August
02.08.09, Laura
*Inoculation of pMAL+CAT ligation 9.7., 2.1 in Chloramphenicol
*Inoculation of Strep+Dig, Strep+FluA, His+Dig, His+FluA
03.08.09, Laura, Hannes, Christoph, Gerrit, Sarah, Dieter
*Ni-NTA His purification of Aa AGO
![]() SDS-Gel ; Lanes: Flow through 1, Marker (NEB prestained protein marker broad range #p7708s), flow through 2, flow through 3,flow through 4, Flow through 6, flow through 8, wash 1, wash 2, wash 3 |
![]() SDS-Gel ; Lanes: Marker (NEB prestained protein marker broad range #p7708s), elution 1, e2, e3, e4, e5, e6, e7, e8 |
*plasmid preparation and gel was useless
*digestion of His, Strep, Split-Linker as vectors with AgeI and PstI
*digestion of Dig, FluA, Foki and Foka as inserts with NgoMIV and PstI
*inoculation of His, Strep, Split-Linker, Dig, FluA
*transformation of Foki and Foka
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 |
| pMAL_CAT_clon1 | FreiGEM | 03.08.2009 | 10:37 | 107.35 | 2.147 | 1.119 | Jan 92 | Feb 21 |
| pMAL_CAT_clon2 | FreiGEM | 03.08.2009 | 10:38 | 102.99 | 2.060 | 1.087 | Jan 89 | Feb 13 |
| Strep_Dig_clon1 | FreiGEM | 03.08.2009 | 10:39 | 94.10 | 1.882 | 0.971 | Jan 94 | 02. Okt |
| Strep_Dig_clon2 | FreiGEM | 03.08.2009 | 10:40 | 96.81 | 1.936 | 1.024 | Jan 89 | Feb 15 |
| Strep_FluA_clon1 | FreiGEM | 03.08.2009 | 10:41 | 93.05 | 1.861 | 0.960 | Jan 94 | Feb 16 |
| Strep_FluA_clon2 | FreiGEM | 03.08.2009 | 10:42 | 89.24 | 1.785 | 0.934 | Jan 91 | Feb 16 |
| His_Dig_clon1 | FreiGEM | 03.08.2009 | 10:42 | 104.88 | 2.098 | 1.116 | Jan 88 | 02. Okt |
| His_Dig_clon1 | FreiGEM | 03.08.2009 | 10:43 | 100.67 | 2.013 | 1.055 | Jan 91 | Feb 13 |
| His_FluA_clon1 | FreiGEM | 03.08.2009 | 10:44 | 101.41 | 2.028 | 1.074 | Jan 89 | Feb 17 |
| His_FluA_clon2 | FreiGEM | 03.08.2009 | 10:44 | 91.72 | 1.834 | 0.968 | Jan 89 | Feb 18 |
04.08.09, Sarah, Dieter, Timo, Manuel, Julia
*inoculation of Fok(active) and Fok(inactive) 5 colonies from each plate
*inoculation of Lipocalin (FluA) from the glycerol stock
*dephosphorylation of the digested vectors (His, Strep and Split-Linker) from monday (03.08.)
*agarose gel of the digests (His, Strep, Split-Linker, Lipo (FluA), Anticalin (Dig), Fok(active) and Fok(inactive)), cut the bands, gel extraction
*quick ligation of Fok(active) and Fok(inactive) into Split-Linker
*quick ligation of Lipocalin (FluA) into His and Strep
*quick ligation of Anticalin (Dig) into His and Strep
*transformation of the ligations and additional: test transformation with pUC and the new Xl1Blue competent cells
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 |
| His_09.08.04 | FreiGEM | 04.08.2009 | 14:15 | 55.39 | 1.108 | 0.567 | Jan 95 | 0.13 |
| FokI_09.08.04 | FreiGEM | 04.08.2009 | 14:16 | 0.72 | 0.014 | -0.059 | -0.25 | 0.00 |
| FokI_09.08.04 | FreiGEM | 04.08.2009 | 14:17 | Mai 17 | 0.103 | -0.021 | -4.98 | 0.02 |
| Strep_09.08.04 | FreiGEM | 04.08.2009 | 14:18 | 30.42 | 0.608 | 0.253 | Feb 41 | 0.05 |
| FluA_09.08.04 | FreiGEM | 04.08.2009 | 14:18 | 09. Feb | 0.180 | 0.079 | Feb 28 | 0.02 |
| FokA_09.08.04 | FreiGEM | 04.08.2009 | 14:20 | 20.30 | 0.406 | 0.165 | Feb 47 | 0.06 |
| FokA_09.08.04 | FreiGEM | 04.08.2009 | 14:20 | 18. Jan | 0.360 | 0.141 | Feb 56 | 0.05 |
| Split_09.08.04 | FreiGEM | 04.08.2009 | 14:21 | Sep 92 | 0.198 | 0.109 | Jan 82 | 0.05 |
| Split_09.08.04 | FreiGEM | 04.08.2009 | 14:22 | 56.87 | 1.137 | 0.698 | Jan 63 | 0.11 |
| Dig_09.08.04 | FreiGEM | 04.08.2009 | 14:22 | 24.16 | 0.483 | 0.266 | Jan 81 | 0.05 |
| h2o | FreiGEM | 04.08.2009 | 14:43 | 0.00 | 0.000 | 0.000 | NaN | NaN |
| eb | FreiGEM | 04.08.2009 | 14:44 | -1.01 | -0.020 | -0.012 | Jan 63 | 0.56 |
| Dig Plasmidprep | FreiGEM | 04.08.2009 | 16:09 | 225.85 | 4.517 | 2.337 | Jan 93 | Feb 18 |
| His Plasmidprep | FreiGEM | 04.08.2009 | 16:11 | 254.66 | 5.093 | 2.637 | Jan 93 | Feb 20 |
| Split Plasmidprep | FreiGEM | 04.08.2009 | 16:12 | 330.12 | 6.602 | 3.420 | Jan 93 | Feb 17 |
05.08.09, Hannes, Christoph, Laura, Rüdiger, Gerrit, Isabel
*transformation of Aa and Tt into BL21de3 --> 37°C o/n
*ordered oligos from sigma-aldrich - for Fok control
- for AGOs
- new 4mer, 8mer and 12mer Linkers
*order from Fermentas (5th floor) - NTP R0481
- T7 RNA Polymerase EPO111
- RiboRuler RNA Ladder High Range SM1823
*poured LB-Kan plates --> cold room
*hybridized Fok-control oligos 1 and 2 and M13 DNA -> digested DNA with Fok -> made analytical gel
*Made a new updated 3d model of our enzyme.
-aligned manually dna to make it bigger
-added Fluoreszin/lipocalin structure to model
-added digoxigenin/lipocalin structure to model
-measured distances from fok parts to lipcalins to estimate linker length: probably 5 AA are enough.
-found out positions for oligo-tags fluoresceine and digoxigenin by visual inspection
-found company [http://www.purimex.com/de/index.htm] that can tag oligos in the middle
-created templates for oligos: 3variations: dioligo end tags, dioligo end+middle tag, monooligo end+middle tag. see picture
pictures:
color code:
-green: fokI active domains
-pink:active AA/base where fok cuts
-yellow: possible placed to tag oligo
-red dna:oligo
-blue dna: dna that is to cut
-white:digoxigenin+lipcalin
-turquoise: fluoresceine+lipocalin
![]() Figure 1: Gesamtkonstrukt anticalin bottom |
![]() Figure 1: Gesamtkonstrukt anticalin top |
-diologoA 3'dig -20bp long
-dioligoA 3'fluo cut 7/8 from 5' -16bp long
-dinooligoB dig intern 15 from 5' cut 22/23 from 5' -30bp long
-dioligoB 5'fluo -15bp long
-monooligo 3'fluo dig intern 14 from 5' cut 21/22 from 5' -30bp long
we may need to use diologoA on ice, because it might be fragile because so short.
