Team:LCG-UNAM-Mexico:Journals:Uriel

From 2009.igem.org

Uriel's lab journal

Objectives

Construction of the phage production control system.
  
   In order to produce a grate amount of P4 phage particles that has our death system, we want to avoid the natural
   early lysis that occur when WT P4 and P2 interact. This avoidance will be achieved by taking the control of the 
   two major regulators of P2 morphopoietic genes. The control systems that is going to be implemented is constituted 
   by a promoter inducible by IPTG in conjunction with transactivators cox and ogr from phage P2. All this will 
   allow us to grow bacteria in grate quantities and induce lysis when ever we want and as a consequence the 
   production of grate amounts of P4 phage.   
  
Qualitative characterization of the multipromoter.

   The multipromoter that we have designed has the capacity to respond specifically to T3/T7 RNA polymerases
   so if one or both polymarease are presente in the cell the genes downstream of this promoter will be active. 
   A first characterization approach is the introduction of a plasmid carring our promoter in the E. coli strain
   BL21(DE3)pLysS that has a T7 RNA polymerase inducible by IPTG

July 30, 2009

Primers for P2 cox and ogr genes arrived so we can start to construct the phage production system control.

To attain control of phage production we are going to put under an IPTG inducible promoter the genes that codify for the principal regulators of the morphopoietic genes and delete genes that doesn't belongs to the morphopoietic group this part will be done by Laura Gomez.

The genes that codify for this regulators are going to be amplified via colony PCR from the E. coli C-177 strain, which has a lysogenic form of phage P2. The primers that we are using amplify the genes with its WT RBS's and also introduce an extra stop codon as required by the standardization protocol and also de suffix and prefix iGEM sequences.

It is known that C-1a strain neither has a cox gene nor an ogr gene while C-1a K-12 strain contain a copy of ogr in its genome. We have performed a colony PCR over the next strains, looking for ogr and cox.

Genes:

ogr
cox


Strains:

       C-1a
       C-117
       DH5alpha

July 31, 2009

Colony PCR is going to be done with strain C-1a and C-117 as a control DH5alpha which has 17, we are going to confirm that C-1a doesn't has a P2 by means of PCR for P2 cox and ogr genes.

Primers:

 Cox:

    >for_pre+rbs+cox_P2
 
    GTTTCTTCGAATTCGCGGCCGCTTCTAGGGGGCTAGAGGACGACATGAG

    >rev_suf+dSTOP+cox_P2
 
    GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAACGTGGTTCACCGAGAC
 Ogr:

    >Forward_OGR

    GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCGGAAGAGGTGCTCGCGATG 
    
    >Reverse_OGR

    GTTTCTTCCTGCAGCGGCCGCTACTAGTATTA,TTACATCCACATAATTTGCTGCCC 
Expected Regions:

  Cox:
  



  Ogr:


Strains were platted on June 19, 2009 and were maintained at 4ºC and also a glycerol stock was created for C-1a and C-117. With a wood stick bacteria was taken and inoculated in LB without any selection.

The inoculated medium was incubated at 37ºC 250 rpm. for 1 hr. and then centrifuged at maximum speed with a tabletop centrifuge, supernatant was discarded and 200 µL of Tris-EDTA 10/1-NaCl 10mM added. The samples were heated over 10 min at 95ºC and then centrifuged again 2 min. 10µL of supernatant were taken for the PCR.


PCR Reaction:

   Water         24µL
   Buffer 10x    5µL
   MgCl2 50mM    2.5µL
   dNTP's 0.4mM  3.5µL
   Taq           1µL
   primer up     2.5µL
   primer low    2.5µL
   DNA           10µL
   Total         50µL


PCR results:
 
	Control		-
	C-117/ogr	+
	C-1a/ogr	-
	DH5alpha/ogr	+
	C-117/cox	+
	C-1a/cox	-
	DH5alpha/cox	-

The PCR's were consistent with previous results in literature. For example ogr was positive for DH5alpha which is a derivative from K-12 and we could not obtain PCR products from C-1a. C-117 which has P2 in lysogenic state gave use positive PCR products for ogr and cox.

