Team:Alberta/Project/Promoters & Terminators
From 2009.igem.org
![]() |
|
|
Promoter and Terminator DesignOur project tests the limits to which biology can be standardized. Towards this goal, the endogenous promoter of every essential gene will be replaced with one of seven standard promoters producing different expression levels. The terminator of every essential gene will also be replaced with a standard biobrick terminator. The promoters and terminators are biobrick parts and are currently being functionally tested. To determine which promoter to pair with which gene, microarray expression data from the literature was used. Advantages of standardized promoters include:
|
PromotersThe standardized promoters were based from a series of promoters produced by the 2006 Berkeley iGEM team. These are a series of promoters which have been mutated from the consensus sigma 70 promoter allowing for varying levels of promoter activity to be produced. The promoters can be found here . The following promoters were selected:
|
TerminatorThe part which was used as the universal terminator in our standardized parts list was Bba b1006. This is a bidirectional terminator with 6 nucleotide loop and 8 bp stem which has been shown to terminate transcription 99% of the time (Please see here for terminator characterization information). The sequence of the terminator is: AAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTT |
Modifications To Promoters and TerminatorsAlterations were made to the Anderson collection promoters to allow for use with the BioBytes assembly system. Two restriction sites were removed, and two nucleotides were added to slightly alter the start site of transcription. Both the promoters and terminators had a PstI and XbaI site added allowing for insertion into pAB or pBA. Please see the attached document here for sequence information regarding the modified promoters and terminators. |
Microarray Determination of Standardized PromotersWith a series of standardized promoters and a list of essential genes it is important to be able to compare these to one another and assign the appropriate promoter to each gene. In order to accomplish this, microarray data was used for the E. coli genome under aerobic conditions. The Covert et al 2004 paper was used to determine this information. They looked at a series of gene knockouts under a variety of media conditions and determined the level of transcript for 1010 metabolic genes during the growth phase of the organism. We used the WT data determined a level of each gene's transcript and used this to assign individual promoters to the genes. A list of the literature essential genes with their promoter levels can be found here . These results however are not complete since there are many variables which need to be considered in order to ensure the correct level of transcript is produced. Further research will be required to see the effects of different cellular stages and conditions. |
"