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 |
| FokA I | FreiGEM | 05.08.2009 | 10:21 | 182.39 | 3.648 | 1.975 | Jan 85 | Jan 65 |
| FokA II | FreiGEM | 05.08.2009 | 10:22 | 213.31 | 4.266 | 2.288 | Jan 86 | Jan 97 |
| FokI I | FreiGEM | 05.08.2009 | 10:23 | 191.10 | 3.822 | 2.148 | Jan 78 | Jan 28 |
| FokI II | FreiGEM | 05.08.2009 | 10:24 | 292.92 | 5.858 | 3.301 | Jan 77 | Jan 30 |
| FreiGEM | 05.08.2009 | 13:18 | 0.00 | 0.000 | 0.000 | NaN | NaN | |
| Fok_Kontrolloligo1 | FreiGEM | 05.08.2009 | 13:18 | 1676.99 | 33.540 | 16.535 | 02. Mrz | Feb 58 |
| Fok_Kontrolloligo2 | FreiGEM | 05.08.2009 | 13:19 | 1584.88 | 31.698 | 17.847 | Jan 78 | Feb 54 |
06.08.09, Sarah, Manuel, Max, Dieter, Rüdiger, Gerrit
Nanodrop Data
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 |
| Dig+Strep Klon 1 | FreiGEM | 06.08.2009 | 11:01 | 366.2 | 7.324 | 3.865 | 1.89 | 2.16 |
| Dig+Strep Klon 2 | FreiGEM | 06.08.2009 | 11:02 | 258.87 | 5.177 | 2.717 | 1.91 | 2.24 |
| Dig+Strep Klon 3 | FreiGEM | 06.08.2009 | 11:03 | 248.28 | 4.966 | 3.027 | 1.64 | 1.12 |
| FluA+His-Klon1-06.08.09 | FreiGEM | 06.08.2009 | 11:04 | 308.64 | 6.173 | 3.237 | 1.91 | 2.04 |
| FluA+His-Klon2-06.08.09 | FreiGEM | 06.08.2009 | 11:05 | 361.37 | 7.227 | 3.794 | 1.91 | 2.17 |
| FluA+His-Klon3-06.08.09 | FreiGEM | 06.08.2009 | 11:06 | 360.45 | 7.209 | 3.822 | 1.89 | 2.07 |
| FluA+Strep-Klon1-06.08.09 | FreiGEM | 06.08.2009 | 11:07 | 345.21 | 6.904 | 4.396 | 1.57 | 1 |
| FluA+Strep-Klon2-06.08.09 | FreiGEM | 06.08.2009 | 11:08 | 330.12 | 6.602 | 3.477 | 1.9 | 2.18 |
| FluA+Strep-Klon3-06.08.09 | FreiGEM | 06.08.2009 | 11:09 | 368.91 | 7.378 | 3.908 | 1.89 | 2.1 |
| Dig+His-Klon1-06.08.09 | FreiGEM | 06.08.2009 | 11:10 | 381.02 | 7.62 | 4.014 | 1.9 | 2.09 |
| Dig+His-Klon2-06.08.09 | FreiGEM | 06.08.2009 | 11:11 | 489.08 | 9.782 | 5.174 | 1.89 | 2.17 |
| Dig+His-Klon3-06.08.09 | FreiGEM | 06.08.2009 | 11:11 | 407.31 | 8.146 | 4.354 | 1.87 | 1.91 |
| FokI+Split-Klon1-06.08.09 | FreiGEM | 06.08.2009 | 11:12 | 389.6 | 7.792 | 4.123 | 1.89 | 2.12 |
| FokI+Split-Klon2-06.08.09 | FreiGEM | 06.08.2009 | 11:13 | 411.18 | 8.224 | 4.356 | 1.89 | 1.81 |
| FokI+Split-Klon3-06.08.09 | FreiGEM | 06.08.2009 | 11:14 | 271.52 | 5.43 | 2.903 | 1.87 | 1.72 |
| FokI+Split-Klon3neu-06.08. | FreiGEM | 06.08.2009 | 11:15 | 358.5 | 7.17 | 3.765 | 1.9 | 2.18 |
| FokA+Split-Klon1-06.08.09 | FreiGEM | 06.08.2009 | 11:16 | 254.78 | 5.096 | 2.753 | 1.85 | 1.7 |
| FokA+Split-Klon1neu-06.08 | FreiGEM | 06.08.2009 | 11:17 | 367.15 | 7.343 | 3.868 | 1.9 | 2.09 |
| FokA+Split-Klon2-06.08.09 | FreiGEM | 06.08.2009 | 11:17 | 336.04 | 6.721 | 3.529 | 1.9 | 1.86 |
| FokA+Split-Klon4-06.06.09 | FreiGEM | 06.08.2009 | 11:18 | 362.16 | 7.243 | 3.812 | 1.9 | 2.06 |
*looked for oligo sequences according to the templates we defined yesterday
Sequence checked with http://www.basic.northwestern.edu/biotools/oligocalc.html
M13
ATTENTION: Gentle does not remember the positions of sequences. Each time you open the program the 0 position of your DNA is set somewhere else!
5'-CAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATA-3'
oligo
3'-GTTTGACCTTGTTGTGAGTTGGGATAG|AGCCCGATAAGAAAACTAAATAT-5'
here the sequences to copy(without colors)
monooligo 3'fluo dig intern 14 from 5' cut 21/22 from 5' 30bp
TTGGGATAG|AGCCCGATAAGAAAACTAAAT
~151€
dioligoB dig intern 15 from 5' cut 22/23 from 5' 30bp
TGGGATAG|AGCCCGATAAGAAAACTAAATA
~71€
diologoA 5'dig cut 8/9 from 5' 16bp
TGGGATAG|AGCCCGAT
~30€
Double ammount: dioligoAB 5'fluo
TGACCTTGTTGTGAGT
min 138€
Costs indicated are just rough estimates.
Total costs will be around 400€
* theoretical cloning and upload of the Fok cloning steps
Wet Lab
- Plasmid preparation of
- Dig + Strep clones 1-3
- Dig + His 1-3
- FluA + Strep 1-3
- FluA + Dig 1-3
- Foki + Split 1-3
- Foka + Split 1,2,4
- Digestion of his-Dig, Strep-Dig, His-FluA, Strep-FluA
- Gel Extraction of the inserts and pEX
- Ligation of
- His+Dig with pEx
- Strep+Dig with pEx
- His+FluA with pEx
- Strep+FluA with pEx
- transformation of ligations
07.08.09, Gerrit, Sarah, Max, Sascha, Isabel, Rüdiger, Manuel
*Labtalk: -we should take the pictures of the agarose-gels always with the camera that's connected to the pc (opposite the gel cutting room) and save them!!