August 3, 2009

We prepared overnights of DH5alpha which contain the BioBricks pSB1AK3 and pSB1T3 the selective medium was 50µL/mL Kanamycin and 20µL/mL Tetracycline respectively


August 4, 2009

We redo the colony PCR for ogr and cox only using the C-117 strain. The PCR products were purified using the High Pure PCR Product Roche's Purification Kit and also plasmidic DNA was purified from the last overnights using the High Pure Plasmid Roche's Isolation Kit. The plasmids that were purified are going to used to add a double terminator sequence to ogr and clone cox for future manipulations.

       1) ogr EcoRI/SpeI
       2) cox EcoRI/PstI
       3) BBa_B0015 EcoRI/XbaI (plasmid pSB1AK3)
       4) BBa_J04450 EcoRI/PstI (plasmid pSB1T3)
Restriction Reactions:

	DNA	10µL
	Ezimas	.5µL each one  
	Buffer	2µL
	Water	7µL
	Total	20µL

Vectors that will be use for cloning were dephosphorylated with Antarctic Phosphatase to avoid as much as possible false positives and also screening to many colonies.

 Dephosphorylation Reaction:

	Plasmid		20µL
	Buffer		3µL
	Enzyme		1µL
	Water		6µL
	Total		30µL
	
    Incubation conditions:

	1) 15 min --> 37ºC
	2) 5 min  --> 65ºC



Parts were ligated in the following way:

	1) ogr+BBa_B0015+pSB1T3
	2) cox+pSB1T3
Ligation Reactions:

	1)

	Buffer	4µL
	Ligase	1µL
	pSB1T3	2µL
	ogr	6µL
	BBa_B0015	7µL
	Weter	0µL
	Total	20µL

	2)

	Buffer	4µL
	Ligase	1µL
	pSB1T3	3µL
	cox	6µL
	Weter	6µL
	Total	20µL

The las reaction gave as a result the next parts:

       1)ogr+BBa_B0015+pSB1T3  
       2)cox+pSB1T3 

DH5alpha competent cells were transformed and platted on LB Agar with appropriate selection, for both constructions this selection was Tetracycline.

August 6, 2009

The ogr PCR product was cut with EbaI/PstI and cloned in pSB1T3 that was digested with the same enzymes and dephosphorylated as mentioned earlier. And then we performed a ligation reaction. The resulting BioBrick was named I-09#021.

	1) ogr EcoRI/PstI
Restriction Reaction:

	DNA	10µL
	Ezimas	.5µL 
	Buffer	2µL
	Water	7µL
	Total	20µL

A 1% agarose gel was prepared and run 1 hr. 85 V. to see the insert and plasmid concentration. Unfortunately we loose our ogr's PCR product so we performed a new PCR only for this gene.


August 7, 2009

The PCR for ogr was done using the DNA from strain C-117.

PCR Reaction:

	Water 	23µL
	Buffer	5µL
	MgCl2	2.5µL
	dNTPs 	.5	each
	Taq/pol	1µL
	Oligo	2.5	each
	DNA	10µL
	Total	50µL

PCR:
	
	1) Control	+
	2) C-117/ogr	+
	3) C-117/ogr	+
	4) C-117/ogr	+
	5) C-117/ogr	+
	

An Agarose gel was run and we find that one of our reactants was contaminated because our negative control was positive that PCR is going to be repeated but with different reactants

August 10, 2009

We are going to change the PCR reagents because we don't know if they are contaminated and perform the next PCR reaction.

Reagents to be changed:

 1)primers for cox and ogr
 2)buffer 10X
 3)MgCl2

I'm going to do again the PCR for ogr and cox only from C-117 and as a control C-1a and DH5alpha the former control neither has a cox gene nor an ogr gene.

