Team:KULeuven/Notebook/Blue Light Receptor
From 2009.igem.org
Blue Light Receptor Notebook
Week 1: 6 July 2009 - 12 July 2009
Week 2: 13 July 2009 - 19 July 2009
[edit] Monday
- YcgF Gene, naturally available in 3 E. Coli strains. Can use the promotor of Ycgf gene for expression
- Probable strain K12
- Promotor voor YcgF gene:
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG
(source: [1])
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG
[edit] Tuesday
- Primer selection for the promotor [Done]
- Send mail to Institut for Biologie-Mikrobiologie (The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli) [Done]
[edit] Wednesday
- Mail Institut fur Mikrobiologie der Westfalischen, Wilhelms-Universitat Munster for the plasmid [Done]
Week 3: 20 July 2009 - 26 July 2009
[edit] Thursday
- Primers for the blue light receptor have arrived
[edit] Friday
- PCR on promoter region in MC4100 E.coli colony using primers and tested on agarose gel
Week 4: 27 July 2009 - 2 August 2009
[edit] Monday
- concentration: 91,9 ng/μl
- 260/280 = 1,90
BBa_E0240: rbs + GFP + terminator was plated.
[edit] Tuesday
[edit] Wednesday
GFP (BBa_E0240)
- Miniprepped and nanodropped
- Concentration: 85,6ng/μl
- 260/280: 1,87
- A restriction digest was performed to cut the plasmid with EcoRI and XbaI
- A mixture of 20μl was made(3x):6μl DNA, 2μl bufferH, 1μl EcoRI and 1μl XbaI, 10μl AD
- The mixture was incubated for at least an hour at 37°C
BLR promoter region
The PCR product that was purified friday (24/07) is digested with EcoRI and partially digested with SpeI
- Digestion with EcoRI
- Following mixture was made (x6): 5μl DNA, 2μl buffer H, 1μl EcoRI, 12μl MilliQ
- Incubated for 1h at 37°C
- Partial digestion with SpeI
- Dilution of the enzymes:
- AD/b: 225μl MQ + 25μl buffer H
- 1/100: 1μl SpeI + 99μl AD/b
- 1/200: 50μl 1/100 + 50μl AD/b
- 1/500: 20μl 1/100 + 80μl AD/b
- Made following mixture:
- Dilution of the enzymes:
| I | II | III | IV | V | VI | |
|---|---|---|---|---|---|---|
| EcoRI digestion mix | 20μl | 20μl | 20μl | 20μl | 20μl | 20μl |
| diluted SpeI | 1μl 1/200 | 2μl 1/200 | 3μl 1/200 | 1μl 1/500 | 2μl 1/500 | 3μl 1/500 |
| AD | 4μl | 3μl | 2μl | 4μl | 3μl | 2μl |
- The mixture was incubated for 15 min at 37°C
After the restriction digests, the products had to be checked for their length. So, an agarose gel was run for both the cut GFP-plasmids and the cut promoter region. A photograph was taken and following conclusions were made:
- Plasmids with GFP appeared to have cut decently
- Promoter region: the partial digestion did not seem to have done the trick. We only found a lane around 360 bp while we expected to find another lane just under 200 bp due to cutting at the "forbidden" SpeI site in the middle. As we did not find this lane in our gel we concluded that SpeI probably did not cut. This might be because it was diluted too much or because we did not incubate long enough.
We concluded to purify both the plasmids and the promoter region through gel extraction. After nanodropping, we had these results:
- Plasmids:
- Concentration: 22ng/µl
- 260/280: 1,83
- Promoter region (two samples):
- Concentration: 31,7ng/µl and 32,7ng/µl
- 260/280: 1,84 and 2,06
The conclusion of the day was to redo a partial digestion on the promoter regions, this time under different conditions (longer incubation time and less diluted). At the same time a Knelow technique would be used on the newly PCR-ed promoter region in order to cut out the SpeI site.
Later that evening we received an email from Regine Hengge (co-author on the article The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli). This contained valuable information about the location of the actual promoter in our purified region.