-the expression of the Fok constructs could be on wednesday. We should do a 2 liter expression with His-Dig-Linker-Fok(active) and with His-FluA-Linker-Fok(inactive), therefore we need schikanekolben, places on the shaker, LB-medium, IPTG and Antibiotics (these things should be prepared on monday)
-sponsoring team is increased by Julia and Dieter
-we should do a test expression with our pEx (pMal+CAT), ask Janina
-we should count the colonies on the test transformation (4°C freezer)
*plasmid preparation of -pEx clone 1 and 2
-Tt in BL21de3 clone 1 and 2
-Aa in BL21de3 clone 1 and 2
*inoculation of - pEx-His-Dig
- pEx-Strep-Dig
- pEx-His-FluA
- pEx-Strep-FluA
*hybridisation of M13 ssDNA and the 2 Fok-Oligos (cutting distance: 200bq)
*digestion of the M13 ssDNA with FokI (unmodified): 37°C room over night
* we made 20 Ampicillin aliquots (-20 freezer)
*Nanodrop data
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 |
| pEx Klon 2 | FreiGEM | 07.08.2009 | 09:36 | 73.43 | 1.469 | 0.844 | Jan 74 | Jan 98 |
| pEx Klon 4 | FreiGEM | 07.08.2009 | 09:37 | 87.15 | 1.743 | 0.934 | Jan 87 | 02. Mai |
| Tt in BL21de3 Klon1 | FreiGEM | 07.08.2009 | 09:38 | 59.00 | 1.180 | 0.631 | Jan 87 | 02. Jun |
| Tt in BL21de3 Klon 2 | FreiGEM | 07.08.2009 | 09:39 | 119.63 | 2.393 | 1.291 | Jan 85 | Jan 85 |
| Aa in BL21de3 Klon 1 | FreiGEM | 07.08.2009 | 09:39 | 121.81 | 2.436 | 1.343 | Jan 81 | Jan 43 |
| Aa in BL21de3 Klon 1 | FreiGEM | 07.08.2009 | 09:40 | 56.36 | 1.127 | 0.623 | Jan 81 | 2.00 |
08.08.09, Manuel
*plasmid preparation clones 1-3/6 of - pEx-His-Dig
- pEx-Strep-Dig
- pEx-His-FluA
- pEx-Strep-FluA
*digestion with AgeI and PstI (37°C room over night): - pEx-His-Dig
- pEx-Strep-Dig
- pEx-His-FluA
- pEx-Strep-FluA
*digestion with NgoMIV and PstI (37°C room over night): - Split-Fok(active)
- Split-Fok(inactive)
*I put the digestion of the M13 ssDNA with FokI (unmodified Fok)into the -20°C freezer. I'll run the gel tomorow.
*Nanodrop data
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 |
| pEx-His-Dig 1 | FreiGEM | 08.08.2009 | 08:47 | 100.84 | 2.017 | 1.082 | Jan 86 | 02. Apr |
| pEx-His-Dig 2 | FreiGEM | 08.08.2009 | 08:48 | 110.14 | 2.203 | 1.101 | 2.00 | 0.36 |
| pEx-His-Dig 3 | FreiGEM | 08.08.2009 | 08:49 | 79.18 | 1.584 | 0.844 | Jan 88 | Jan 85 |
| pEx-Strep-Dig 1 | FreiGEM | 08.08.2009 | 08:50 | 81.79 | 1.636 | 0.867 | Jan 89 | 02. Jan |
| pEx-Strep-Dig 2 | FreiGEM | 08.08.2009 | 08:50 | 66.66 | 1.333 | 0.716 | Jan 86 | Jan 38 |
| pEx-Strep-Dig 3 | FreiGEM | 08.08.2009 | 08:51 | 78.98 | 1.580 | 0.832 | Jan 90 | Jan 87 |
| pEx-His-FluA 1 | FreiGEM | 08.08.2009 | 08:52 | 83.12 | 1.662 | 0.865 | Jan 92 | Jan 74 |
| pEx-His-FluA 2 | FreiGEM | 08.08.2009 | 08:52 | 116.43 | 2.329 | 1.218 | Jan 91 | Jan 88 |
| pEx-His-FluA 3 | FreiGEM | 08.08.2009 | 08:53 | 89.44 | 1.789 | 0.976 | Jan 83 | Jan 47 |
| pEx-Strep-FluA 1 | FreiGEM | 08.08.2009 | 08:54 | 94.09 | 1.882 | 1.002 | Jan 88 | Jan 81 |
| pEx-Strep-FluA 2 | FreiGEM | 08.08.2009 | 08:55 | 91.28 | 1.826 | 0.981 | Jan 86 | Jan 79 |
| pEx-Strep-FluA 3 | FreiGEM | 08.08.2009 | 08:55 | 78.36 | 1.567 | 0.823 | Jan 90 | Jan 98 |
09.08.09, Manuel
*plasmid preparation of the pEx::His/Strep-Dig/FluA
*digestion of the pEx::His/Strep-Dig/FluA plasmids with PstI and AgeI
*digestion of the pMA::Split-Fok(active/inactive) with NgoMIV and PstI
*agarose gel of both digestions, cut bands, gel extraction
*ligation (all combinations)
*transformation into XL1blue
*prepared a startup culture for the isolation of M13 ssDNA
*Nanodrop data
| Sample ID | User ID | Date | Time | ng/ul | A260 | A280 | 260/280 | 260/230 |
| Split-FokA Gelel. | FreiGEM | 09.08.2009 | 09:38 | 13,37 | 0,267 | 0,12 | 2,23 | 0,06 |
| pEx-His-Dig Gelel. | FreiGEM | 09.08.2009 | 09:39 | 19,85 | 0,397 | 0,228 | 1,74 | 0,07 |
| pEx-Strep-Dig Gelel. | FreiGEM | 09.08.2009 | 09:40 | 10,42 | 0,208 | 0,09 | 2,31 | 0,08 |
| pEx-His-FluA Gelel. | FreiGEM | 09.08.2009 | 09:41 | 16,22 | 0,324 | 0,16 | 2,03 | 0,07 |
| pEx-His-FluA Gelel. | FreiGEM | 09.08.2009 | 09:41 | 31,72 | 0,634 | 0,384 | 1,65 | 0,15 |
| pEx-His-FluA Gelel. | FreiGEM | 09.08.2009 | 09:42 | 11,45 | 0,229 | 0,126 | 1,81 | 0,06 |
10.08.09, Manuel,Julia,Sarah,Isabel,Rüdiger,Christoph
*Prepared Äkta for size exclusion chromatographie
*Designed possible sequenz based on the RSV integrase catlytic domain to exchange PIWI-domain in the Aa AGO
*Prepared LB-Medium for the expression of Fok-constructs (5L)
*Counted colonies on the test transformation plates
*Inoculation of final constructs in XL1 Blue
*run a agarose gel of the digested and undigested M13 phage DNA
*Sequenzing of : His-Dig (clone 2), Strep-Dig (clone 1), FluA-His (clone 2), FluA-Strep (clone 3), FokI-Split (clone 2), FokA-Split (clone 2) with the "sebi_fwd" primer and : pEX-His-Dig (clone 2), pEX-Strep-Dig (clone 1), pEX-His-FluA (clone 2), PEX-Strep-FluA (clone 1) wit pQE-FP primer
*hybridisation of the new arrived Linker-Oligos
*digestion of the pEX-Vector (NgoM4 and Age1)
*Searched new Oligos for M13:
To order from: http://www.purimex.com/de/index.htm
Sequence checked with http://www.basic.northwestern.edu/biotools/oligocalc.html
Searching scheme:
M13
5’-SnnnnnnnnnnnnnSnSnnnnnSS|SSnnnnSRSnnnnnnnnnnnSS -3'
Oligo
3'-SnnnnnnnnnnnnnSnSnnnnnSS|SSnnnnSRSnnnnnnnnnnnSS -5'
- 50% GC-content
- no complementarity
- no hairpins
Best result:
M13
5'CCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTAACATGG-3'
Oligo
3'GGGAATACTAACTGGCAGACGCGG|AGCAAGGCCGATTCATTGTACC-5'
monooligo 3'fluo dig intern 14 from 5' cut 21/22 from 5' 30bp
CAGACGCGG|AGCAAGGCCGATTCATTGTAC
~151€
dioligoB dig intern 15 from 5' cut 22/23 from 5' 30bp
AGACGCGG|AGCAAGGCCGATTCATTGTACC
~71€
diologoA 5'dig cut 8/9 from 5' 16bp
AGACGCGG|AGCAAGGC
~30€
Double ammount: dioligoAB 5'fluo 16bp
GGGAATACTAACTGGC
min 138€
Y: C or T [http://de.wikipedia.org/wiki/Pyrimidin Pyrimidin]
R: A or G [http://de.wikipedia.org/wiki/Purin Purin]
S: G oder C engl. strong (starke) [http://de.wikipedia.org/wiki/Wasserstoffbr%C3%BCckenbindung Wasserstoffbrückenbindung]
|: Cuttingsite
DIG-tag
Fluo-tag
Costs indicated are just rough estimates.
