"
Team:NYMU-Taipei/Project/Receptor/Integrin
From 2009.igem.org
| Home | Project Overview: | Chassis | Receptors | Removal | Experiments and Parts | F.A.Q | About Us |
Contents |
Motivation
Virus have a high mutation rate, so our immune system can not always detect mutated viruses. But virus capsid proteins have some specific binding proteins that viruses use to enter into human cells. There are some highly conserved regions on the virus proteins, since mutations of these regions will never be worth it for the viruses since the viruses will not be able to enter human cells and survive.
We wanted to express receptors that interact with several viruses (such as Adenovirus and coxsackievirus) originating from human cells in our ViroCatcher. In addition, we have to check the folding of target receptors, because our receptors come from human cells have to express and fold in bacteria. Eventually, to make contact with receptors of Adenovirus-like viruses and we have to anchor the receptors on the membrane of our ViroCatcher.
Goal
Use the receptors on human cells that bind to adenovirus-like viruses, and put them on our ViroCatcher to catch adenovirus-like viruses.
Receptors used to catch adenovirus and coxsackievirus
Previous studies indicates that several viruses like adenovirus and coxsackivirus interact with cellular receptors alpha-V integrin to entry into human cells. These virus capsid proteins has a conserve "RGD" region that interacts with the human α-V integrin receptor. Previous studies also shows that when virus lose the "RGD" motif, they reduce their ability of infection[1]. Not only can adenovirus and cosackievirus interact with receptor the α-V integrin, many other viruses can interact with it (See table 1)[2].
We chose to use receptor α-V integrin to catch viruses that has the "RGD" motif, so our ViroCatcher can catch several virus just by using the alpha-V integrin receptor.
Here we chose another receptor CAR (coxsackievirus and adenovirus receptor) that is used specially for catching adenovirus and coxsakievirus. Adenovirus and coxsakievirus not only bind to the α-V integrin receptor, it also binds to the CAR receptor when they infect our cells. They use their fiber proteins on their capsid to interact with the CAR receptor[3].
Previous studies also indicates that the binding affinity of the CAR receptor is better than α-V integrin, so we add the CAR receptor to ensure that our ViroCatcher can catch adenovirus and coxsackievirus[3].
We express the two receptors α-V integrin and the CAR receptor on our ViroCatcher membrane and use autotransporter system to anchor them on the membrane of our ViroCatcher.
1 atggcttttc cgccgcggcg acggctgcgc ctcggtcccc gcggcctccc gcttcttctc
61 tcgggactcc tgctacctct gtgccgcgcc ttcaacctag acgtggacag tcctgccgag
121 tactctggcc ccgagggaag ttacttcggc ttcgccgtgg atttcttcgt gcccagcgcg
181 tcttcccgga tgtttcttct cgtgggagct cccaaagcaa acaccaccca gcctgggatt