[edit] Thursday
- Concentration:
- 192,7 ng/µl
- 161,9 ng/µl
- 155,1 ng/µl
- 260/280
- 1,82
- 1,82
- 1,80
[edit] Friday
Week 5: 3 August 2009 - 9 August 2009
[edit] Monday
[edit] Tuesday
[edit] Wednesday
[edit] Thursday
[edit] Friday
Week 6: 10 August 2009 - 16 August 2009
[edit] Monday
- concentration of clean pcr product.:
- 102,6 ng/µl
- 1,88
[edit] Tuesday
- Restriction digest
- BBa_K238013 cut with EcoRI and SpeI, incubation for 1,5 hour
- Gel electrophoresis of BBa_K238013
- The cut piece should be 109 bp
- Restriction digest
- Electroporation of parts pSB3K3-BBa_P1010 and BBa_J23101 in electrocompetent cells
[edit] Wednesday
- Gel electrophoresis of BlP cut with EcoRI and SpeI
- Gel extraction of the Blp
Nanodrop results
| Part | concentration (ng/μl) | 260/280 λ | 260/230 λ |
|---|---|---|---|
| Blp | 27 | 2,08 |
- PCR (with Pfx) of blue light promoter with primers iGEM 2260 and iGEM 2261
- Annealing of 58C
- Inoculate liquid medium
- Inoculation of pSB3K3-BBa_P1010 and BBa_J23101
- Ligation
| Vector | insert |
| pSB1A3+BBa_P1010 | BBa_K238013 (BLP) |
| 50ng -> 2,5 μl | 5 ng -> 0,3 μl |
[edit] Thursday
- PCR product of 12-august of pairt BBa_K238013
- Miniprep of BBa_J23101
Nanodrop results:
| Part | concentration (ng/μl) | 260/280 λ | 260/230 λ |
|---|---|---|---|
| BBa_K238013 | 123,3 | 1,82 | |
| BBa_J23101 | 141,2 | 1,99 |
- Restriction digest BBa_K145015 cut with EcoRI and XbaI
- Electroporation of pSB3K3 + BBa_P1010 and the ligation of ...
- Gelelectrophoresis of BBa_K145015
- Only 1 band, so probably everything was cut
- Gelextraction of BBa_K145015
- Nanodrop = 29,3 ng/μl
- Ligation of vector BBa_K145015 and insert
[edit] Friday
- Transfer of the plates with cells from the ligation: 20 colonies have been transferred to a new plate to achieve more single colonies
- Plating of BBa_R0040 from -80°C
- Electroporation of the blue light promotor ligation (with BBa_K145015) in new competent cells
Week 7: 17 August 2009 - 23 August 2009
[edit] Monday
Lig B has been re-ented on a new plate because too many cells had grown on the one we made on aug 14. We always used single kolonies to re-ent.
[edit] Tuesday
2) Restriction digest of the DNA from step 1 with EcoRI and PstI
3) Gel electrophoresis to check if the insert in the plasmid is the correct size, which it was, so the ligation was succesful.
[edit] Wednesday
[edit] Thursday
[edit] Friday
Week 8: 24 August 2009 - 30 August 2009
[edit] Monday
- Plates with LigA were put under blue light. The LEDs were put on their max capacity.
- Restriction digest with
- tubes (1,3,5,7,9) of LigA (BLP + BBa_E0240) cut with EcoRI en PstI
- promotor BBa_J23101 cut with EcoRI en SpeI (4x)
- Gel electrophoresis with the RD of LigA and BBa_J23101 followed by a gel extraction:
- Note: tube 5 of LigA was loaded poorly on the gel and could not be used.
