Team:TUDelft/Conjugation Procedure
Experimental Procedures
This page contains the step-by-step plan followed by the conjugation team and each steps current status.
Section 1: Helper Plasmid
Section 1: The Plan
Part 1A:
Part 1B: oriTR knockout
- Design and order primers needed for λ-red knockout ✔
- Acquire knockout plasmids ✔
- Knockout oriTR **In Progress**
- Verify that conjugation stopped **In Progress**
- Characterize conjugation efficiency of Conjugation Testing Plasmid 1 with R751 ΔoriTR as helper
- Send R751 ΔoriTR plasmid to registry
Part 1C: trbK knockout
- Knockout trbK **In Progress**
- Verify that conjugation takes place among R751 ΔtrbK cells
- Characterize conjugation efficiency
- Send R751 ΔoriT + ΔtrbK plasmid to registry
Part 1D: trbC knockout
- Knockout trbC
- Verify that no conjugation takes place in presence of Conjugation Testing Plasmid 1
- Send R751 ΔoriT + ΔtrbK + ΔtrbC plasmid to registry
Knockouts
The λ-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work (lambda red, NanoBio, knockout protocol used by Berkeley '06). Primers were designed following the standard procedure. The following primers were used (red parts are P1 and P2):
trbK_KO_FWD (70 bp)
CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTCGTGTAGGCTGGAGCTGCTTC
trbK_KO_REV (70 bp)
GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACCATGGGAATTAGCCATGGTCC
oriTR_KO_FWD (70 bp)
TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTCGTGTAGGCTGGAGCTGCTTC
oriTR_KO_REV (70 bp)
TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCGATGGGAATTAGCCATGGTCC
The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region):
trbK_KO_FWD (20 bp)
CACAACTGCGCCAGGGCAGC
trbK_KO_REV (20 bp)
CAGACGAACAGCGGCAGGGC
oriTR_KO_FWD (20 bp)
CTGGCCCACGTCGCGCAGAT
oriTR_KO_REV (20 bp)
TTGTGGCGGGTTTCGCTATA
Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See Results page for more info.
Section 2: Message Plasmid
Part 2A: BioBrick Assembly
- Order DNA synthesis for
- BBa_K175001 (trbK) ✔
- BBa_K175000 (trbC)
- Verify that trbK expression blocks conjugation ✔
- Place trbK on standard backbone ✔, sequence ✔, and send to registry ✔
- Amplify and Transform BioBricks needed
- BBa_I13522 (pTet-RBS-GFP-term-term) ✔
- BBa_I714031 (oriTR) ✔
- BBa_J13002 (pTet-RBS) ✔
- BBa_E0840 (RBS-GFP-term-term) ✔
- Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] ✔
- Verify Conjugation Testing Plasmid 1 works. ✔
- Sequence Conjugation Testing Plasmid 1. **In Progress**
- Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] ✔
- Verify Conjugation Testing Plasmid 2 works. **In Progress**
- Sequence Conjugation Testing Plasmid 2. **In Progress**
Part 2B: Full Communication testing
- Electroporate Conjugation Testing Plasmid 2 into some R751 ΔoriT cells creating InitiatorCells (select for presence of both message and helper plasmid)
- Add InitiatorCells to a culture of R751 ΔoriT + ΔtrbK and observe signal propagation, characterize rate of signal propagation. Look for lethal zygosis issues.
- If signal propagation observed, do victory dance.
For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the cloning strategy page
On to the Experimental Results >>>
"







