Team:TUDelft/Brainstorm/Plasmid
Self Destructing Plasmid Brainstorm Area
Contents |
Implementation
Main Components
- Package
- Selection Marker (Antibiotic resistance)
- Chloramphenicol
- Kanamycin
- Tetracyclin
- Selection Marker Promoter (constitutive)
- Payload, gene to express in signal (GFP for testing)
- Payload Promoter
- Selection Marker (Antibiotic resistance)
- Restriction Enzyme
- Restriction Enzyme Recognition Sequence (multiple sites?)
- I-SceI (18 bp recognition seq) (TAGGGATAACAGGGTAAT) (4 bp overhang) [10]
- PI-SceI (37 bp recognition seq) (ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG) (4 bp overhang) [11]
- I-PpoI (15 bp recognition seq) (CTCTC TTAAGGTAGC) (4 bp overhang) [12]
- I-TevI (21 bp recognition seq) (GAAAACCTGTATTTTCAGGGC) (Glu-Asn-Leu-Tyr-Phe-Gln-Gly) (2 bp overhang) [13] [14]
- Restriction Enzyme Promoter
Timeline
Promoter Selection
Applications
Recycling Selectable Marker Genes
Metabolic Control Analysis
Cell-Cell Signaling
Synchronization
- Use F plasmid
- address problems with AHL signaling
- 24 hr half-life at 7.5pH means media becomes saturated (http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1797063 and http://parts2.mit.edu/projects/iap2003/Prakash/index.htm#Challenges)
- "important that a degradation mechanism that is faster than the desired period of oscillations be introduced into the system"
- solutions previously attempted
- aiiA degradation enzyme not secreted
- in the paper: S. Basu, R. Mehreja, S. Thiberge, M. T. Chen, and R. Weiss, Spatiotemporal control of gene expression with pulse-generating networks, Proc. Natl. Acad. Sci. USA, 101 (2004), pp. 6355–6360. http://www.pnas.org/content/101/17/6355.full
- two relevant experiments from Pulse Regeneration section
- first pulse 4hr AHL induction, then cells washed three times with new media, grown 6 hr in fresh media, then second pulse reaches same intensity levels as first
- first pulse 6hr AHL induction, then cells washed and resuspended in new media, second pulse can reach same intensity levels as first, after waiting 140 min before addition of second AHL
- two relevant experiments from Pulse Regeneration section
- washing cells not always practical
- Implementation
- F plasmid modified to have a gene of interest for signal generation and a self destructive endonuclease instead of AHL for cell signaling, F plasmid transmitted by conjugation [15]
- Tradeoff (F plasmid vs. AHL): F plasmid has better rate of degradation (tunable) but worse rate of propagation.
- From the paper: A comparison of the kinetics of plasmid transfer in the conjugation systems encoded by the F plasmid from Escherichia coli and plasmid pCF10 from Enterococcus faecalis. Andrup L, Andersen K. Microbiology. 1999 Aug;145 ( Pt 8):2001-9. http://www.ncbi.nlm.nih.gov/pubmed/10463166
- "the plasmid's maximal conjugation rate was estimated to be approximately 0.15 transconjugants per donor per minute."
- "the donors underwent a 'recovery period' between rounds of conjugative transfer and newly formed transconjugants required a period of about 40-80 min to mature into proficient donors."
- F plasmid is very large [16]
- oriT sequence in F plasmid initiates rolling circle amplification and transfer of the plasmid to the recipient cell
- can knockout oriT from F plasmid (See Berkeley 2006 project http://2006.igem.org/Berkeley2006-ConjugationMain) and put on smaller plasmid
- how to differentiate between donors and recipients, link expression of modified F plasmid to presence of smaller plasmid?
I. Synchronization:
- Add F plasmid using electroporation
- Allow conjugation to increase F+ population
- Induce synchronization and self destruction -> all cells now back to F-
- Next pulse, add F+ cells and repeat
- modeling paper, Section 4 in particular: Synchrony in a Population of Hysteresis-Based Genetic Oscillators, Alexey Kuznetsov, Mads Kærn, and Nancy Kopell, SIAM J. Appl. Math. Volume 65, Issue 2, pp. 392-425 (2004), http://scitation.aip.org/getabs/servlet/GetabsServlet?prog=normal&id=SMJMAP000065000002000392000001&idtype=cvips&gifs=yes
Complex Spatiotemporal Pattern Generation
- Instead of signaling molecules use the self destructing F plasmid. Related projects/papers see http://2008.igem.org/Team:EPF-Lausanne/Project
- A synthetic multicellular system for programmed pattern formation, Subhayu Basu, Yoram Gerchman, Cynthia H. Collins, Frances H. Arnold & Ron Weiss, http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html
- Artificial cell-cell communication in yeast Saccharomyces cerevisiae using signaling elements from Arabidopsis thaliana, http://www.nature.com/nbt/journal/v23/n12/full/nbt1162.html
"