- Note: the samples of promotor BBa_J23101 were barely visible. Only 2 of the 4 samples were recovered by extraction.
| Part | concentration (ng/μl) | 260/280 λ | |
|---|---|---|---|
| LigA 1 | 7,9 | 2,16 | |
| LigA 3 | 10,8 | 1,88 | |
| LigA 7 | 4,8 | 2,49 | |
| LigA 9 | 8,0 | 3,02 | |
| BBa_J23101 (A) | 20,8 | 1,70 | |
| BBa_J23101 (B) | 12,8 | 2,57 |
4. Enting of liquid cultures with kanamycin and pSB3K3
[edit] Tuesday
- Miniprepping the liquid cultures with pSB3K3
| Part | concentration (ng/μl) | 260/280 λ |
|---|---|---|
| pSB3K3 (1) | 27,6 | 1,91 |
| pSB3K3 (2) | 47,7 | 2,08 |
- Restriction digest of pSB3K3 with EcoRI and PstI
- Gel electrophoresis and extraction of the RD of pSB3K3
--> failed. There was no signal at all
- New colonies were ented in liquid culture.
- Ligation C performed: BBa_J23101 (A) + BBa_E0240
| Vector | insert |
| pSB1A3 + BBa_E0240 | BBa_J23101 |
| 30ng -> 1,4μl | 40,8ng -> 2μl |
[edit] Wednesday
- The plates with ligation A (blp + GFP) were fetched from the blue light installation. There was no GFP signal. The following actions will be taken:
- The plasmids will be purified from the colonies and will be sequenced using primer 2260.
- Next time, we will probably put them in liquid cultures under the LED's while shaking gently. Also, other parameters that need to be considered are being researched.
- They will not be exposed to the light as long anymore. We decided that 1h will be more than enough.
- Possible bleaching?
- A colony from all three plates with the LigA-construct was taken and ented in liquid culture. This was needed to check whether the colonies were still alive.
- culture 13/08
- culture 14/08 (1)
- culture 14/08 (2)
- By 5pm, one of the liquid cultures had grown and was miniprepped. 20μl was sent for sequencing together with 5μM of primer 2260.
| Part | concentration (ng/μl) | 260/280 λ | |
|---|---|---|---|
| LigA (14/08 (1)) | 23,1 | 2,21 |
4. Two electroporations were performed and plated on LB medium. One with LigC (BBa_J23101 + BBa_E0240) and one with pSB3K3 DNA.
[edit] Thursday
- The electroporations of 26/08 were checked.
- pSB3K3 had some colonies. they were ented in liquid culture.
- LigC (BBa_J23101 + BBa_E0240) did not grow. we figured that an insert of 35bp was too short to ligate so we decided to use BBa_E0240 as insert and BBa_J23101 + pSB1A2 as vector . The following restriction digest was started:
- BBa_J23101 was cut with SpeI and PstI
- BBa_E0240 was cut with XbaI and PstI
- The miniprep that was made to sequence the LigA construct on 26/08 was used again to perform a restriction digest (EcoRI and PstI). This was put on gel to check whether there actually was LigA-insert in the vector and whether the insert had the right length. The gel showed a signal at 1000 bp and at 2000 bp which coincides with the insert (BLp + GFP) and the vector.
- A new setup to light the E.coli was engineered.
- Fresh cultures were made from the old ones (LB plate ligA 14/08 and the two liquid cultures from 26/08 were used as templates.)
- They were put in the 16°C room for about an hour
- A blue light (40W) was put on them for about an hour
- They were put in the 37°C incubator overnight
[edit] Friday
- Miniprep of liquid cultures of pSB3K3 grown overnight.
| Part | concentration (ng/μl) | 260/280 λ | |
|---|---|---|---|
| pSB3K3 1 | 36,4 | 2,23 | |
| pSB3K3 2 | 33,0 | 2,46 |
- Gel electrophoresis of pSB3K3 miniprep and of restriction digest from 27/08 (BBa_J23101 and BBa_E0240. There was an unexpected signal at 800bp at the (BBa_J23101 lanes. The conclusion was that this part can not be used and we have to start all over from the basic DNA to make this ligation C.
- We checked our cultures that were radiated with blue light on 27/08.
- The liquid cultures were put in the FACs machine. There was some fluorescence which is probably due to GFP. However, it can not be excluded that this is due to leakage from our promotor. So, a new set up needs to be made where decent controls are included.
- The LB plates were put under a special GFP lamp. Just like the liquid cultures, there was signal but the same considerations need to be made.