 PCR Reactions:          1)     2)     3)     4)      5)      6)     7)      8)      9)     10)

 Water            23µL   +      +      +      +       +       +      +       +       +       +
 Buffer 10X        5µL   +      +      +      +       +       +      +       +       +       +
 MgCl2           2.5µL   +      +      +      +       +       +      +       +       +       +
 dNTP's          3.5µL   +      +      +      +       +       +      +       +       +       +
 Taq               1µL   +      +      +      +       +       +      +       +       +       +
 primer fw       2.5µL   +      +      +      +       +       +      +       +       +       +
 primer rev      2.5µL   +      +      +      +       +       +      +       +       +       +
 DNA tamplate     10µL   -      -      +      +       +       +      +       +       +       +

1)control for cox only primers
2)control for ogr only primers
3)control for DH5alpha ogr it must be positive
4)control for ogr & cox with strain C-1a it must be negative
5-7)PCR of interest positive for C-117 ogr gene
8-10)PCR of interest positive for C-117 cox gene

August 11, 2009

The PCR for ogr was done again and everything looked OK so we purified the PCR products with the High Pure PCR Product Roche's Purification Kit. An Agarose gel was run to see how much DNA was lost during the purification procedure and the using this information to add the right amount of restriction enzymes.

The first three lanes are cox, ogr and ogr+BBa_B0015 amplified using the prefix and suffix primer for these genes

Agust 13, 2009

Plasmid 18 was dephosphorylated because we are going to insert in it the ogr product that was amplified yesterday.

Dephosphorylation Reaction:

  Plasmid    20µL
  Buffer     3µL
  Enzyme     1µL
  Water      6µL
    
    Incubation:

    1)15 min --> 37ºC
    2)5 min  --> 65ºC

This plasmid that is going to be ligated with ogr is digested EcoRI/PstI.

cox was cut with EcoRI/SpeI and the plasmid that contain ogr+BBa_B0015 with EcoRI/XbaI because we are going to insert cox into this plasmid in order to concatenate cox+ogr+BBa_B0015.

August 14, 2009

Vector pSB1T3 was dephosphorylated and again a 1% Agarose gel was run with the vector and the ogr PCR product to check concentrations and posterior to this a ligation reaction was performed.

The Ligase enzyme that we are using is T4 DNA ligase from New England Biolabs which has the following reaction conditions

10 min at 23ºC and for inactivation incubate 20 min at 70ºC

Ligation Reaction:

	T4 Ligase	1µL
	Buffer		2µL
	ogr		2µL
	pSB1T3		5µL
	Water		10µL
	Total		20µL

Once the ligation reaction finished we transformed DH5alpha competent cells and platted them on selective medium.


August 18, 2009

We started to prepare glycerol for the BrioBricks and Strains that we have finished to store them at -70ºC.

The BBa_R0010/pSB1A2 which has an IPTG inducible promoter is going to be purified and digested to put under the control of this promoter the construction cox+ogr+BBa_B0015.

The plasmid was digested with SpeI/PstI and the insert with XbaI/PstI.

To construct cox+ogr+BBa_B0015 we took cox that was in pSB1T3 and ogr+BBa_B0015 also in pSB1T3 and perform the following reactions:

Restriction Reaction:
					       Resistance
	pSB1T3+ogr+BBa_B0015	XbaI/PstI	  Tet
	pSB1T3+cox	        EcoRI/SpeI	  Tet
	pSB1C3		        EcoRI/PstI	  Cm

We expect white colonies and resistant to Cm because pSB1C3 has cloned an RFP protein that is expressed constitutively.

August 20, 2009

We performed restriction reactions with different colonies that carry the same plasmid to perform parallel constructions to avoid the case where a mutation could arise over one of the constructions leading this to the need of doing again the whole construction from a previous step.

DH5alpha strains that contain the listed plasmids below were grown in selective media and plasmid purification was performed and afterwards it was digested.


Plasmids:
	
	1) ogr	XbaI/PstI
	2) ogr+pSB1CB	XbaI/PstI
	3) ogr+pSB1CB	EcoRI/PstI
	4) ogr+pSB1CB	EcoRI/PstI
	5) ogr+pSB1CB	EcoRI/PstI
	6) BBa_J04450	EcoRI/PstI
	7) ogr+BBa_PB1005	EcoRI/PstI
	8) BBa_J04450	EcoRI/PstI
       9) cox
Restriction Reactions:
	
	Buffer		4µL
 	BSA		.4µL
	DNA		25µL
 	Enzyme		2µL	each
	Water		6.6µL
	Total		40µL

August 21, 2009

An 1% Agarose gel was run for 1hr. at 85 V.