241 gtggaaggag ggcaggtcct caaatgtgac tggtcttcta cccgccggtg ccagccaatt
301 gaatttgatg caacaggcaa tagagattat gccaaggatg atccattgga atttaagtcc
361 catcagtggt ttggagcatc tgtgaggtcg aaacaggata aaattttggc ctgtgcccca
421 ttgtaccatt ggagaactga gatgaaacag gagcgagagc ctgttggaac atgctttctt
481 caagatggaa caaagactgt tgagtatgct ccatgtagat cacgtcagct tatttcggat
541 caagtggcag aaatcgtatc taaatacgac cccaatgttt acagcatcaa gtataataac
601 caattagcaa ctcggactgc acaagctatt tttgatgaca gctatttggg ttattctgtg
661 gctgtcggag atttcaatgg tgatggcata gatgactttg tttcaggagt tccaagagca
721 gcaaggactt tgggaatggt ttatatttat gatgggaaga acatgtcctc cttatacaat
781 tttactggcg agcagatggc tgcatatttc ggattttctg tagctgccac tgacattaat
841 ggagatgatt atgcagatgt gtttattgga gcacctctct tcatggatcg tggctctgat
901 ggcaaactcc aagaggtggg gcaggtctca gtgtctctac agagagcttc aggagacttc
961 cagacgacaa agctgaatgg atttgaggtc tttgcacggt ttggcagtgc catagctcct
1021 ttgggagatc tggaccagga tggtttcaat gatattgcaa ttgctgctcc atatgggggt
1081 gaagataaaa aaggaattgt ttatatcttc aatggaagat caacaggctt gaacgcagtc
1141 ccatctcaaa tccttgaagg gcagtgggct gctcgaagca tgccaccaag ctttggctat
1201 tcaatgaaag gagccacaga tatagacaaa aatggatatc cagacttaat tgtaggagct
1261 tttggtgtag atcgagctat cttatacagg gccagaccag ttatcactgt aaatgctggt
1321 cttgaagtgt accctagcat tttaaatcaa gacaataaaa cctgctcact gcctggaaca
1381 gctctcaaag tttcctgttt taatgttagg ttctgcttaa aggcagatgg caaaggagta
1441 cttcccagga aacttaattt ccaggtggaa cttcttttgg ataaactcaa gcaaaaggga
1501 gcaattcgac gagcactgtt tctctacagc aggtccccaa gtcactccaa gaacatgact
1561 atttcaaggg ggggactgat gcagtgtgag gaattgatag cgtatctgcg ggatgaatct
1621 gaatttagag acaaactcac tccaattact atttttatgg aatatcggtt ggattataga
1681 acagctgctg atacaacagg cttgcaaccc attcttaacc agttcacgcc tgctaacatt
1741 agtcgacagg ctcacattct acttgactgt ggtgaagaca atgtctgtaa acccaagctg
1801 gaagtttctg tagatagtga tcaaaagaag atctatattg gggatgacaa ccctctgaca
1861 ttgattgtta aggctcagaa tcaaggagaa ggtgcctacg aagctgagct catcgtttcc
1921 attccactgc aggctgattt catcggggtt gtccgaaaca atgaagcctt agcaagactt
1981 tcctgtgcat ttaagacaga aaaccaaact cgccaggtgg tatgtgacct tggaaaccca
2041 atgaaggctg gaactcaact cttagctggt cttcgtttca gtgtgcacca gcagtcagag
2101 atggatactt ctgtgaaatt tgacttacaa atccaaagct caaatctatt tgacaaagta
2161 agcccagttg tatctcacaa agttgatctt gctgttttag ctgcagttga gataagagga
2221 gtctcgagtc ctgatcatat ctttcttccg attccaaact gggagcacaa ggagaaccct
2281 gagactgaag aagatgttgg gccagttgtt cagcacatct atgagctgag aaacaatggt
2341 ccaagttcat tcagcaaggc aatgctccat cttcagtggc cttacaaata taataataac
2401 actctgttgt atatccttca ttatgatatt gatggaccaa tgaactgcac ttcagatatg
2461 gagatcaacc ctttgagaat taagatctca tctttgcaaa caactgaaaa gaatgacacg
2521 gttgccgggc aaggtgagcg ggaccatctc atcactaagc gggatcttgc cctcagtgaa
2581 ggagatattc acactttggg ttgtggagtt gctcagtgct tgaagattgt ctgccaagtt
2641 gggagattag acagaggaaa gagtgcaatc ttgtacgtaa agtcattact gtggactgag