- A new plan was designed in order to make a permanent glycerol stock of LigA and to make a new set up for GFP measurements, this time including controls.
The following was done over the weekend:
- Saturday:
- LigA grew well overnight. 4 colonies were selected for further testing and plated on new plates
- The plates with BBa_E0240 overgrew, so a single colony was picked and replated
- The plates containing electroporated ligC from 26/08 had two colonies after all. These were ented in liquid cultures and grown overnight, so it can be checked later if these colonies do in fact contain ligC.
- Sunday:
- The 4 colonies that were selected on Saturday grew well and were ented in liquid cultures.
- Some colonies from BBa_E0240 were also ented in liquid culture.
Week 9: 31 August 2009 - 6 September 2009
[edit] Monday
- A miniprep and RD (with EcoRI and PstI) were performed on the four colonies that were ented on Sunday.
- Nanoprop results
- RD results on gel: the right signals were detected
| Part | concentration (ng/μl) | 260/280 λ | |
|---|---|---|---|
| LigA (1) | 110,6 | 1,92 | |
| LigA (2) | 76,7 | 1,99 | |
| LigA (3) | 84,8 | 2,07 | |
| LigA (4) | 31,7 | 2,02 | |
| BBa_E0240 | 104,3 | 2,10 |
- LigA was plated on LB medium. This will be the "motherplate" from which the glycerol stock and the testing cultures will be taken from.
- Electroporation of BBa_J23101 in competent cells. It was plated and put overnight in the incubator.
- In order to be able to grow vector pSB3K3, which contains the toxic ccdB gene, we need special cells which carry the gyrA462 mutation. This is strain DB3.1 from E.coli. These were plated and put in the incubator overnight.
[edit] Tuesday
- Experimental set up for irradiation of LigA (BBa_K238013 + BBa_E0240)
- Enting colonies from the motherplate:
- There are two groups, each with 8 cultures.
- Shift one: 2 agar plates and 2 liquid cultures with LigA and 2 agar plates and 2 liquid cultures with BBa_E0240 were put in 16°C for one hour. After an hour, half of them were irradiated with blue light for an hour while the other have was wrapped in aluminium foil as a control. Afterwards they are put in the 37°C incubator for some time
- Shift two: they were put in the 37°C for some hours so that the cultures can grow.
- After measurement of the first shift the following was concluded:
- Although the cells with BBa_E0240 had a small signal after FACS, the plates showed no GFP when put under the lamp.
- LigA that was not exposed to blue light had the same amount of signal as the construct that had been exposed. we assume that this is due to the exposure to white light when the cultures are exposed. Possibly, the promotor was then already activated since white light contains blue light frequencies. A new set up will be made over the weekend where all cultures will be made in a dark room.
- Dilutions of the shift one liquid cultures were made + 2 new cultures from the motherplate from ligA. These were put overnight under blue light together with the cultures of shift 1
- Following was ented in liquid culture:
- LigA from motherplate
- BBa_J23101 from motherplate
- DB3.1
[edit] Wednesday
- FACS measurements:
- The cultures from shift 2 had similar results as shift one. However, the GFP signal measured from the LigA construct was stronger. Thus, cells definitely need to grow before undergoing irradiation.
- The dilutions and the shift one cultures put overnight did not show any significant results.
- BBa_J23101 was miniprepped and nanodropped
| Part | concentration (ng/μl) | 260/280 λ | |
|---|---|---|---|
| BBa_J23101 (A) | 238,9 | 1,95 | |
| BBa_J23101(B) | 248,8 | 1,91 |
- After nanodropping, BBa_J23101 was restricted with SpeI and PstI, while BBa_E0240 was cut with PstI and XbaI.
- A gel electrophoresis and extraction was performed. This showed an unexpected 800 bp signal at the lanes with BBa_J23101. This is in fact due to the vector in which this part is ligated. BBa_J61002 contains a reporter gene, RFP. Thus, in combination with the promotor, a construct is formed that can be used to measure activity of this promotor. Since the promotor is flanked by standard assembly restriction sites we can replace the current promotor (BBa_J23101) by any other promotor, for instance BBa_K238013.