Total costs will be around 400€
20% Neukundenrabatt
Base: 0,45€
3’fluoCPG: 80€
5’amino: 16€
DIG: 15€
3xHplc 24€
Intern Amino: 56€
5’Fluo: ?
11.08.09 Manuel, Max, Julia, Christoph, Rüdiger
* plasmid preparation of the final constructs
* made glycerol stocks of the final constructs (in XL1Blue)
* send final constructs to sequencing
* transformation of the final constructs into the T7 strain for the expression
* Inoculation of ER2738
* Manual structure alignment of the RSV and HIV1 integrase catalytic domaine. Successfull replacement would require majour changes in conformation..
![]() |
![]() |
*Trafo:
100µl T7 with HDI 1µl and HDA 1µl
100µl Bl21 Gold3 with HDI 1µl and HDA 1µl
12.08.09, Sarah, Isabel, Rüdiger, Christoph, Hannes
*made 8l LB-medium (search in AG Graumann)
*inoculation of the final constructs (T7 is unusable for the expression)
*preparation of the startup cultures for the test expression (inoculation of XL1 Blue glycerol stock containing the plasmid, transformation of pEX and T7/BL21)
*Phage breeding
*made binding buffer for the expression (agreed with Sven)
*digoxigenin http://de.wikipedia.org/wiki/Digoxigenin
*fluorescein http://de.wikipedia.org/wiki/Fluorescein
*reworked 3d model: cutting site is moved 2 bases towards 3'
*sent information about linker to purimex
*ordered new short linker: 5'3': CTAGAGGTGGTTCTGGTA 3'5': CCGGTACCAGAACCACCT
*ordered 500g Agarose for 215 € from Bioline
* size exclusion chromatography of Aa AGO (Äkta)
![]() |
13.08.09, Hannes, Manuel, Max
*SDS gel of protein fractions (AGO Aa) after size exclusion chromatography [[Image:Freiburg09_090814_SDS_Aa_nach_Aekta003.jpg|none|thumb|SDS-Gel ; Lanes: Marker (NEB prestained protein marker broad range #p7708s), fraction 1 (after size exclusion), fraction 2, fraction 3, fraction 4, fraction 5, fraction 6, fraction 7, fraction 8, fraction 22|400x400px]] [[Image:Freiburg09_090814_SDS_Aa_wasch_elu_vor_Aekta004.jpg|none|thumb|SDS-Gel ; Lanes: Marker (NEB prestained protein marker broad range #p7708s), fraction 70 (after size exclusion), washing fraction 2 (after Ni-NTA column), washing fraction 3 (after Ni-NTA column), thawed elution fraction from pool 1-4 (after Ni-NTA column)|400x400px]]
*glycerol stocks of pEx-His-Dig-Split-Fok (active and inactive) in BL21 de3 cells
*protein expression of His-Dig-FokA in BL21 de3 (2 litres), His-Dig-FokI in BL21 de3 (2 litres) and pEX in XBlue (1 litre) - 2l (1l) LB+Amp were inoculated with startup culture of His-Dig-FokI and His-Dig-FokA to OD600 0.1
- cells were grown to OD600:
FokA1: 0.58
FokA2: 0.66
FokI1: 0.58
FokI2: 0.58
pEX: 0.42
- cells were induced with 0.7mM IPTG and grown at 28°C for 4.5 hours.
- cells were harvested at OD600:
FokA1: 1.7
FokA2: 4.4
FokI1: 3.1
FokI2: 3.3
pEX: 1.1
--> centrifugation at 4000rpm for 15 minutes at 4°C, pellets in freezer bags at -80°C.
14.08. Hannes
Fraction 16-27 of size exclusion chromatography frozen at -80°C
15.08 Rüdiger
this is an unfinished version of the logo i'm creating:
[[Image:Freiburg09_logo-draft.jpg|none|thumb|Alogo_draft|400x400px]]
17.08 Manu, Rüdiger, Laura
*gel and gelextraction of pEx digested with XbaI and PstI
*digest of Foka (30.06.), Split Linker 2 (unidgested from 04.08.) and pMA-Dig
*gel and gel extraction (pMA digest has to be repeated tomorrow, slice got lost)
*sequencing of Foka-Split-Linker clon1 and 4 (from 06.08.) and Foka
*ligation of
- Foka and Split Linker 1 (digested from 04.08.)
- Foka and Split Linker 2 (undigested from 04.08.)
- pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
*Transformation of
- Foka and Split Linker 1 (digested from 04.08.)
- Foka and Split Linker 2 (undigested from 04.08.)
- pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- Fok active (from original tube)
17.08 Isabel
* phage M13 particle precipitation
* phage M13 ssDNA isolation (12x50µl)
18.08 Isabel, Rüdiger, Laura, Christoph, Max, Dieter, Manu
* link for parts submitted by berkley 2008:
http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=UC_Berkeley
* transformations of Foka/Split linker and pEX clon2.2 have been successful->inoculation was done
* transformations of
- pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- Foka (original)
haven't been successful so we repeated digests of pEx, His-Dig, His-FluA, Strep-Dig and Strep-FluA again
*Janina ordered phagemid oligos (to insert dummies in the phagemid vector)
*gel and gel extraction of pEx, His-Dig, His-FluA, Strep-Dig and Strep-FluA and pMA
*ligation of
- pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- pMA and Short linker
*transformation of
- pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- pMA and Short linker
19.08 Isabel, Julia, Rüdiger, Manu, Christoph
* inoculation of pEx+His FluA, pEX+Strep FluA, pMA+short linker
* Trafo in RV cells: pMA+HisDig, pMA+HisFluA, pMA+StrepDig, pMA+StrepFluA, pEX
* plasmid preparation
* sequencing
* TrisHCl pH8
* MgCl2
* digest of pMA-His, pMA-Strep, pMA-Dig
* designed and ordered primers for submitting wt Aa Ago as biobrick part (with out EcoRI site in the gene and with standard iGEM cloningsites via megaprimer technic):
Usage:
1: a-start b-middel
2: a-middel b-back
A, Primer start: GGTTTAAAAGAGCTTCCTTTCCCATCTAGAAGCGGCCGCGAATTC
A, Primer middle: TCGTTCATTTTGAAATCCCCTGAACTCTTCTTCACCCACTCTTTTCAGTT
A, Primer back : CTGCAGCGGCCGCTACTAGTATTATTAAAGCCAGTACATAATATCACCTTCC
B, Primer start: GAATTCGCGGCCGCTTCTAGATGGGAAAGGAAGCTCTTTTAAACC
B, primer middle: AACTGAAAAGAGTGGGTGAAGAAGAGTTCAGGGGATTTCAAAATGAACGA
B, primer back: GGAAGGTGATATTATGTACTGGCTTTAATAATACTAGTAGCGGCCGCTGCAG
20.08. Hannes, Laura, Rüdiger, Christoph, Manu
*Plasmid prep of pMA_Shortlinker clon 1 and 2, pEx_Strep_FluA 1 & 2, pEx_His_FluA 1&2 and glycerolstock stocks
*Preparative Gel of restriction digest pMA_His, pMA_Strep and pMA_Dig (9:00, Manu)
purpose: get single fragment Dig_NgoMIV_NgoMIV_PstI and vectors pMA_His_AgeI_PstI and pMA_Strep_AgeI_PstI
Gel preparation: 100 ml TAE buffer KuKlab stock, 1 g Agarose (Gibco), 2x Microwave, 6 µl Ethidiumbromide Kuklab stock (comment: unknown Ethidiumbromide concentration)
Loading
lane1: NEB 1 kBp ladder iGEM labstock
lane3: 30 µl pMA_Strep_AgeI_PstI from 09.07.09
lane5: 30 µl Dig_NgoMIV_NgoMIV_PstI digest from 22.07.09
lane7: 30 µl pMA_Strep_AgeI_PstI from 09.07.09
Gel run: 100V, 45 min
Gel picture with Biorad imgager
15.08 Rüdiger
this is an unfinished version of the logo i'm creating: [[Image:Freiburg09_logo-draft.jpg|none|thumb|Alogo_draft|400x400px]]17.08 Manu, Rüdiger, Laura
*gel and gelextraction of pEx digested with XbaI and PstI
*digest of Foka (30.06.), Split Linker 2 (unidgested from 04.08.) and pMA-Dig
*gel and gel extraction (pMA digest has to be repeated tomorrow, slice got lost)
*sequencing of Foka-Split-Linker clon1 and 4 (from 06.08.) and Foka
*ligation of - Foka and Split Linker 1 (digested from 04.08.)
