Team:NYMU-Taipei/Project/Lab Note

From 2009.igem.org

(Difference between revisions)

Revision as of 19:59, 21 October 2009

Home

Experiments and Parts

F.A.Q

About Us

Motivation

Our engineered E. coli (ViroCatcher) is designed to trap the viruses and successfully prevents viruses spreading out in our bodies. If we remove ViroCatcher, viruses will be cleaned up together as well with our ViroCatcher. To remove viruses, we must work out a method for E. coli removal.

For removing ViroCatcher, we have two choices. One is to let it suicide, and the other is to let it be removed by our immune cells (like how dead cells are removed). Before removal, we must be sure that the intended work is done, and viruses must be removed at the same time. Therefore, we designed a removal gene and included it in ViroCatcher. If ViroCatcher gets the sinal of binding with viral proteins, it will turn on the removal gene and be removed.

Furthermore, if ViroCatcher did not catch anything, we still have to design a mechanism to let our ViroCatcher express the removal gene and remove itself. Otherwise, bacteria will fill our blood vessel and block our blood flow.

Selecting the Removal Gene

We had considered the following three removal genes. In the end, we chose to use the expression of LPS.

Cell Suicide Generator

The CcdB protein, constitutively expressed by P1010, is lethal to most of the BioBrick cell strains, only DB3.1 is resistant[5]. A hybrid promoter controls the production of LuxR and ccdB. The promoter is activated by HSL-LuxR complex and repressed by P22 c2. The LuxR coding region is preceded by a strong RBS and followed by a bad terminator (60% efficiency). This means there is read through into the ccdB coding region which can be translated from a very weak RBS. If the P22 c2 repressor is absent, there should be a strong enough LuxR background to allow autoactivation if HSL is added. The amound of ccdB should be sublethal as long as there is no significant activation[6].

The most simple way to get rid of the E. coli is to let it suicide, however, there are many viruses that have been caught on the surface that we have to pay attention to. If ViroCatcher dies or explodes, the trapped viruses will spread into our bloodstream again. Cell Suicide Generator seems not to be a good choice.

Cell suicide generator

R0034

ccdB
K145151

B0010

B0012

Macrophage Inflammatory Proteins

Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines. In humans, there are two major forms, MIP-1α and MIP-1β that are now officially named CCL3 and CCL4 respectively. Both are major factors produced by macrophages after they are stimulated with bacterial endotoxins[1]. They activate human granulocytes (neutrophils, eosinophils and basophils) which can lead to acute neutrophilic inflammation. They also induce the synthesis and release other pro-inflammatory cytokines such as interleukin 1 (IL-1), IL-6 and TNF-α from fibroblasts and macrophages. The genes for CCL3 and CCL4 are both located on human chromosome 17[2].
- Chemokine (C-C motif) ligand 3, also known as CCL3, is a human gene. Macrophage inflammatory protein-1 is a so-called monokine that is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes (Wolpe et al., 1988). Sherry et al. (1988) demonstrated 2 protein components of MIP1, called by them alpha and beta[supplied by OMIM][1].
- CCL4 is a CC chemokine with specificity for CCR5 receptors. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cell [2]. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells [3]. Perforin-low memory CD8+ T cells that normally synthesize MIP-1-beta [4].
- The main function of chemokines is the induction of cell migration. Cells will move toward the direction of increment of continuous chemokine concentration gradient. In other words, cells migrate toward the source of chemokine. For example, the induction of lymphocyte to the lymphatic node is due to chemokines. Apply this thinking to our design, we want to use CCL3 and CCL4, or chemokines for macrophages, to assemble macrophages around ViroCatcher. It will raise the possibility that macrophages recognize the proteins of viruses and swallow the E. coli whole.
  But there's a problem. CCL3 and CCL4 is two kinds of ligands of receptors of antibody. If we use this design, ViroCatchers will bind with each other, aggregate together, and block our blood vessels. So unfortunately, this design still cannot be used as the removal circuit.

