Team:NYMU-Taipei/Project/Receptor/Autotransporter Secretion System

From 2009.igem.org

Contents

The autotransporter secretion system

Only Receptors that are exposed to the outside of E. coli can catch the virus. E.coli is a gram-negative bacterium that has an inner membrane and an outer membrane, and a periplasmic space between the inner and outer membranes. Because of this, we need the autotransporter secretion system to construct our receptor proteins on E. coli 's surface.

We chose to implement two different autotransporter mechanisms (OmpA and C-IgAP) because we wanted to test and compare their secretion abilities. We suspected that the C-IgAP system is more efficient than the OmpA system.

Lpp-OmpA-linker-(receptor)

autotransporter-1
PTetR
R0040

Image:NYMU_icon_P.png
RBS
B0034

Image:NYMU_icon_R.png
L-OmpA
K103006

Image:NYMU_icon_C.png
Receptor

Image:NYMU_icon_C.png

B0010

Image:NYMU_icon_T.png

B0012

Image:NYMU_icon_T.png

We used an existing BioBrick part: BBa_K103006 (iGEM08_Warsaw). The part contains Lpp, OmpA and a linker, so right after the linker, we can fuse with our receptor.

   1  catatgaaag ctactaaact ggtactgggc gcggtaatcc tgggttctac
  51  tctgctggca ggttgctcca gcaacgctaa aatcgatcag ggaattaacc
 101  cgtatgttgg ctttgaaatg ggttacgact ggttaggtcg tatgccgtac
 151  aaaggcagcg ttgaaaacgg tgcatacaaa gctcagggcg ttcaactgac
 201  cgctaaactg ggttacccaa tcactgacga cctggacatc tacactcgtc
 251  tgggtggcat ggtatggcgt gcagacacta aatccaacgt ttatggtaaa
 301  aaccacgaca ccggcgtttc tccggtcttc gctggcggtg ttgagtacgc
 351  gatcactcct gaaatcgcta cccgtctgga ataccagtgg accaacaaca
 401  tcggtgacgc acacaccatc ggcactcgtc cggacaacgg cggaggttct
 451  ggaggaggga gctc

Lpp: Lipoprotein signal peptide

When fused with another protein downstream, the signal peptide should anchor the protein to the outer membrane of E. coli, facing the periplasmic space.

OmpA: Outer membrane protein A

Five transmembrane domains of OmpA, crossing the outer membrane of E. coli, forming a barrel shape.
3D-structure of OmpA

topview
topview
sideview
sideview


PelB-(receptor)-C_IgAP

autotransporter-2
PTetR
R0040

Image:NYMU_icon_P.png
RBS
B0034

Image:NYMU_icon_R.png
PelB
J32015

Image:NYMU_icon_C.png
Receptor

Image:NYMU_icon_C.png
β-IgAP
K109405

Image:NYMU_icon_C.png

B0010

Image:NYMU_icon_T.png

B0012

Image:NYMU_icon_T.png

PelB: pelB leader sequence

A sequence of amino acids which when attached to a protein, directs the protein to the periplasmic membrane of E. coli, where the sequence is removed by pelB peptidase.

    1  atgaaatacc tgctgccgac cgctgctgct ggtctgctgc tcctcgctgc
   51  ccagccggcg atggcc

C-IgAP: Carboxy-terminal (β-) domain of Immunoglobulin A1 (IgA1) proteases1

PCR from genome of Neisseria gonorrhoeae FA1090(provide by Dr.Hsing-Ju Wu, Academia sinica/Institute of Biological Chemistry)