- Foka and Split Linker 2 (undigested from 04.08.)
- pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
*Transformation of - Foka and Split Linker 1 (digested from 04.08.)
- Foka and Split Linker 2 (undigested from 04.08.)
- pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- Fok active (from original tube)
17.08 Isabel
* phage M13 particle precipitation
* phage M13 ssDNA isolation (12x50µl)
18.08 Isabel, Rüdiger, Laura, Christoph, Max, Dieter, Manu
* link for parts submitted by berkley 2008: http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2008&group=UC_Berkeley
* transformations of Foka/Split linker and pEX clon2.2 have been successful->inoculation was done
* transformations of - pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- Foka (original)
haven't been successful so we repeated digests of pEx, His-Dig, His-FluA, Strep-Dig and Strep-FluA again
*Janina ordered phagemid oligos (to insert dummies in the phagemid vector)
*gel and gel extraction of pEx, His-Dig, His-FluA, Strep-Dig and Strep-FluA and pMA
*ligation of - pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- pMA and Short linker
*transformation of - pEx and His-Dig
- pEx and His-FluA
- pEx and Strep-Dig
- pEx and Strep-FluA
- pMA and Short linker
19.08 Isabel, Julia, Rüdiger, Manu, Christoph
* inoculation of pEx+His FluA, pEX+Strep FluA, pMA+short linker
* Trafo in RV cells: pMA+HisDig, pMA+HisFluA, pMA+StrepDig, pMA+StrepFluA, pEX
* plasmid preparation
* sequencing
* TrisHCl pH8
* MgCl2
* digest of pMA-His, pMA-Strep, pMA-Dig
* designed and ordered primers for submitting wt Aa Ago as biobrick part (with out EcoRI site in the gene and with standard iGEM cloningsites via megaprimer technic): Usage: 1: a-start b-middel 2: a-middel b-back A, Primer start: GGTTTAAAAGAGCTTCCTTTCCCATCTAGAAGCGGCCGCGAATTC
A, Primer middle: TCGTTCATTTTGAAATCCCCTGAACTCTTCTTCACCCACTCTTTTCAGTT
A, Primer back : CTGCAGCGGCCGCTACTAGTATTATTAAAGCCAGTACATAATATCACCTTCC
B, Primer start: GAATTCGCGGCCGCTTCTAGATGGGAAAGGAAGCTCTTTTAAACC
B, primer middle: AACTGAAAAGAGTGGGTGAAGAAGAGTTCAGGGGATTTCAAAATGAACGA
B, primer back: GGAAGGTGATATTATGTACTGGCTTTAATAATACTAGTAGCGGCCGCTGCAG
20.08. Hannes, Laura, Rüdiger, Christoph, Manu
*Plasmid prep of pMA_Shortlinker clon 1 and 2, pEx_Strep_FluA 1 & 2, pEx_His_FluA 1&2 and glycerolstock stocks
*Preparative Gel of restriction digest pMA_His, pMA_Strep and pMA_Dig (9:00, Manu)
purpose: get single fragment Dig_NgoMIV_NgoMIV_PstI and vectors pMA_His_AgeI_PstI and pMA_Strep_AgeI_PstI Gel preparation: 100 ml TAE buffer KuKlab stock, 1 g Agarose (Gibco), 2x Microwave, 6 µl Ethidiumbromide Kuklab stock (comment: unknown Ethidiumbromide concentration) Loading lane1: NEB 1 kBp ladder iGEM labstock
lane3: 30 µl pMA_Strep_AgeI_PstI from 09.07.09
lane5: 30 µl Dig_NgoMIV_NgoMIV_PstI digest from 22.07.09
lane7: 30 µl pMA_Strep_AgeI_PstI from 09.07.09
Gel run: 100V, 45 min
Gel picture with Biorad imgager
| [[Image:Freiburg09_200809_verdau_splitfokA_splitfokI_HisfluA.JPG|none|thumb|preparative gel of 100bp marker of NEB and digested inserts pMAsplitFoka,pMASplitFoki and pEXHisFluA|300x300px]] | [[Image:Freiburg09_200809_verdau_strep_fluA_shortlinker.JPG|none|thumb|preparative gel of 1kb Marker, pExStrepFluA and pMAShortlinker|300x300px]] |
Gel run worked
Observed bands
pMA_Strep_AgeI_PstI and pMA_Strep_AgeI_PstI gives one main band of approximately 2500 bp Dig_NgoMIV_NgoMIV_PstI digest gives two bands at 2000 Bp and 500 Bp
*Restriction digest of several plasmids (11:00, Laura, Hannes) purpose: digest to get fusion proteins Plasmid: 10 µl pMA_Split_Foka plasmid prep from 19.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl NgoMIV from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock
Plasmid: 10 µl pMA_Split_Foki plasmid prep from 06.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl NgoMIV from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock Plasmid: 10 µl pEx_His_FluA plasmid prep from 20.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock
Plasmid: 10 µl pEx_Strep_FluA plasmid prep from 20.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock
Plasmid: 10 µl pMA_Shortlinker plasmid prep from 20.08.2009 water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock
Incubation: 2 h in 37°C room
*gel extraction of digests
*Ligation and transformation of pMA_His and pMA_Strep with Dig (Manuel 11:00) Vector: 3 µl pMA_His_AgeI_PstI from 09.07.09
Insert: 6 µl Dig_NgoMIV_NgoMIV_PstI from 22.07.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_Strep_AgeI_PstI from 09.07.09
Insert: 6 µl Dig_NgoMIV_NgoMIV_PstI from 22.07.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Preparative Gel of restriction digest pMA_Split_Foka and pMA_Split_Foki, pEx_Strep_FluA, pEx_Strep_FluA, pMA_Shortlinker (14:00, Hannes, Laura)
purpose: get single fragments
Gel preparation: 50 ml TAE buffer KuKlab stock, 0.5 g Agarose (Gibco), 2x Microwave, 2.5 µl Ethidiumbromide Kuklab stock (comment: unknown Ethidiumbromide concentration) Loading 1st gel: lane1: NEB 100 Bp ladder iGEM labstock
lane3: 30 µl pMA_Split_Foka from 19.08.2009
lane5: 30 µl pMA_Split_Foki from 06.08.2009
lane7: 30 µl pEx_His_FluA from 20.08.2009
2nd gel:
lane1: 1kbp ladder iGEM labstock
lane3: pEx_Strep_FluA from 20.08.2009
lane5: pMA_Shortlinker plasmid prep from 20.08.2009
Gel run: 100V, 45 min
Gel picture with Biorad imgager
picture... Outcome:
Gel run worked
*gel extraction of digests
*Sequencing of pEx_His_FluA, pEx_Strep_FluA, pMA_Shortlinker
*Ligation and transformation of fragments and vectors (17:00 Laura, Hannes) Vector: 3 µl pEx_His_FluA
Insert: 6 µl Split_Foka
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_His_FluA
Insert: 6 µl Split_Foki
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_Strep_FluA
Insert: 6 µl Split_Foka
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_Strep_FluA
Insert: 6 µl Split_Foki
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_Shortlinker
Insert: 6 µl Split_Foka
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_Shortlinker
Insert: 6 µl Split_Foki
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Inocluation of pMA+HisDig, pMA+HisFluA, pMA+StrepDig, pMA+StrepFluA, pEX
21.08. Hannes, Laura, Rüdiger, Christoph, Manu
*Plasmid preparation of pMA+HisDig, pMA+HisFluA, pMA+StrepDig, pMA+StrepFluA, pEX Klon 100, 1
2eppis of each line. Cells from Trafo from 20.08.09 were pelleted down, supernatant removed.
