• Notebook

Project progress

A & B (comparator), ideas

Key/lock system, see Riboregulators (Berkeley 2006)

Odor synthesis/sensor

• Vanillin synthesis: DNA not yet complete/in library [1]
  • Combination of 5 genes; 3 are available
    • Edinburgh Vanilla production (Synthesis pathway by Edinburgh igem 2007)
  • Vanillin production using metabolically engineered Escherichia coli under non-growing conditions, Ferrulic accid --> Vanillin, 5k bp

Light sensor

• YcgF Gene, natural available in 3 E. Coli strains. Can use the promotor of YcgF gene for expression
• Probable strain K12
• Primer of YcgF Promotor:
  • AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])

Odourless strain of E.coli

• MIT 2006 used an indoline deficient strain of E.coli: YYC912.
• Knockout of TNAa5- gene (tryptophanase) in various strains and selected the least 'smelly.'

To do

• Blue light receptor
  • Decide on E.Coli strain
    • Try with K12
    • Vector in neural scent (indole knockout)
  • Decide on primers (!Pre + suffix!)
  • PCR of promotor
  • Couple promotor to GFP --> Standard iGEM plasmid
  • Test!
  • Obtain regulation site
• Vanillin synthesis
  • Send mail to University of Tuscia
• Presentations
• Order receptor biobrick
  • Trg - Env2
  • PBP

Drylab

BioInformatics bookmarks

Wiki

• Create Ideas page
• Some idiot replaced the example logo Image:Example_logo.png with his own logo, so all references to it were removed from our wiki

Progress of parts

[edit] Blue Light Receptor

[edit] Vanillin Production

[edit] Vanillin Receptor

[edit] Key/Lock/Anti-Key