  • C-IgAP BBa_J32018
    • The mechanism autotransporters, has been examined using a single-chain antibody (scFv) as a reporter passenger domain to monitor the translocation process. Fusion of a scFv to the IgA protease allowed us to investigate the passage of the chimeric protein through the periplasm, its insertion into the outer membrane and the movement of the N-terminal moiety towards the cell surface. The binding activity of the scFv to its target antigen entirely rely on the formation of disulphide bonds.
    • The leader sequence of C-IgAP is cleaved at the membrane by a signal peptidase, releasing the mature polyprotein into the periplasm. When in the periplasm, the beta-domain of the protein inserts into the outer membrane to form a beta-barrel structure. After formation of the beta-barrel pore, the passenger domain is translocated to the cell surface through the pore. Once at the cell surface, several possibilities may occur:
  1. the protein remains intact as a large polyprotein that has a carboxy-terminal membrane-bound domain and an aminoterminal domain extending into the environment.
  2. the protein either gains autoproteolytic activity and cleaves itself or it is cleaved by an outer membrane protease, but in this case the passenger domain remains in contact with the cell surface via noncovalent interactions with the b-domain.
  3. the passenger domain gains its autoproteolytic activity or is cleaved by an outer membrane protease and is released into the environment.[1]
    1    aaagctgagg aagaagagca ccgtcaaaca gcccaatccc agccgcaacg 
   51    ccgcaaacgc cgtgccgcac cgcaggatta tatggcagtt tcccaagacc 
  101    gtccgaaacg tcgcggacgc agatctactc tgccggcacc gccctcgcca 
  151    tcatttgatt catcagctta cgcagcaccc agggccttgc ataatccgga 
  201    ctggtatgaa aatgattatg aagaaatccc cttggatgcg ctggaagatg
  251    aagatgtatc cgaatcggtt gacacatcag acaaacagcc tcaagacaat
  301    acggaacttc atgaaaaagt tgaggcagtg agtttgcaac caagagccgc
  351    gcagccgcga acccaagccg ccgcgcaagc cgatgcagtc agcaccaata
  401    ctaactcggc tttatctgac gcaatggcaa gcacgcaatc tatcttgttg 
  451    gatacaggtg cttcattaac acggcacatt gcacaaaaat cacgcgctga
  501    tgccgaaaaa aacagtgttt ggatgtcaaa caccggttat ggccgtgatt 
  551    atgcttccgc acaatatcgc cggtttagtt cgaaacgcac gcaaacacaa
  601    atcggcattg accgcagctt gtccgaaaat atgcagatag gcggagtatt 
  651    gacttactct gacagtcagc atacttttga tcaggcgggc ggcaaaaata
  701    cttttgtgca agccaacctt tatggtaagt attatttaaa tgatgcttgg 
  751    tatgtggccg gcgatattgg tgcgggcagc ttgagaagcc ggttacaaac
  801    gcagcaaaaa gcaaacttta accgaacaag catccaaacc ggccttactt 
  851    tgggcaatac gctgaaaatc aatcaattcg agattgtccc tagtgcgggt
  901    atccgttaca gccgcctgtc atctgcagat tacaagttgg gtgacgacag 
  951    tgttaaagta agttctatgg cagtgaaaac actaacggcc ggactggatt
 1001    ttgcttatcg gtttaaagtc ggcaacctta ccgtaaaacc cttgttatct 
 1051    gcagcttact ttgccaatta tggcaaaggc ggcgtgaatg tgggcggtaa
 1101    atccttcgcc tataaagcag ataatcaaca gcaatattca gcaggcgccg 
 1151    cgttactgta ccgtaatgtt acattaaacg taaatggcag tattacaaaa
 1201    ggaaaacaat tggaaaaaca aaaatccgga caaattaaaa tacagattcg 
 1251    tttctaa

But this part is not exist in plate. We need to PCR this sequence from Neisseria gonorrhoeae by ourself.

 PCR the C-IgAP   outer primer 
  gcttctagag AAAGCTGAGGAAGAAGAGC 53deg,  CG:47%,10+19=29bp
  ctgcagcggccgctactagta  TTAGAAACGAATCTGTATTTTAATTTGT 52deg,  CG:21%, 21+28=49bp


There have some problem:Pst1 cutting site...So we have to mutate these site dierectly.


    1    aaagctgagg aagaagagca ccgtcaaaca gcccaatccc agccgcaacg 
   51    ccgcaaacgc cgtgccgcac cgcaggatta tatggcagtt tcccaagacc 
  101    gtccgaaacg tcgcggacgc agatctactc tgccggcacc gccctcgcca 
  151    tcatttgatt catcagctta cgcagcaccc agggccttgc ataatccgga 
  201    ctggtatgaa aatgattatg aagaaatccc cttggatgcg ctggaagatg
  251    aagatgtatc cgaatcggtt gacacatcag acaaacagcc tcaagacaat
  301    acggaacttc atgaaaaagt tgaggcagtg agtttgcaac caagagccgc
  351    gcagccgcga acccaagccg ccgcgcaagc cgatgcagtc agcaccaata
  401    ctaactcggc tttatctgac gcaatggcaa gcacgcaatc tatcttgttg 
  451    gatacaggtg cttcattaac acggcacatt gcacaaaaat cacgcgctga
  501    tgccgaaaaa aacagtgttt ggatgtcaaa caccggttat ggccgtgatt 
  551    atgcttccgc acaatatcgc cggtttagtt cgaaacgcac gcaaacacaa
  601    atcggcattg accgcagctt gtccgaaaat atgcagatag gcggagtatt 
  651    gacttactct gacagtcagc atacttttga tcaggcgggc ggcaaaaata
  701    cttttgtgca agccaacctt tatggtaagt attatttaaa tgatgcttgg 
  751    tatgtggccg gcgatattgg tgcgggcagc ttgagaagcc ggttacaaac
  801    gcagcaaaaa gcaaacttta accgaacaag catccaaacc ggccttactt 
  851    tgggcaatac gctgaaaatc aatcaattcg agattgtccc tagtgcgggt
  901    atccgttaca gccgcctgtc atctgcagat tacaagttgg gtgacgacag 
  951    tgttaaagta agttctatgg cagtgaaaac actaacggcc ggactggatt
 1001    ttgcttatcg gtttaaagtc ggcaacctta ccgtaaaacc cttgttatct 
 1051    gcagcttact ttgccaatta tggcaaaggc ggcgtgaatg tgggcggtaa
 1101    atccttcgcc tataaagcag ataatcaaca gcaatattca gcaggcgccg 
 1151    cgttactgta ccgtaatgtt acattaaacg taaatggcag tattacaaaa
 1201    ggaaaacaat tggaaaaaca aaaatccgga caaattaaaa tacagattcg 
 1251    tttctaa