Then plasmid purification used QIAprep Spin Miniprep Kit:
All centrifugation steps are carried out at 13000 rpm
0. Centrifuge cells at 8000 rpm for 3 min; Discard supernatant
1. Resuspend pelleted bacterial cells in 250µl Buffer P1 and transfer to a microcentrifuge tube.
2. Add 250 µl Buffer P2 and mix thoroughly by inverting the tube 4-6 times.
3. Add 350 µl Buffer N3 and mix immediately and thoroughly by inverting the tube 4-6 times.
4. Centrifuge for 10 min at 13000 rpm in a table-top microcentrifuge.
5. Apply the supernatant (from step 4) to the QIAprep spin column by decanting or pipetting.
6. Centrifuge for 30-60 s. Discard the flow-through.
7. Recommended: Wash the QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30-60 s. Discard the flow-through.
8. Wash QIAprep spin column by adding 0.75 ml Buffer PE and centrifuging for 30-60 s.
Here a mistace happened, since I added PE buffer that wasnt diluted in alcohol to probes pMA+StrepFluA, pEX Klon 100, 1. I removed it
trough vacuuum pump and added the correct. However results are impaired.
9. Discard the flow-through, and centrifuge for an additional 1 min to remove residual wash buffer.
10. To elute DNA, place the QIAprep column in a clean 1.5 ml microcentrifuge tueb. Add 50 µl elution buffer (EB) to the center of each QIAprep spin
column, let stand for 1 min, and centrifuge for 1 min.
Results of Plasmid Prep: (insert Nanodrop data here)
*Results of Sequencing: - pEx_CAT 2.2 clones 1 and 2(plasmid prep of 19.08.09) positive
- Split-Foka clones 1&2 (plasmid prep of 19.08) was positive
- pEx_HisFluA clone 1 was negative (it it turned out to be His-Tag_Fok)
- pEx_StrepFluA clone 1 turned out to be His-Tag_FluA -> it's now renamed to pEx_HisFluA
- pMA_Short-Linker was positive but vector didn't match with pMA
*Transformations pEx_HisFluA_SplitFoki/a (StrepFluA renamed in HisFluA), pMA_Short-Linker_Foki/Foka have grown very well ->Inoculation will be done on sunday by Rüdiger
*simulated Hybridization of M13 phage DNA, simulated digest of "hybridized" M13 DNA
*analytical gel of hybridized, digested and untreated M13 DNA [[Image:Freiburg09 210809_m13dnatest.JPG|none|thumb|analytical gel of of hybridized, digested and untreated M13 DNA|]]
*Sequencing of pMA+HisDig, pMA+HisFluA, pMA+StrepDig, pMA+StrepFluA
*ordered AGO oligos and the new fok monomere 36aa linker oligo
23.08. Rüdiger
*picked 3 colonies from following strands and put them into LB amp, 37°C overnight iGEM RV308 pEX Strep FluA+Split Foka 20.08 Rest
iGEM RV308 pEX Strep FluA+Split Foka 20.08
iGEM RV308 pMA Strep Dig 20.08 Rest
iGEM RV308 pMA Strep Dig 20.08 Rest
iGEM RV308 pMA His Dig 20.08 Rest
iGEM RV308 pMA His Dig 20.08
iGEM RV308 pEX Strep FluA+Split Foki 20.08 Rest
iGEM RV308 pEX Strep FluA+Split Foki 20.08
iGEM RV308 pMA short linker+ Foki 20.08
iGEM RV308 pMA short linker+ Foki 20.08 Rest
iGEM RV308 pMA short linker+ Foka 20.08
iGEM RV308 pMA short linker+ Foka 20.08 Rest
iGEM RV308 pEX His FluA+Split Foka 20.08 Rest
iGEM RV308 pEX His FluA+Split Foka 20.08
iGEM RV308 pEX His FluA+Split Foki 20.08 Rest
iGEM RV308 pEX His FluA+Split Foki 20.08
annotation: HisFluA... turned out to be HisFok -> discared inoculations, StrepFluA turned out to be HisFluA -> renamed samples
*ordered Fok monomere linker to connect His/strep+split Foka with split Foki.
24.08. Manu, Rüdiger, Laura, Gerrit
*Fok controls with M13 DNA - simulated Hybridization of M13 DNA - hybridization with Fok control 2 oligo - hybridization with Fok control 2 & 3 oligos
*digest of -DNA without oligos and Fok (4°C)
-DNA without oligos and Fok (37°C)
-DNA with Fok2 oligo and Fok (37°C)
-DNA with both oligos and Fok (37°C)
*analyticel gel with different test [[Image:Freiburg09 240809_m13dnatest.JPG|none|thumb|analytical gel of original FokI control digest of M13 DNA|300x300px]]
-> in presence of Fok M13 DNA seems to get hackled
*plasmidpreparation of inoculated probes pEX His FluA+Split Foka clon1
pEX His FluA+Split Foka clon2
pEx His FluA+Split Foki clon1
pEx His FluA+Split Foki clon2
pMA Strep Dig clon1
pMA Strep Dig clon2
pMA His Dig clon2 Rest
pMA His Dig clon3
pEX Strep His+Split Foki clon1
pEX Strep His+Split Foki clon2
pMA short linker+ Foki clon1
pMA short linker+ Foki clon2
pMA short linker+ Foka clon1
pMA short linker+ Foka clon2
-> send one clon of each part to sequencing
*digest of pMAHisDig and pMAStrepDig (plasmidprep from 24.08.09)
*digest of pMA_ShortLinker_Foka clon2 and pMA_ShortLinker_Foki clon1
*preparative gel [[Image:Freiburg 09 240809verdau1.JPG|none|thumb|preparative gel of pMA_HisDig, pMA_StrepDig and pMA_ShortLinkerFoka digests|300x300px]] [[Image:Freiburg09 240809verdau2.JPG|none|thumb|preparative gel of pMA_HisDig, pMA_StrepDig and pMA_ShortLinkerFoka digests|300x300px]] ->Shortlinker_Foka/i bands were about 1200 bp, which is much larger than expected -> gel slices were frozen, but we have to see the sequences before we continue
->StrepDig and HisDig showed just very weak bands -> overnight digest was set up -> gel has to be repeated tomorrow if sequences are alright
*made glycerine stocks for all probes from the pasmid prep
*made pellets and put them in -20°C from
pEX His FluA+Split Foka clon1
pEX His FluA+Split Foka clon2
pEx His FluA+Split Foki clon1
pEx His FluA+Split Foki clon2
pMA Strep Dig clon1
pMA Strep Dig clon2
pMA His Dig clon2 Rest
pMA His Dig clon3
pEX Strep His+Split Foki clon1
pEX Strep His+Split Foki clon2
pMA short linker+ Foki clon1
pMA short linker+ Foki clon2
pMA short linker+ Foka clon1
pMA short linker+ Foka clon2
*ordered Fok monomere linker to connect His/strep+split Foka with split Foki with igem restrictions sites XbaI and AgeI
*transformation of constructs already finished into XBlue1 -pExHisFluASplitFoka plasmidprep from 24.08.09