- DB3.1, BBa_J23101 and LigA were ented in liquid culture and grown overnight to make glycerol stocks and competent cells
[edit] Thursday
- A restriction digest on BBa_J23101 with EcoRI and SpeI was performed. This will cut the promotor out of its vector (BBa_J61002) which has a RFP reporter gene. We will put BBa_K238013 (cut with EcoRI and SpeI) in this vector. This way we will get a construct where RFP will be produced dependant on our blue light promotor. We can then compare this with the intensity of RFP produced by BBa_J23101.
- Glycerol stock was made from LigA and BBa_J23101. They are stored in the -80°C in S&P F8 67-68 and 69-70.
- Ecoli strain DB3.1 cells were made competent for electroporesis.
- Gel electorphoresis and extraction on BBa_J23101
[edit] Friday
- Gel extraction performed on the signals from 3/09
- Nanodrop: 14,7 ng/µl of BBa_J61002 with a 260/280 of approx 2,12
- Ligation with BBa_J61002 and BBa_K238013 (ligX 1)
- A new restriction digest on BBa_J61002 and BBa_K238013 with EcoRI and SpeI was performed.
- Gel extraction of these new digests. BBa_J61002 was nanodropped with a concentration of 28 ng/µl. this was ligated with BBa_K238013 (ligX 2)
- Electroporation of pSB3K3
[edit] Saturday
- Electroporation of ligX 1&2
- There was no growth of cells after electroporation with pSB3K3
[edit] Sunday
- There was good growth of the cells that were electroporated with ligX. 4 single colonies were selected and plated on Ap medium. This was all done in a dark room to avoid activation of the promotor.
Week 10: 7 September 2009 - 13 September 2009
[edit] Monday
- Restriction digest with EcoRI and PstI on BBa_E0240 and the purified pcr product of BBa_K238013 in order to get our promotor on itself in the pSB1A2 standard vector.
- Gel electroforesis and extraction of this RD. The concentration of this extraction was too low so no ligation was performed with these samples.
- Extra pcr was done on BBa_K238013 with primers 2260 and 2261.
- Liquid cultures of LigX and of BBa_J23101 were made from the 4x plates.
[edit] Tuesday
- Dilutions of the liquid cultures of ligX (7/09) were made and put in 37°C to grow during the day.
- In the evening the liquid cultures were first put in 16°C and then put under light.
- The miniprep of LigX was not performed correctly.
- Liquid cultures of BBa_J23101 were made.
[edit] Wednesday
- FACS-ing the liquid cultures that were put under blue light on 08/09 gave no significant results.
- Motherplate for BBa_J23101 was made
- liquid cultures for checking the ligX were made.
- LC with BBa_J23101 were miniprepped, nanodropped, restriction digested and put on gel. The signals were good. The vector, pSB1A2, was cut from the gel and gel extracted (10ng/µl). This was ligated with BBa_K238013 (LigY).
Nanodrop:
| Part | concentration (ng/μl) | 260/280 λ | |
|---|---|---|---|
| BBa_J23101(1) | 141,8 | 1,94 | |
| BBa_J23101(2) | 139,5 | 1,99 | |
| BBa_J23101(3) | 177,5 | 1,95 | |
| BBa_J23101(4) | 141 | 1,95 |
[edit] Thursday
- Since the results from our light experiments keep failing, some new ideas were computed. pSB1A2 is the backbone for our construct but since this is a high copy number plasmid perhaps the ratio of promotor to repressor is unequal (not enough repressor). A new enting in LC was done with ligX. These were grown for a few hours at 37°C and then put in 16°C room overnight so that more repressor can be made (its promotor is temperature-sensitive).
- Ligation from 09/08 was electroporated in competent cells.
- Miniprep of LigX, restriction digest and gel electrophoresis. The signals were good so a motherplate for ligX was made. Also, the vector pSB1A2 was extracted from the gel (39,1 ng/µl).