2701 acttttatga ataaagaaaa tcagaatcat tcctattctc tgaagtcgtc tgcttcattt
2761 aatgtcatag agtttcctta taagaatctt ccaattgagg atatcaccaa ctccacattg
2821 gttaccacta atgtcacctg gggcattcag ccagcgccca tgcctgtgcc tgtgtgggtg
2881 atcattttag cagttctagc aggattgttg ctactggctg ttttggtatt tgtaatgtac
2941 aggatgggct tttttaaacg ggtccggcca cctcaagaag aacaagaaag ggagcagctt
3001 caacctcatg aaaatggtga aggaaactca gaaacttaa
outer primer foward contain ompA sticky tag
GCACTCGTCCGGACAAC(56deg, 65%, 17bp) ATGGCTTTTCCGCCG 53deg, 60%, 8+15bp
outer primer reverse
ctgcagcggccgctactagta TTAAGTTTCTGAGTTTCCTTCACC 55deg, 38%, 21+24bp
inner primer1:55deg, 53%, 19bp
CCATTCCACTaCAGGCTGA TCAGCCTGtAGTGGAATGG
inner primer2:55deg, 41%, 22bp
CTGTTTTAGCaGCAGTTGAGAT ATCTCAACTGCtGCTAAAACAG
1 atggcgctcc tgctgtgctt cgtgctcctg tgcggagtag tggatttcgc cagaagtttg
61 agtatcacta ctcctgaaga gatgattgaa aaagccaaag gggaaactgc ctatctgccg
121 tgcaaattta cgcttagtcc cgaagaccag ggaccgctgg acatcgagtg gctgatatca
181 ccagctgata atcagaaggt ggatcaagtg attattttat attctggaga caaaatttat
241 gatgactact atccagatct gaaaggccga gtacatttta cgagtaatga tctcaaatct
301 ggtgatgcat caataaatgt aacgaattta caactgtcag atattggcac atatcagtgc
361 aaagtgaaaa aagctcctgg tgttgcaaat aagaagattc atctggtagt tcttgttaag
421 ccttcaggtg cgagatgtta cgttgatgga tctgaagaaa ttggaagtga ctttaagata
481 aaatgtgaac caaaagaagg ttcacttcca ttacagtatg agtggcaaaa attgtctgac
541 tcacagaaaa tgcccacttc atggttagca gaaatgactt catctgttat atctgtaaaa
601 aatgcctctt ctgagtactc tgggacatac agctgtacag tcagaaacag agtgggctct
661 gatcagtgcc tgttgcgtct aaacgttgtc cctccttcaa ataaagctgg actaattgca
721 ggagccatta taggaacttt gcttgctcta gcgctcattg gtcttatcat cttttgctgt
781 cgtaaaaagc gcagagaaga aaaatatgaa aaggaagttc atcacgatat cagggaagat
841 gtgccacctc caaagagccg tacgtccact gccagaagct acatcggcag taatcattca
901 tccctggggt ccatgtctcc ttccaacatg gaaggatatt ccaagactca gtataaccaa
961 gtaccaagtg aagactttga acgcactcct cagagtccga ctctcccacc tgctaaggta
1021 gctgccccta atctaagtcg aatgggtgcg attcctgtga tgattccagc acagagcaag
1081 gatgggtcta tagtatag
outer primer forward contain ompA sticky tag
GCACTCGTCCGGACAAC(56deg, 65%, 17bp)ATGGCGCTCCTGCTGTGC 62deg, 67%, 18bp
outer primer reverse
ctgcagcggccgctactagta CTATACTATAGACCCATCCTTGCTC 55deg, 44%, 25bp
Circuit design
| pRE K116603  |
RBS B0034  |
transmembrane region  |
CAR or alpha-v integrin |
B0010  |
B0012 |
References
1. Shiokawa S, Yoshimura Y, Sawa H, Nagamatsu S, Hanashi H, Sakai K, Ando M, Nakamura Y: Functional role of arg-gly-asp (RGD)-binding sites on beta1 integrin in embryo implantation using mouse blastocysts and human decidua. Biol Reprod 1999, 60(6):1468-1474.
2. Shan-dian G, Jun-zheng D, Jian-hua Z, Hui-yun C, Qing-ge X: Integrin activation and viral infection. Virologica Sinica 2008, 23(1): 1-7.
3. Nemerow GR, Stewart PL: Role of alpha(v) integrins in adenovirus cell entry and gene delivery. Microbiol Mol Biol Rev 1999, 63(3):725-734.