Expression of LPS

In the Chassis part of our project, we have mentioned that ViroCatcher is a LPS[7] knock-out stain, in order to avoid the detection by the immune system. Therefore, if we re-express LPS, our ViroCatcher will have the ability to attract immune cells and let immune system macrophage remove ViroCatcher itself along with the viruses bound to the surface[8][9]. To express LPS again in ViroCatcher, we just have to turn on msbB gene.

Homo sapiens chemokine (C-C motif) ligand 3, mRNA (cDNA clone MGC:198546 IMAGE:9054485), complete cds[http://www.ncbi.nlm.nih.gov/nuccore/219521699]

       1 acactcgagc ccacattccg tcacctgctc agaatcatgc aggtctccac tgctgccctt
      61 gctgtcctcc tctgcaccat ggctctctgc aaccagttct ctgcatcact tgctgctgac
     121 acgccgaccg cctgctgctt cagctacacc tcccggcaga ttccacagaa tttcatagct
     181 gactactttg agacgagcag ccagtgctcc aagcctggtg tcatcttcct aaccaagcga
     241 agccggcagg tctgtgctga ccccagtgag gagtgggtcc agaaatatgt cagcgacctg
     301 gagctgagtg cctgaggggt ccagaagctt cgaggcccag cgacctcggt gggcccagtg
     361 gggaggagca ggagcctgag ccttgggaac atgcgtgtga cctccacagc tacctcttct
     421 atggactggt tgttgccaaa cagccacact gtgggactct tcttaactta aattttaatt
     481 tatttatact atttagtttt tgtaatttat tttcgatttc acagtgtgtt tgtgattgtt
     541 tgctctgaga gttccccctg tcccctc

Homo sapiens chemokine (C-C motif) ligand 4, mRNA (cDNA clone MGC:126026 IMAGE:40032172), complete cds [http://www.ncbi.nlm.nih.gov/nuccore/74355495]

       1 cacagctggg ttctgaagct tctgagttct gcagcctcac ctctgagaaa acctcttttc
      61 caccaatacc atgaagctct gcgtgactgt cctgtctctc ctcatgctag tagctgcctt
     121 ctgctctcca gcgctctcag caccaatggg ctcagaccct cccaccgcct gctgcttttc
     181 ttacaccgcg aggaagcttc ctcgcaactt tgtggtagat tactatgaga ccagcagcct
     241 ctgctcccag ccagctgtgg tattccaaac caaaagaagc aagcaagtct gtgctgatcc
     301 cagtgagacc tgggtccagg agtacgtgta tgacctggaa ctgaactgag ctgctcagag
     361 acaggaagtc ttcagggaag gtcacctgag cccggatgct tctccatgag acacatctcc
     421 tccatactca ggactcctct ccgcagttcc tgtcccttct cttaatttaa tcttttttat
     481 gtgccgtgtt attgtattag

Escherichia coli K-12 substr. MG1655 msbB gene sequence[http://biocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10614]

       1 atgGAAACGA AAAAAAATAA TAGCGAATAC ATTCCTGAGT TTGATAAATC CTTTCGCCAC
      61 CCGCGCTACT GGGGAGCATG GCTGGGCGTA GCAGCGATGG CGGGTATCGC TTTAACGCCG
     121 CCAAAGTTCC GTGATCCCAT TCTGGCACGG CTGGGACGTT TTGCCGGACG ACTGGGAAAA
     181 AGCTCACGCC GTCGTGCGTT AATCAATCTG TCGCTCTGCT TTCCAGAACG TAGTGAAGCT
     241 GAACGCGAAG CGATTGTTGA TGAGATGTTT GCCACCGCGC CGCAAGCGAT GGCAATGATG
     301 GCTGAGTTGG CAATACGCGG GCCGGAGAAA ATTCAGCCGC GCGTTGACTG GCAAGGGCTG
     361 GAGATCATCG AAGAGATGCG GCGTAATAAC GAGAAAGTTA TCTTTCTGGT GCCGCACGGT
     421 TGGGCCGTCG ATATTCCTGC CATGCTGATG GCCTCGCAAG GGCAGAAAAT GGCAGCGATG
     481 TTCCATAATC AGGGCAACCC GGTTTTTGAT TATGTCTGGA ACACGGTGCG TCGTCGCTTT
     541 GGCGGTCGTC TGCATGCGAG AAATGACGGT ATTAAACCAT TCATCCAGTC GGTACGTCAG
     601 GGGTACTGGG GATATTATTT ACCCGATCAG GATCATGGCC CAGAGCACAG CGAATTTGTG
     661 GATTTCTTTG CCACCTATAA AGCGACGTTG CCCGCGATTG GTCGTTTGAT GAAAGTGTGC
     721 CGTGCGCGCG TTGTACCGCT GTTTCCGATT TATGATGGCA AGACGCATCG TCTGACGATT
     781 CAGGTGCGCC CACCGATGGA TGATCTGTTA GAGGCGGATG ATCATACGAT TGCGCGGCGG
     841 ATGAATGAAG AAGTCGAGAT TTTTGTTGGT CCGCGACCAG AACAATACAC CTGGATACTA
     901 AAATTGCTGA AAACTCGCAA ACCGGGCGAA ATCCAGCCGT ATAAGCGCAA AGATCTTTAT
     961 CCCATCAAAT AA