Nanodrop results:
| Part | concentration (ng/μl) | 260/280 λ | |
|---|---|---|---|
| LigX1(1) | 110,9 | 1,97 | |
| LigX1(2) | 107,3 | 1,95 | |
| LigX1(3) | 97,1 | 1,98 | |
| LigX1(4) | 106,9 | 1,97 | |
| LigX2(1) | 123,8 | 1,99 | |
| LigX2(2) | 100,9 | 1,99 | |
| LigX2(3) | 111 | 1,95 | |
| LigX2(4) | 108 | 1,97 |
[edit] Friday
- The electroporated ligY did not grow. A new restriction digest on pcr product BBa_K238013 was performed with EcoRI and PstI.This was put on gel. There was a good signal so it was used to perform a ligation with vector pSB1A2.
- A liquid culture that was made from pSB3K3 a few days ago showed growth after all. This was miniprepped and restriction digested to check whether the vector is actually present.
- The liquid cultures with our blue light construct (lig) that stood overnight at 16°C was FACS-ed. Half of the cultures were exposed to blue light during the day and put under the FACS in the evening.
Week 11: 14 September 2009 - 20 September 2009
[edit] Monday
- miniprep of ligY colonies. nannodrop: 111 ng/µl and 116 ng/µl.
- restriction digest of ligY miniprep
- gelelectrophoresis of restricted ligY and compared to ligA. the ligY fragment was larger than ligA which means that the ligation Y fauled. the promotor region probably ligated to RFP which was not restricted out of the vector properly.
- gel extraction of plasmid pSB1A2 (nanodrop: 10ng/µl)
- a new ligY was performed
- control of pcr-product BBa_K238013. It was ok.
[edit] Tuesday
- miniprep of pBR322 (nanodrop: 24,5ng/µl)
- restriction digest of pBR322 with EcoRI and PstI
- gelelectrophoresis and extraction of pBR322 (nanodrop: 10,8ng/µl)
- ligation of pBR322 with ligA (blp + BBa_E0240)
- electroporation of cells with LigY (attempt 3)
[edit] Wednesday
- miniprep of pRB322 (nanodrop: 59,8ng/µl)
- ligY was replated
- logA electroporation
- plating of pSB3K3 from -80°C freezer.
[edit] Thursday
- electroporation of logA (ligA in pBR322, a low copy plasmid).
- a PCR on pSB3K3 with primers ......
- restriction digest of pSB3K3, pBR322 and ligA with EcoRI and PstI followed by a gel electrophoresis and extraction.
- ligations of ligA (blp+GFP) with pBR322 (logA) and pSB3K3 (likA) were put overnight
- BBa_I20260 was taken from the distribution plates and plated on LB
- liquid cultures of ligY (blp) were made in the morning, grew and were miniprepped in the evening followed by a restriction digest with EcoRI and PstI
[edit] Friday
- gel electrophoresis of the RD of ligY and ligA. all of the inserts were ok and ligA had a right signal.
- a motherplate for ligY was made
- likA and LogA ligations were electroporated
- a new ligation of likA and logA were made and put overnight.
[edit] Saturday
- enting of the electroporated logA from 18/09. the enting was done on tc(5) as wel as on ap plates. there should not be any growth on the ap plates since the resistence gene is cut in half by the insert. the electroporation of likA didn't show any growth
- a new RD of ligA, pSB3K3 and pBR322 with EcoRI and PstI were done and put overnight.
- an electroporation of likA and logA (ligations from 18/09) was done
[edit] Sunday
- the elecroporation from saterday was not succesfull for logA but there was a colony on the likA plates. this was reented and a liquid culture was made to miniprepp and check.
- the restriction digest from saterday was put on gel and checked. all but one lane had good signal. a gel extraction was done with following results: ligA: 4,8ng/µl ; pBR322: 12,3ng/µl and pSB3K3: 14,3ng/µl (allw with good 260/280 values). pSB3K3 and ligA were used to perform a new ligation (likA)
- the overenting of logA on tc/ap plates from saterday was succesfull. the cultures only grew on the tc plates. the liquid cultures that were made from these logA's were miniprepped with following results: logA(1): 59,1ng/µl and logA(2): 91,5ng/µl. a restriction digest with EcoRI and PstI was done and put on gel. the signal however showed that only one of the enzymes cut properly. the signal was however on the right height. a new restriction digest will be performed on monday.