With this gel was confirmed that ogr is cloned in pSB1T3 and now we can make a glycerol for this strain.

First nine lanes interest.

24 Ago 2009

The pSB1C3 was dephosphorylated with antarctic phosphate

Dephospohrialtion Reaction:

	Plasmid		20µL
	Buffer		3µL
	Enzyme		1µL
	Water		6µL
	Total		30µL

	Incubation:
	
		1) 15 min ––> 37ºC
		2) 5 min --> 65ºC

After plasmid dephosphorialtion we are going to perform a ligation reaction between cox and ogr+BBa_0015

August 25, 2009

Again an Agarose was run 1hr. at 85 V. to se the relative concentration of each sample that is going to be use for the ligation reaction.

Ligation Reaction:

	T4-ligase	 1µL
	Buffer		2µL
	#023.1		3µL
	#022.1		3µL
	#017.1		2µL
	Water		9µL
	Total		20µL

	Incubation:

		1) 10 min. --> 20ºC-25ºC
		2) 20 min. --> 65ºC

	Controls:

		1) Vector without dephosphorylation 
		2) Dephosphorilated vector without insert
	

We platted DH5alpha transformed cells over selective medium and incubate the plates overnight at 37ºC.

August 27, 2009

Plasmid extraction

August 29, 2009

From ligation and transformation on Ago 25 a restriction analysis form tree selected proteins.

We are going to cut the purified plasmid from transformed cells in the following way:

	1) I-09#012	SpeI/PstI
	2) I-09#24.1	XbaI/PstI
	3) I-09#24.2	XbaI/PstI
	4) I-09#24.3	XbaI/PstI
Restriction Reaction:

	Buffer 		4µL
	BSA		0.4µL
	Enzyme		2µL each 
	DNA		25µL
	Total		40µL

We run a 1% Agarose gel at 85 V. 1hr

Unfortunately cox+ogr+BBa_B0015 cloning by fusing cox and ogr+BBa_B0015 in another plasmid didn't work out. We will try to repeat the procedure to see if we are luckier.

September 7, 2009

Again we dephophorylated vector I-09#017 to ligate it with cox and ogr+BBa_B0015 and then perform a transformation

Dephosphorylation Reaction:

	Plasmid		20µL
	Buffer		3µL
	Enzyme		1µL
	Water		6µL
	Total		30µL
	
    Incubation conditions:

	1) 15 min --> 37ºC
	2) 5 min  --> 65ºC


Ligation Reaction:

       T4-ligase	 1µL
       Buffer		2µL
       #023.1		3µL
       #022.1		3µL
       #017.1		2µL
       Water		9µL
       Total		20µL

    Incubation conditions:

       1) 10 min. --> 20ºC-25ºC
       2) 20 min. --> 65ºC

    Controls:

       1) Vector without dephosphorylation 
       2) Dephosphorilated vector


We platted DH5alpha transformed cells over selective medium and incubated overnight at 37ºC.

September 11, 2009

Colony PCR reactions were done with selected colonies that resulted from the last transformation the resulting and tow of the twenty-one looked like they contained cox+ogr+BBa_B0015 verification with a restriction assay was done and also ogr+BBa_B0015+18 was purified and opened digested with EcoRI/PstI to be prepared in case last ligation don't work.


September 15, 2009

The ligation didn't work, I planned to follow a different strategy first purify the cox fragment using Low melt point Agarose, we are using this procedure because the plasmido that contain cox is the samen as the one that has ogr+BBa_B0015 and as a consequence the same antibiotic resistance gene, so by separating the DNA by electrophoresis we can take apart cox gene and the ligated in to the dephoshorylated plasmid ogr+BBa_B0015 that was digested EcoRI/XbaI, the resultin plasmid will be cox+ogr+BBa_B0015.