*Primer Design
gaattcgcggccgcttctag atgGAAACGAAAAAAAATAATAGCGAA 55deg GC:26% length:27bp
ctgcagcggccgctactagta TTATTTGATGGGATAAAGATCTTTGC 54deg GC:31% length:26bp

Goals

There are two specific aims for the removal part. One is ViroCatcher binding to viruses and being removed, and the other is self-removal after a specified period of time. Since the gene msbB of LPS is knocked out, if there is an insertion of msbB gene into the plasmid, then msbB gene and the LPS functions will express. Once the LPS is expressed, the immune system is turned on and ViroCatcher is swallowed by macrophage through phagocytosis along with many viruses attached.

If the machine catches nothing, it is still necessary to remove the E. coli machine after a period of time. This period of time should be controlled precisely, otherwise the machine will be removed before it catches any viruses. We compose an oscillator and a toggle switch together as our timer.

Removal Design

Removal for Binding Viruses

Mentioned before at Signal, an output promoter called ompC promoter will be inactivate through the way of the signal transduction of binding with viruses. Obviously, if we use a promoter inhibited by the ompC promoter output protein , when ompC inactivated, the gene we want to express will tun on. Therefore, we come out this design:

(this picture must be changed)

Use the tetR promoter as a switch for the msbB gene. If the receptor catches a virus, TetR protein absent, tetR promoter will turn on msbB gene, then LPS will be expressed and it will attract the immune system. ViroCatcher will be cleaned up by immune cells together with the trapped viruses.

Timed Removal

If the receptor does not catch anything, the ompC promoter will not be turned on, and the removal gene will not be expressed, so ViroCatcher cannot be removed when it catches nothing. How to make sure our Viro Catcher is removed from the human body? We worked out this set of design:

This circuit is composed of three parts - oscillator, toggle switch, and remover. Oscillator and toggle switch work together as the timer. The oscillator is consist of two genes. One gene activate the other gene and get a negative feedback. When output proteins of oscillator reach a threshold that preset, then the promoter of toggle switch will be activate, and output protein of toggle switch will suddenly activate the promoter of remover.

The following picture shows how the timer works by modeling:

We stop the timer by setting a threshold. As the protein produced by the oscillator promoter accumulates and reaches a certain threshold, the output promoter activity would suddenly change. This output promoter is connected to removal gene msbB. Therefore, at the time that timer stops, LPS expressed and attract macrophages.

This setting can control the micromachine to trigger an immune response after a period of time. This period of time is controlled precisely, otherwise ViroCatcher will be removed too fast or too late. Anyway, no matter what kind of situation, our ViroCatcher will be removed.