- a liquid culture of ligY mother plate was made for glycerol stock.
Week 12: 21 September 2009 - 27 September 2009
[edit] Monday
- a new restriction digest on logA (1&2) was done.
- the re-enting of likA was succesfull and the liquid culture was miniprepped. likA: 179,3 ng/µl. a restriction digest with EcoRI and PstI was performed and put on gel. the signals were good.
- a glycerol stock of ligY was made and some samples for sequencing were prepared.
- a motherplate of LogA en LikA were made and liquid cultures to make a glycerol stock.
- liquid cultures were also made for empty top10 cells, standard promotor BBa_I20260 and LikA (blp and GFP in pSB3K3).
[edit] Tuesday
- liquid cultures of LikA, BBa_I20260 and the empty top10 cells were reented. 100µl was taken and put in new medium to get a dilution of 1/50. they grew during the day. in the evening these cultures were put in the 16°C room overnight.
[edit] Wednesday
- measurements of the liquid cultures from 22/09 were made. the empty top10, and standard promoter I20260 were measured. then, at different times likA were measured.
we concluded the following from our measurements:
- the gfp at time 0 was already pretty high
- the level of gfp did not change during lighting.
- the level of gfp measured was not higher then the gfp signal from I20260.
after having read some of the articles about this system again we made some new discoveries about the receptor (YcgF), the repressor (YcgE) and the promotor (blp):
- temperature seems to be more important then we first suspected. not only does temperature influence the expression of YcgF/E but it also influences the dimerization of YcgF. It seems that the colder the temperature, the easier dimerization (in the absence of light) happens.
- this finding made us conclude the following about temperatures in our experimental set up.
- growing cells at 37°c: at this temperature the repressor has a very low expression rate. thus, the number of plasmids containing a promoter (15-30) is too big compared to the amount of repressor.
- putting cells in 16°c: the amount of repressor produces might be enough to cover all the promoters but there will be at least as much receptor that is dimerized and tus active to undo this repression.
- conclusion: growing aty 25° gives the possibility of creating enough repressor/receptor without having the receptor in an active state and removing the repressor activity.
[edit] Thursday
- following the conclusions made on 23/09 a new experiment was set up:
- liquid cultures were ented (and reented in the evening) and grown on two different temperatures: 37° and 25°.
- from each of these growth conditions some of the cultures were put in 16° and the other at 25°. each of these groups were then again divided in a group that was lit with blue light and a group that wasn't.
- this was done for our ligation of blp with GFP in three different vector (pSB3K3, pBR322 and pSB1A2)
- an example of a sample name is: 37/16/NB/LigA, grown at 37°, put in 16°, not lit and in vector pSB1A2.
[edit] Friday
- measurement of the liquid culuters of 24/09:
- at first glance it seemed that there was indeed repression of the promoter on 25°. further conclusions from the results could however not be made yet.
- a new experiment will be done on tuesday the 29th with cultures that only grew on 25°C.
[edit] Saturday
[edit] Sunday
- enting of ligA, LikA and LogA for measurementof the promoter activity when grown at 25°C
Week 13: 28 September 2009 - 4 October 2009
[edit] Monday
[edit] Tuesday
[edit] Wednesday
[edit] Thursday
[edit] Friday
[edit] Saturday
[edit] Sunday
Week 14: 5 October 2009 - 11 October 2009
[edit] Monday
[edit] Tuesday
- the strenght of the promoter was tested following the protocol from the standard promoter measurement kit from iGEM. this can be found on the parts registry.
- liquid cultures of blp+gfp in the pBR322 vector were made to redo our experiment.
[edit] Wednesday
[edit] Thursday
[edit] Friday
[edit] Saturday
[edit] Sunday
Week 15: 12 October 2009 - 18 October 2009
[edit] Monday
[edit] Tuesday
[edit] Wednesday
[edit] Thursday
[edit] Friday
[edit] Saturday
[edit] Sunday
-->
"








