Team:NYMU-Taipei/Project/Receptor/CD4

From 2009.igem.org

Motivation

Virus have a high mutation rate, so our immune system can not always detect mutated viruses. But virus capsid proteins have some specific binding proteins that viruses use to enter into human cells. There are some highly conserved regions on the virus proteins, since mutations of these regions will never be worth it for the viruses since the viruses will not be able to enter human cells and survive.

In our ViroCatcher, we want to express human receptors that interact with HIV. In addition, we have to check the folding of the target receptors, because our receptors from human cells would have to express in bacteria. Eventually, to make contact with receptors of HIV, we have to anchor the receptors on the membrane of our ViroCatcher.

Goal

Use the receptors on human cells that bind to HIV, and put them on our ViroCatcher to catch HIV.

Receptors used to catch HIV

Previous study indicate that HIV absorb T cell and macrophage by their envelope glycoprotein[1,2], and insert a fusion peptide into target cell to change their membrane structure. Changing of membrane structures will help the fusion between the HIV envelope and the target cell membrane. The CD4 receptor of macrophage and T cells are the main target of HIV. HIV attaches onto human cells using their gp120 protein. The binding causes a shift of conformation on gp120 that allows the connection between gp120 and the co-receptor CCR5 or CXCR4[1,2].

figure from website:http://www.bio.davidson.edu/Courses/Molbio/MolStudents/spring2003/Cobain/geneprotein.html

We express the two receptors CD4 and CCR5 on our ViroCatcher membrane and use autotransporter system to anchor the receptors on the membrane of our ViroCatcher.

CD4 sequence

       1 atgaaccggg gagtcccttt taggcacttg cttctggtgc tgcaactggc gctcctccca
      61 gcagccactc agggaaagaa agtggtgctg ggcaaaaaag gggatacagt ggaactgacc
     121 tgtacagctt cccagaagaa gagcatacaa ttccactgga aaaactccaa ccagataaag
     181 attctgggaa atcagggctc cttcttaact aaaggtccat ccaagctgaa tgatcgcgct
     241 gactcaagaa gaagcctttg ggaccaagga aactttcccc tgatcatcaa gaatcttaag
     301 atagaagact cagatactta catctgtgaa gtggaggacc agaaggagga ggtgcaattg
     361 ctagtgttcg gattgactgc caactctgac acccacctgc ttcaggggca gagcctgacc
     421 ctgaccttgg agagcccccc tggtagtagc ccctcagtgc aatgtaggag tccaaggggt
     481 aaaaacatac agggggggaa gaccctctcc gtgtctcagc tggagctcca ggatagtggc
     541 acctggacat gcactgtctt gcagaaccag aagaaggtgg agttcaaaat agacatcgtg
     601 gtgctagctt tccagaaggc ctccagcata gtctataaga aagaggggga acaggtggag
     661 ttctccttcc cactcgcctt tacagttgaa aagctgacgg gcagtggcga gctgtggtgg
     721 caggcggaga gggcttcctc ctccaagtct tggatcacct ttgacctgaa gaacaaggaa
     781 gtgtctgtaa aacgggttac ccaggaccct aagctccaga tgggcaagaa gctcccgctc
     841 cacctcaccc tgccccaggc cttgcctcag tatgctggct ctggaaacct caccctggcc
     901 cttgaagcga aaacaggaaa gttgcatcag gaagtgaacc tggtggtgat gagagccact
     961 cagctccaga aaaatttgac ctgtgaggtg tggggaccca cctcccctaa gctgatgctg
    1021 agtttgaaac tggagaacaa ggaggcaaag gtctcgaagc gggagaaggc ggtgtgggtg
    1081 ctgaaccctg aggcggggat gtggcagtgt ctgctgagtg actcgggaca ggtcctgctg
    1141 gaatccaaca tcaaggttct gcccacatgg tccaccccgg tgcagccaat ggccctgatt
    1201 gtgctggggg gcgtcgccgg cctcctgctt ttcattgggc taggcatctt cttctgtgtc
    1261 aggtgccggc accgaaggcg ccaagcagag cggatgtctc agatcaagag actcctcagt
    1321 gagaagaaga cctgccagtg tcctcaccgg tttcagaaga catgtagccc catttga

outer primer (forward) contain ompA sticky tag

GCACTCGTCCGGACAAC(56deg, 65%, 17bp)ATGAACCGGGGAGTCC(54deg, 63%, 16bp)

outer primer (reverse)

ctgcagcggccgctactagta AATGGGGCTACATGTCTTCT 55deg, 45%, 20bp

CCR5 sequence

       1 atggattatc aagtgtcaag tccaatctat gacatcaatt attatacatc ggagccctgc
      61 caaaaaatca atgtgaagca aatcgcagcc cgcctcctgc ctccgctcta ctcactggtg
     121 ttcatctttg gttttgtggg caacatgctg gtcatcctca tcctgataaa ctgcaaaagg
     181 ctgaagagca tgactgacat ctacctgctc aacctggcca tctctgacct gtttttcctt
     241 cttactgtcc ccttctgggc tcactatgct gccgcccagt gggactttgg aaatacaatg
     301 tgtcaactct tgacagggct ctattttata ggcttcttct ctggaatctt cttcatcatc
     361 ctcctgacaa tcgataggta cctggctgtc gtccatgctg tgtttgcttt aaaagccagg
     421 acggtcacct ttggggtggt gacaagtgtg atcacttggg tggtggctgt gtttgcgtct
     481 ctcccaggaa tcatctttac cagatctcaa aaagaaggtc ttcattacac ctgcagctct
     541 cattttccat acagtcagta tcaattctgg aagaatttcc agacattaaa gatagtcatc
     601 ttggggctgg tcctgccgct gcttgtcatg gtcatctgct actcgggaat cctaaaaact
     661 ctgcttcggt gtcgaaatga gaagaagagg cacagggctg tgaggcttat cttcaccatc
     721 atgattgttt attttctctt ctgggctccc tacaacattg tccttctcct gaacaccttc
     781 caggaattct ttggcctgaa taattgcagt agctctaaca ggttggacca agctatgcag
     841 gtgacagaga ctcttgggat gacgcactgc tgcatcaacc ccatcatcta tgcctttgtc
     901 ggggagaagt tcagaaacta cctcttagtc ttcttccaaa agcacattgc caaacgcttc
     961 tgcaaatgct gttctatttt ccagcaagag gctcccgagc gagcaagctc agtttacacc
    1021 cgatccactg gggagcagga aatatctgtg ggcttgtga

outer primer (forward) contain ompA sticky tag

GCACTCGTCCGGACAAC(56deg, 65%, 17bp)ATGGATTATCAAGTGTCAAGTCC (54deg, 39%, 23bp)

outer primer (reverse)

ctgcagcggccgctactagta CAAGCCCACAGATATTTCCTG 55deg, 48%, 21bp

inner primer1

CATTACACCTGtAGCTCTCATT 53deg, 41%, 22bp 
AATGAGAGCTaCAGGTGTAATG

inner primer2

TTCCAGGAgTTCTTTGGC 53deg, 50%, 18bp 
GCCAAAGAAcTCCTGGAA

Circuit design

HIV receptors

pRE
K116603

RBS
B0034

transmembrane region

CD4 or CCR5

B0010

B0012

References

1. Chan DC, Kim PS: HIV entry and its inhibition. Cell 1998, 93(5):681-684.
2. Wyatt R, Sodroski J: The HIV-1 envelope glycoproteins: fusogens, antigens, and immunogens. Science 1998, 280(5371):1884-1888.