Experiment Results

Protocol of Promoter Strength Testing

extract the Biobrick promoter
combine it with GFP generator [http://partsregistry.org/Part:BBa_I13504 BBa_I13504] with the promoter and then transform
colony PCR
liquid incubation and plasmid extraction
measure the amount of fluroresence by using an ELISA reader with a 96 well plate
data collection
using pTet as the standard having the value of 1
characterize the basal level expression without any inducer or repressor interaction

Oscillator Modeling

Modeling

Promoter Strength Testing

Reporting Assay of Promoter Strength Testing

Colony PCR Gel Pictures

Figure 1. 1.pTet with generator ([http://partsregistry.org/Part:BBa_K195610 BBa_K195610]) 2.pLac with generator ([http://partsregistry.org/Part:BBa_K195612 BBa_K195612]) 3.pRE with generator ([http://partsregistry.org/Part:BBa_K195609 BBa_K195609])

Figure 2. L1~L2 pTet with generator ([http://partsregistry.org/Part:BBa_K195610 BBa_K195610]) L3~L4 pPenI with generator ([http://partsregistry.org/Part:BBa_K195611 BBa_K195611]) L5~L6 pLac with generator ([http://partsregistry.org/Part:BBa_K195612 BBa_K195612])

Figure 3. L1~L4 pLuxR with generator ([http://partsregistry.org/Part:BBa_K195615 BBa_K195615]) L5 pCI with generator ([http://partsregistry.org/Part:BBa_K195613 BBa_K195613]) L6~L8 pLasR with generator ([http://partsregistry.org/Part:BBa_K195616 BBa_K195616])

Figure 4. L1~L4 p22 with generator ([http://partsregistry.org/Part:BBa_K195614 BBa_K195614]) L5~L8 pLuxR with generator ([http://partsregistry.org/Part:BBa_K195615 BBa_K195615])

Figure 5. L1~L6 pRE with PenI repressor gene ([http://partsregistry.org/Part:BBa_K195621 BBa_K195621])

Graph of Experiments

Figure 1. This is the relative promoter strength to pTet, which was tested by measuring the flurorescence with an ELISA Reader. pLux and pLas are inducible promoters, so their measured promoter strength is their basal level strength.

NYMU Chart (Lr2tEr7t) without line-1.png

Figure 2. This is the component testing with the activator CII at the downstream of pLac inducing pRE to express GFP.

Figure 3. This is the measurement by using an ELISA reader, graphing Fluorescence versus O.D of the Time Delay device(I) ([http://partsregistry.org/Part:BBa_K195622 BBa_K195622])

msbB gene PCR Results

Figure 1. This gel picture shows the result of PCR by L1~L5 is the length of msbB gene. L6 is negative control.

References

[1] File:NYMU Cutaneous Injection of Human Subjects with Macrophage Inflammatory Protein-1 Induces Significant Recruitment of Neutrophils and Monocytes1.pdf

[2] File:Activation of Human Peripheral Blood Mononuclear Cells by Nonpathogenic Bacteria In Vitro - Evidence of NK Cells as Primary Targets.pdf

[3] File:Macrophage activation switching - an asset for the resolution of inflammation.pdf

[4] [http://www.springerlink.com/content/g262813537x0t254/ The effect of various inflammatory agents on the phagocytosis and cytokine profile of mouse and rat macrophages]

[5] [http://partsregistry.org/wiki/index.php/Part:BBa_P1010/ Part:BBa_P1010]

[6] [http://partsregistry.org/wiki/index.php/Part:BBa_K145230/ Part:BBa_K145230]

[7] [http://en.wikipedia.org/wiki/Lipopolysaccharide#Lipid_A/ LPS]

[8] File:NYMU LPS濃度對於細胞CD14的表現的影響.pdf

[9] File:Ginger extract inhibits LPS induced macrophage activation and function.pdf