September 22, 2009

Band purification:

Quiagen gel exration kit was used for this.

An 1% Low melt point agarose gel was loaded with the sample that contained cox+18, the gel was stained with ethdium bromaid and saw with a transluminator. Once we saw our band it was cut from the gel and transferred to an 1.5 mL tube and weighted (0.13g) in the kit protocol they propose an equivalences of buffer 100mg~100µL so we have to add 3 volumes of each 130µL of buffer and follow the kit protocol.

September 23, 2009

A ligation is going to be done with cox and ogr+BBa_B0015, ogr+BBa_B0015+18 was dephosphorylated and cox was purified via gel. As a control we will try to religate the dephosphorylated plasmid, the same plasmid not dephosphorylated and a uncut plasmid which must transform because was not digested.

Ligation Reaction:

 T4 ligase   1µL
 Buffer      2µL
 ogr+BBa_B0015     2µL
 cox         5µL
 Water       10µL
 Total       20µL

   Controls:

    1)dephosphorylated plasmid         2)non-dephosphorylated
    
    T4 ligase   1µL                    T4 ligase     1µL
    Buffer      2µL                    Buffer        2µL
    Plasmid     2µL                    Plasmid       2µL
    Water      15µL                    Water        15µL
    Total      20µL                    Total        20µL
  Incubation:

    1)10 min --> 25ºC
    2)20 min --> 65ºC

DH5alpha competent cells were transformed and platted over selective media in this case Tet.

September 24, 2009

All controls resulted as expected so the must probable is that we achieved to ligate cox with ogr+BBa_B0015+18 I prepared overnights to extract plasmid tomorrow and perform a restriction assay to see if we have the fragment of interest.

September 25, 2009

To check last ligations a restriction assay is going to be done in a way that allows us to do the next ligation and finish the phage production control system.

Restriction Reactions:

  1)XbaI/PstI cox+18              2)XbaI/PstI cox+ogr+BBa_B0015 colonies[1-6]
  Buffer 2       2µL              Buffer2           2µL
  BSA          0.2µL              BSA             0.2µL
  Water        6.8µL              Water           6.8µL
  DNA           10µL              DNA              10µL
  Enzyme       0.5µL each(X/P)    Enzyme          0.5µL each(X/P)
  Total         20µl              Total            20µL


As the image show on the first 7 lanes we were able to ligate cox with ogr+BBa_B0015+18 every of the selected clones has the cox insert so this procedure was faster than the fisr that we tried to use the only thing is that you need to purify the insert via an Agarose gel and the ligate it to the plasmid of interest.

We are ready for the last step, we are going to add the IPTG inducible promoter to get the following structure.

iptg+cox+ogr+ter

The second lane sample was selected for ligation with IPTG

Ligation Reaction:

  T4 ligase        1µL
  Buffer           2µL
  cox+ogr+BBa_B0015      5µL
  iptg             5µL
  Water           10µL
  Total           20µL

DH5alpha competent cells were transformed and platted over LB Amp100 and incubate at 37ºC

September 28, 2009

Controls were inconsistent in particular the re-ligation of dephosphorylated plasmid which gave the same amount of colonies compared with ligation of cox+ogr+BBa_B0015 and 12 so we are going to re-dephosphorylate the vector 12 and perform a new ligation reaction.

Dephosphorylation Reaction:

  Plasmid     10µL
  Buffer       3µL
  Enzyme       1µL
  Water       16µL
  Total       30µL

    Incubation 
    1)10 min --> 25ºC
    2)20 min --> 65ºC

A 1% agarose gel was run to see the concetration of the plasmid and the insert, this to put the right amounts of insert and plasmid.



The samples that we are looking on the gel correspon to cox+ogr+BBa_B0015+18 digested with XbaI/SpeI and 12

Once we checked concetrations we can do the ligation reaction.