-pExHisFluASplitFoki plasmidprep from 24.08.09
*inoculation of trafo of digoxigenin from 04.08.09
*ordered AgeI at NEB freezer -> can be fetched tomorrow from 13 o'clock on
*poured LB Amp plates from lab stock
*theoretical cloning
25.08. Hannes, Max, Manuel, Rüdiger, Timo, Christoph
*transformation of pExHisFluASplitFoki clone1 plasmidprep from 24.08.09 into BL21de3
*ligation of Strep-Dig (digested, 18.08.09) and His-Dig(digested, 18.08.09) into pEX
*transformation of ligation into RV308
*test digest of M13 ssDNA with 1/2 oligos (M13 ssDNA hybrid. 1/2 oligos 24.08.09) with FokI [[Image:Freiburg09_250809_Fok_kontrolle1.JPG|none|thumb|Agarose gel 1%; NEB 1kB DNA ladder, M13 ssDNA, M13 ssDNA hybrid 1 oligo, M13 ssDNA hybrid 1 oligo + FokI, M13 ssDNA hybrid 2 oligos, M13 ssDNA hybrid 2 oligos + FokI, NEB 100bp DNA ladder|300x300px]]
*inoculation of - BL21de3 --> make competent cells
- pExHisFluASplitFokA in XBLue
- pExHisFluASplitFokI in XBlue
- pMA Split FokA
- pMA Split FokI
26.08. Gerrit, Isabel, Sarah, Timo, Laura
*Ligation and transformation of pMA digested from 18.08.09 and Middle an Long linker respectively hybridized from 21.08.09 Vector: 3 µl pMA
Insert: 6 µl Middle Linker
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA
Insert: 6 µl Long Linker
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
-> transformation haven't showed colonies in evening -> new hybridization of linkers was started (last time no water was added)
*made 4 times 400 ml LB Agar
*analytical gel of ShortLinker_Foki and Shortlinker_Foka digests from 24.08.09 [[Image:FreiGEM09260809_analyt.gelshortfok.JPG|none|thumb|analytical gel of digested fragments ShortFoki, short Foka and 100bp marker of NEB|300x300px]] interpretation: both fragments are really to big with a size of about 1200 bp even if sequencing from 24.08.09 was good
-> overnight-digest of pMAShortFoka/i was done again
*ordered NotI at NEB freezer
*made competent cells of BL21de3
*transformation of pExHisFluASplitFoka in BL21de3
*inoculation of - pExHisDig
- pExStrepDig
- pExHisFluASplitFoki
*plasmid preparation of - pEx HisFluASplitFoka
- pEx HisFluaSplitFoki
- pMASplitFoki
- pMASplitFoka
27.08. Gerrit, Laura, Manuel, Timo, Hannes, Christoph, Sarah
*inoculation of - pEx HisFluASplitFoka 100µl
- pEx HisFluASplitFoki rest
*Restriction digest of several plasmids - pEx HisFluASplitFoka (clone 1, 26.08.09)
- pEx HisFluASplitFoki (clone 1, 24.08.09)
- Foki (preparation 2, 05.08.09)
purpose: digest to get fusion proteins Plasmid: 10 µl pMA_Foka plasmid prep II from 05.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl NgoMIV from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl XbaI from NEB KuKlabstock
Plasmid: 10 µl pMA_Foka plasmid prep II from 05.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl XbaI from NEB KuKlabstock Plasmid: 10 µl pMA_Foki plasmid prep II from 05.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl XbaI from NEB KuKlabstock Plasmid: 10 µl pEx_HisDig clone1 plasmid prep from 27.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock
Plasmid: 10 µl pEx_StrepDig clone1 plasmid prep from 27.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl PstI from NEB KuKlabstock
Incubation: 2 h in 37°C room
*Preparative Gel of restriction digest pMA_Foka and pMA_Foki, pEx_Strep_Dig, pEx_His_Dig
purpose: get single fragments
Gel preparation: 50 ml TAE buffer KuKlab stock, 0.5 g Agarose (Gibco), 2x Microwave, 2.5 µl Ethidiumbromide Kuklab stock (comment: unknown Ethidiumbromide concentration) Loading 1st gel: lane1: NEB 1kb ladder iGEM labstock
lane3: 30 µl pEx_StrepDig from 27.08.2009
lane5: 30 µl pEx_HisDig from 27.08.2009
2nd gel:
lane1: pMA_Foka from 05.08.2009
lane3: pMA_Foka from 05.08.2009
lane5: pMA_Fok1 from 05.08.2009
lane7: 1kb ladder iGEM labstock
Gel run: 100V, 45 min
Gel picture with Biorad imgager
| [[Image:Freiburg09_270809_digverdaue.JPG|none|thumb|preparative gel of 1kb marker of NEB and digested vectors pExStrepDig, pExHisDig|300x300px]] | [[Image:Freiburg09_270809__digverdaue_danach.JPG|none|thumb|vectors cutted out|300x300px]] |
| [[Image:Freiburg09_270809_fokverdaue.JPG|none|thumb|preparative gel of pMAFoka, pMAFoka, pMAFoki|300x300px]] | [[Image:Freiburg09_270809_fokverdaue_danach.JPG|none|thumb|vectors cutted out|300x300px]] |
Gel run worked, but Foki was digested wrong -> now we have another pMA vector but not pMA+Foki to insert Shortlinker
*gel extraction of digests
*Ligation and transformation of Vector: 3 µl pMA_HisDig_AgeI_PstI from 27.08.09
Insert: 6 µl SplitFoka_NgoMIV_PstI from 22.07.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_HisDig_AgeI_PstI from 27.08.09
Insert: 6 µl SplitFoka_NgoMIV_PstI from 22.07.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_HisStrep_AgeI_PstI from 27.08.09
Insert: 6 µl SplitFoki_NgoMIV_PstI from 22.07.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_HisStrep_AgeI_PstI from 27.08.09
Insert: 6 µl SplitFoki_NgoMIV_PstI from 22.07.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_XbaI_AgeI from 27.08.09
Insert: 6 µl Shortlinker_hybridized from 17.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pMA_Foka_XbaI_NgoMIV from 27.08.09
Insert: 6 µl Shortlinker_hybridized from 17.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Sequencing of - pExHisFluASplitFoka clone 1 plasmid prep of 26.08.09
- pExHisFluASplitFoki clone 1 plasmid prep of 26.08.09
- pExStrepDig clone 1 plasmid prep of 27.08.09
- pExHisDig clone 1 plasmid prep of 27.08.09
- pMAFoka clone plasmid prep II of 05.08.09
- pMAFoki clone plasmid prep II of 05.08.09
- pMAStrep-Tag of o9.07.09
[['''WE MISSED THE PICKUP OF OUR SAMPLES AND STORE THEM IN -20°C IN "OLIGOS,...."''']]