@@ Line 1: / Line 1: @@
-== Experiment of oscillator biobrick parts (1)==
+[[File:NYMU Wt--rev.png]]
+{{:Team:NYMU-Taipei/Header}}
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 24 oscillator part.png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+== Motivation ==
-% agarose, 90V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: BBa_R0051 pCI|287bp (49+238)|238bp|m|=
-|2: BBa_C0051 CI lam|988bp (750+238)|238bp|w|=
-|3: BBa_C0040 TetR|838bp (660+238)|238bp|w|=
-|4: BBa_B0034 RBS|250bp (12+238)|238bp|w|=
-|5: BBa_j13002 pTetR|302bp (74+238)|238bp|f|=
-|6: BBa_B0015 Term|445bp (129+316)|316bp|w|=
-|7: BBa_K116602 CII|532bp (294+238)|238bp|w|=
-|8: BBa_K116603 pRE|286bp (48+238)|238bp|w|=
-|9: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
-|10: Negative Control|0bp||w|=
-|11: marker 100bp|||n}} }}
-== Experiment of oscillator biobrick parts (2)==
+Our engineered ''E. coli'' (ViroCatcher) is designed to trap the viruses and successfully prevents viruses spreading out in our bodies. If we remove ViroCatcher, viruses will be cleaned up together as well with our ViroCatcher. To remove viruses, we must work out a method for E. coli removal.
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 27 oscillator part(2).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+For removing ViroCatcher, we have two choices. One is to let it suicide, and the other is to let it be removed by our immune cells (like how dead cells are removed). Before removal, we must be sure that the intended work is done, and viruses must be removed at the same time. Therefore, we designed a removal gene and included it in ViroCatcher. If ViroCatcher gets the sinal of binding with viral proteins, it will turn on the removal gene and be removed.
-% agarose, 90V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: BBa_R0040 pTetR|292bp (54+238)|238bp|w|=
-|2: BBa_E0840|1116bp (878+238)|238bp|w|=
-|3: CII<Term(from jesse)|669bp (294+8+129+238)|532bp (294+238)|f|=
-|4: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
-|5: Negative Control||Contamination ~300bp|f|=
-|6: -|-|-|n|=
-|7-8: BBa_B0015 Term (gel extraction)|155bp (129+26)||w|=
-|9: marker 100bp|||n}} }}
-== Experiment of oscillator biobrick parts (3)==
+Furthermore, if ViroCatcher did not catch anything, we still have to design a mechanism to let our ViroCatcher express the removal gene and remove itself. Otherwise, bacteria will fill our blood vessel and block our blood flow.
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 29 oscillator part(3).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 90V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: CII<Term|669bp (294+8+129+238)|532bp (294+238)|w|=
-|2: CI lam<Term|1125bp (750+8+129+238)|988bp (750+238)|w|=
-|3: TetR<Term|1035bp (660+8+129+238)|898bp (660+238)|f|=
-|4: BBa_R0051 pCI|287bp (49+238)|238bp|m|=
-|5: BBa_j13002 pTetR+RBS|312bp (74+238)|238bp|w|=
-|6: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
-|7: Negative Control|0bp|Contamination ~300&700bp,|f|=
-|8: -|-|-|n|=
-|9-10: BBa_E0840 (Gel extraction)|878bp||w|=
-|11: marker 100bp|||n}} }}
-: Inconclusive.
-== Experiment of oscillator biobrick parts (4)==
+== Selecting the Removal Gene ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 31 oscillator part(4).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+We had considered the following three removal genes. In the end, we chose to use the expression of LPS.
-% agarose, 90V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: BBa_R0074 pPenI|315bp (77+238)|238bp|w|=
-|2-6: BBa_C0074 PenI|739bp (423+316)|316bp|w|=
-|7-11: BBa_R0073 pMnt|383bp (67+316)|316bp|m|=
-|12-16: BBa_C0072 Mnt (Strong)|604bp (288+316)|316bp|w|=
-|17-21: BBa_C0073 Mnt (Weak)|604bp (288+316)|316bp|w|=
-|22: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
-|23: Negative Control|0bp|Contamination|f|=
-|24: marker 100bp|||n}}
-The result for lanes 7-11 look weird, but it could be because of the gel. A rerun will be done.}}
-== Experiment of oscillator biobrick parts (5)==
+=== Cell Suicide Generator ===
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 31 oscillator part(5).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+<br>[[File:NYMU 1.jpg]]
-% agarose, 90V, 30min