Ligation Reaction:
 
   T4 ligase     1µL
   Buffer        2µL
   cox+ogr+BBa_B0015   12µL
   12            4µL
   Water         1µL
   Total        30µL  

DH5alpha competent cells were transformed on LB agar Amp100 and incubated overnight 37ºC

September 29, 2009

Four colonies were selected an re-platted and also liquid 5 mL of LB was inoculated to prepare cultures for plasmid extraction.

September 30, 2009

An 1% Agarose gel was run to check concentrations for restriction assays and by this be able to know if we have the fragment we are interested.

The four plasmids were digested EcoRI/PstI

Restriction Reactions:

 Buffer     2µL
 BSA      0.2µL
 DNA       10µL
 Enzyme     1µL each  EcoRI/PstI
 Water    5.8µL   

The insert looks shifted upwards but a little amount so we didn't achieve to ligate the iptg to cox+ogr+BBa_B0015 this is strange because the plasmid maintained its size so the promoter is not there.I've checked the plasmid size an it is 2079 bp so the plasmid doesn't has the promoter.

Going back further when I digested for the first time plasmid pSB1A2 I did it with SpeI/PstI to allow promoter to be at the beginning of the construction.The insert cox+ogr+BBa_B0015 was digested XbaI/PstI so I think the unique alternative is that promoter ipteg wasn't in the plasmid.

In this circumstance we can only say that we changed cox+ogr+BBa_B0015 from plasmid pSB1T3 to pSB1A212 that is resitantant to Amp.

October 5, 2009

To test for the activity of the multipromoter that we designed and synthesized, we are going to transform E. coli BL21(DE3)plysS from novagen. This strain uses a T7 phage polymerase that is controlled thorough Lac promoter. The multipromoter is composed of T7 & T3 promoters, we expect that our construction will respond to IPTG.

The IPTG preparation protocol we used is discribed HERE!!!

Transformed cells were platted on LB medium with Kn and IPTG .5 mM and expect that the colonies will fluoresce and could be seeing with a transluminator.

Octuber 6, 2009

We took a look to the LB Agar plates with a transluminator at a wavelength of 395nm but because we didn't have a filter for GFP emitting wavelength we couldn't discriminate for our wavelength of interest.

We are going to try other approach this time with a microscope more suitable to see GFP.

October 7, 2009

 REGISTRY SITE FOR MULTIPROMOTER BBa_K242101
 m stands for multipromoter !!
Cultures were prepared as follows:
                             BL21/m+         BL21/m+       BL21/m-
   100 mL LB                    +               +             +
   100 µL Kan 30 µg/µL          +               +             - 
   100 µL Cam 20 µg/µL          +               +             +
    10 µL IPTG 1M               +               -             +


For the induction of protein production we started our culture at .1 abs 620nm in 100mL LB and waited until it reached 0.35 abs 620 nm then we added IPTG to a final concentration of 0.1mM and then we leave the culture media for four hours.

5mL of each culture were centrifuged at max speed and the supernatant was discarded. We prepared our samples to see them. Using a microscope with suitable filters and light to see GFP we compared the cultures between them

    Results:
                Bl21/m+     Bl21/m+    Bl21/m-
      IPTG        +            -         +
                 ++++         ++         -          Fluorescence 

In frame is BL21/multipromoter with IPTG inducer at 100X. Unfortunately the microscope and camera were not suitable to check in full detail BL21/m- IPTG+, which gave no fluorescence, and Bl21/multipromoter IPTG-, which presented a diminished fluorescence.

This results support the functioning of multipromoter for T7 polymerase.

Great NEWS!!! our promoter worked for T7 RNA polymerase

For future experiments to get a better characterization look result site.

October 20, 2009

I prepared cultures to purify plasmid that contains the parts that we are planning to send to the registry.

Part List:
cox 
ogr
ogr+cox+BBa_B0015
multipromoter

Three overnights for multipromoter testing were prepared, one would be induced by IPTG, other not and the latter is a BL21 strain that doesn't have the construction but will be grown with IPTG.

October 21, 2009

Preparation of parts for sending them to the registry!!!


References

To see all the literature that we used to develop the construction of control system pleas visit references site and look for ogr, cox, P2 and P4 papers References.

Locations of visitors to this page