*overnight digest of Streptag for ligation with FluA Plasmid: 10 µl pMA_StrepTag from 04.08.2009
water: 13.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2 µl XbaI from NEB KuKlabstock
*Plasmidprep of:
pEX HisDig 100ul clone 1(26.08.09)
pEX HisDig rest clone 4(26.08.09)
pEX StrepDig 100 ul clone 1(26.08.09)
pEX StrepDig rest clone 1(26.08.09)
GlyStocks stored in BoxPlasmidsStocksII in -80°C
*Storing of pellets from : pEX HisDig 100ul clone:2,3 and rest clone:5,6
- pEX StrepDig 100ul clone:2,3 and rest clone:5,6
- in -20°C box pellets
*AGO RNA cleavage assay preparation
-linearised and purified Aa gene in pET28a as template for in vitro transcription
--> Phenol/Chloroform extraction --> c=164.2 ng/µl
-prepaired all parts for in vitrot ranscription tomorrow
-prepaired "AGO buffer" for assay
28.08. Laura, Manuel, Timo, Hannes, Christoph
*inocluation of expressionculture
*made IPTG
*preparative gel of overnight digests see picture... ->pMAFoki prep from 05.08. and pExsFoka digest worked
*gelextraction of gel slices
*ligation and transformation of Vector: 3 µl pMA_Foki_XbaI_NgoMIV gelex from 28.08.09
Insert: 6 µl Shortlinker hybridized from 17.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Plasmidprep and sequencing of:
pMA Middlelinker (28.08.09)
pMA Longlinker(28.08.09)
pEX HisFluASplitFoka(28.08.09)
GlyStocks stored in -80°C and pellets in -20°C
*Inoculation of pEx StrepDigSplitFoka
pEx StrepDigSplitFoki
pMA Shortlinker
pEx HisDigSplitFoki
pEx HisDigSplitFoka
pMA 36GSLinker_XbaI_AgeI
-> transformations from 27.08.09
pEx HisFluASplitFoka
pEx HisFluASplitFoka
->glycerolstock from 24.08.09
*hybridization of M13 DNA and Fok control oligos I and Fok control oligos I & II
*digest of M13 DNA hybridized and non hybridized with FokI ->this time with 0,5ul FokI and with 1/2 hour incubation in 37°C
*analytical gel
*analytical gel of digests [[Image:Freiburg09_280809m13test.JPG|none|thumb|analytical gel of 1kb Marker of NEB (lane1) and M13 DNA hybridized with Fokcontrol 1 (lane 2), M13 DNA hybridized with Fokcontrol 1 and 2 (lane 3), M13 DNA hybridized without Fokcontrols (lane4)|300x300px]] ->again the hybridized M13 DNA seems to be cutted unspecifically or not at all?
*sequencing of pExHisFluASplitFoki/a with 3´ primer: pEx_3´Primer, sequence AGAGCGTTCACCGACAAAC
*made amp plates
*AGO: in vitro transcription of linearised template DNA --> frozen at -80°C
29.08.09, Christoph
*Plasmidprep, glycerol stock and frozen pellet of : pEx StrepDigSplitFoka
pEx StrepDigSplitFoki
pMA Shortlinker
pEx HisDigSplitFoki
pEx HisDigSplitFoka
pMA 36GSLinker_XbaI_AgeI
pEx HisFluASplitFoka (two times)
pMA ShortlinkerFoka
*Stored Trafo in 4°C room
30.08.09, Timo
Made Starter Colonies of:pEX StrepDigSplitFoka in 50ml LB+AMP taken colonie from the plate of 27.08.09 and marked colonie with Sk
pEX HisDigSplitFoka in 50ml LB+AMP taken colonie from the plate of 27.08.09 and marked colonie with Sk
And of glycerol stock ER 2738 in 50ml LB+tet
*Inoculation of pMA Short Linker Foki 28.08.09 Rest
the plate with pMA Short Linker Foki 28.08.09 100ul showed no growth
31.08.09, Laura, Timo, Gerrit, Rüdiger
*Preparation of double stranded phage DNA - dilute ER 3728 culture in 50 ml LB + Tet so that OD=0,1
- infection with 3 ul phage particles
- on shaker in 37°C room for 4 hours
- 5 min centifugation at 5000rpm
- plasmid preparation
-> aliquoted in 2 eppis, put it in box "oligos, stocks, verdünnugnen
*make washing buffer I (with 30mM imidazol), washing buffer II (with 250mM imidazol)and binding buffer for purification with Ni-Tag
*plasmid preparation and glycerol stock of pMAShortlinkerFoki (clon 1-3)
*transformation of pExHisDigSplitFoka/i and pExStrepDigSplitFoka/i in BL21de3 for an expression culture tomorrow
*Restriction digest of several plasmids - Fok monomer
Vector: 10 µl pEx_HisFluASplitFoki plasmid prep from 26.08.2009
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 1 NEB KuKlabstock
Restriction_enzyme_1 : 1,5 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2,5 µl PstI from NEB KuKlabstock
Vector: 10 µl pEx_HisFluASplitFoka plasmid prep from 29.08.2009
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 1 NEB KuKlabstock
Restriction_enzyme_1 : 1,5 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2,5 µl PstI from NEB KuKlabstock
Insert: 10 µl pMA_36GSLinker plasmid prep from 29.08.2009
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1,5 µl NgoMIV from NEB KuKlabstock
Restriction_enzyme_2 : 2,5 µl PstI from NEB KuKlabstock
-Fok dimer
Insert: 10 µl pMA_ShortlinkerFoka/i plasmid prep from 31.08.2009
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 4 NEB KuKlabstock
Restriction_enzyme_1 : 1,5 µl NgoMIV from NEB KuKlabstock
Restriction_enzyme_2 : 2,5 µl PstI from NEB KuKlabstock
Vector: 10 µl pMA_Longlinker plasmid prep from 29.08.2009
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 1 NEB KuKlabstock
Restriction_enzyme_1 : 1,5 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2,5 µl PstI from NEB KuKlabstock
Vector: 10 µl pMA_Middlelinker plasmid prep from 29.08.2009
water: 12.5 µl
BSA: 0.5 µl NEB iGEM stock
buffer: 3 µl buffer 1 NEB KuKlabstock
Restriction_enzyme_1 : 1,5 µl AgeI from NEB KuKlabstock
Restriction_enzyme_2 : 2,5 µl PstI from NEB KuKlabstock
*5l LB solution autoclaved
*25 new aliquots of AMP (100mg/ml)
*analytical gel of digests see picture -> insert ShortFoki and ShortFoka haven't been visible, we have to see results of sequencing
*gelextraction of 36GS-Linker, pMAMiddlelinker, pMALonglinker, HisFluASplitFoki/a
*Ligation and transformation of Vector: 3 µl pEx_HisFluASplitFoka AgeI_PstI from 31.08.09
Insert: 6 µl 36GS_NgoMIV_PstI from 31.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_HisFluASplitFoki AgeI_PstI from 31.08.09
Insert: 6 µl 36GS_NgoMIV_PstI from 31.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_Longlinker_AgeI_PstI from 31.08.09
Insert: 6 µl Foka_NgoMIV_PstI from 17.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_Longlinker_AgeI_PstI from 31.08.09
Insert: 6 µl Foki_NgoMIV_PstI from 04.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_Middlelinker_AgeI_PstI from 31.08.09
Insert: 6 µl Foka_NgoMIV_PstI from 17.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
Vector: 3 µl pEx_Middlelinker_AgeI_PstI from 31.08.09
Insert: 6 µl Foki_NgoMIV_PstI from 04.08.09
buffer: 10 µl Quick ligase buffer from NEB iGEM stock
Ligase: 1 µl Quick ligase NEB iGEM stock
*Sequencing of - pMAShortlinker clone 1 plasmid prep of 29.08.09
- pExHisDigSplitFoki clone 1 plasmid prep of 29.08.09
- pExHisDigSplitFoka clone 1 plasmid prep of 29.08.09
- pExHisFluASplitFoka clone 1 plasmid prep of 29.08.09
- pExStrepDigSplitFoki clone 1 plasmid prep of 29.08.09
- pExStrepDigSplitFoka clone 1 plasmid prep of 29.08.09
- pMAShortlinkerFoki clone 1 plasmid prep of 31.08.09
- pMAShortlinkerFoka clone 1 plasmid prep of 31.08.09
- pMA36GSlinker clone 1 plasmid prep of 31.08.09
*made new 3d model of Gesamtkonstrukt and wrote procedure down
"