modify

    1    aaagctgagg aagaagagca ccgtcaaaca gcccaatccc agccgcaacg 
   51    ccgcaaacgc cgtgccgcac cgcaggatta tatggcagtt tcccaagacc 
  101    gtccgaaacg tcgcggacgc agatctactc tgccggcacc gccctcgcca 
  151    tcatttgatt catcagctta cgcagcaccc agggccttgc ataatccgga 
  201    ctggtatgaa aatgattatg aagaaatccc cttggatgcg ctggaagatg
  251    aagatgtatc cgaatcggtt gacacatcag acaaacagcc tcaagacaat
  301    acggaacttc atgaaaaagt tgaggcagtg agtttgcaac caagagccgc
  351    gcagccgcga acccaagccg ccgcgcaagc cgatgcagtc agcaccaata
  401    ctaactcggc tttatctgac gcaatggcaa gcacgcaatc tatcttgttg 
  451    gatacaggtg cttcattaac acggcacatt gcacaaaaat cacgcgctga
  501    tgccgaaaaa aacagtgttt ggatgtcaaa caccggttat ggccgtgatt 
  551    atgcttccgc acaatatcgc cggtttagtt cgaaacgcac gcaaacacaa
  601    atcggcattg accgcagctt gtccgaaaat atgcagatag gcggagtatt 
  651    gacttactct gacagtcagc atacttttga tcaggcgggc ggcaaaaata
  701    cttttgtgca agccaacctt tatggtaagt attatttaaa tgatgcttgg 
  751    tatgtggccg gcgatattgg tgcgggcagc ttgagaagcc ggttacaaac
  801    gcagcaaaaa gcaaacttta accgaacaag catccaaacc ggccttactt 
  851    tgggcaatac gctgaaaatc aatcaattcg agattgtccc tagtgcgggt
  901    atccgttaca gccgcctgtc atTtgcagat tacaagttgg gtgacgacag 
  951    tgttaaagta agttctatgg cagtgaaaac actaacggcc ggactggatt
 1001    ttgcttatcg gtttaaagtc ggcaacctta ccgtaaaacc cttgttatct 
 1051    gcCgcttact ttgccaatta tggcaaaggc ggcgtgaatg tgggcggtaa
 1101    atccttcgcc tataaagcag ataatcaaca gcaatattca gcaggcgccg 
 1151    cgttactgta ccgtaatgtt acattaaacg taaatggcag tattacaaaa
 1201    ggaaaacaat tggaaaaaca aaaatccgga caaattaaaa tacagattcg 
 1251    tttctaa
 mutant primer
 1.
 C-IgAP_mt1_F:gcctgtcatTtgcagattacaag
 C-IgAP_mt1_R:cttgtaatctgcaAatgacaggc
 
 2.
 C-IgAP_mt2_F:ctgcCgcttactttgcc
 C-IgAP_mt2_R:ggcaaagtaagcGgcag

Experiments

PCR the C-IgAP from genome of Neisseria gonorrhoeae FA1090(Pfu)


Mix: 50μl
template 1μl
forward primer C-IgAP 1μl
reverse primer C-IgAP 1μl
dNTP 2μl
10x buffer 5μl
Pfu 0.5μl
ddH20 38μl
Protocol:
1. 94oC: 59s
2.
40 cycles
94oC: 20s
55oC: 30s
72oC: 180s
3. 72oC: 300s
2% agarose, 100V, 25min

Descr Win length Fail length
0: marker 100bp
1: C-IgAP ~1300 900
2: positive Control C-IgAP(old)
3: Negative Control 0bp
4: marker 100bp


Reference