+*The CcdB protein, constitutively expressed by P1010, is lethal to most of the BioBrick cell strains, only DB3.1 is resistant[5]. A hybrid promoter controls the production of LuxR and ccdB. The promoter is activated by HSL-LuxR complex and repressed by P22 c2. The LuxR coding region is preceded by a strong RBS and followed by a bad terminator (60% efficiency). This means there is read through into the ccdB coding region which can be translated from a very weak RBS. If the P22 c2 repressor is absent, there should be a strong enough LuxR background to allow autoactivation if HSL is added. The amound of ccdB should be sublethal as long as there is no significant activation[6].
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1-2: TetR<Term (Gel extraction)|821bp (660+8+129+24)|684bp (660+24)|f|=
-|4-5: CII<Term (Gel extraction)|455bp (294+8+129+24)|318bp (294+24)|w|=
-|7-9: CI<Term (Gel extraction)|911bp (750+8+129+24)|774bp (750+24)|w|=
-|10: marker 100bp|||n}} }}
-== Experiment of oscillator biobrick parts (6)==
+The most simple way to get rid of the ''E. coli'' is to let it suicide, however, there are many viruses that have been caught on the surface that we have to pay attention to. If ViroCatcher dies or explodes, the trapped viruses will spread into our bloodstream again. Cell Suicide Generator seems not to be a good choice.
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 03 oscillator part(6).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 90V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: BBa_R0074 pPenI|315bp (77+238)|238bp|w|=
-|2: BBa_C0074 PenI|739bp (423+316)|316bp|w|=
-|3: BBa_R0073 pMnt|383bp (67+316)|316bp|w|=
-|4: BBa_C0072 Mnt (Strong)|604bp (288+316)|316bp|w|=
-|5: BBa_C0073 Mnt (Weak)|604bp (288+316)|316bp|w|=
-|6: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
-|7: Negative Control|0bp|Contamination|f|=
-|8: marker 100bp|||n}} }}
-== Experiment of oscillator biobrick parts (7)==
+{{:Team:NYMU-Taipei/Part4|Cell suicide generator|=
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 03 oscillator part(7).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+|R|R0034||=
-% agarose, 90V, 30min
+|C|K145151|ccdB|=
-{{:Team:NYMU-Taipei/GELC|=
+|T|B0010||=
-|0: marker 1kb+100bp|||n|=
+|T|B0012||}}
-|1: RBS + CII + Term|687bp |250bp|f|=
-|2: RBS + CI lam + Term|1143bp |250bp|f|=
-|3: RBS + TetR + Term|1053bp |250bp|f|=
-|4: pCI(plate from 090729)|287bp |238bp|m|=
-|5: E0840|604bp (288+316)|316bp|w|=
-|6: pCI(plasmid from 090730)|287bp |238bp|f|=
-|7: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
-|8: Negative Control|0bp|Contamination~300bp|f|=
-|9: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (8)==
+=== Macrophage Inflammatory Proteins ===
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 04 oscillator part(8).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+<br>[[File:NYMU 2.jpg]]
-% agarose, 90V, 30min
+* Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines. In humans, there are two major forms, MIP-1α and MIP-1β that are now officially named CCL3 and CCL4 respectively. Both are major factors produced by macrophages after they are stimulated with bacterial endotoxins[1]. They activate human granulocytes (neutrophils, eosinophils and basophils) which can lead to acute neutrophilic inflammation. They also induce the synthesis and release other pro-inflammatory cytokines such as interleukin 1 (IL-1), IL-6 and TNF-α from fibroblasts and macrophages. The genes for CCL3 and CCL4 are both located on human chromosome 17[2].
-{{:Team:NYMU-Taipei/GELC|=
+** Chemokine (C-C motif) ligand 3, also known as CCL3, is a human gene. Macrophage inflammatory protein-1 is a so-called monokine that is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes (Wolpe et al., 1988). Sherry et al. (1988) demonstrated 2 protein components of MIP1, called by them alpha and beta[supplied by OMIM][1].
-|0: marker 1kb+100bp|||n|=
+** CCL4 is a CC chemokine with specificity for CCR5 receptors. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cell [2]. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells [3]. Perforin-low memory CD8+ T cells that normally synthesize MIP-1-beta [4].<br>[[File:Chemokine_concentration_chemotaxis.jpg]]<br>
-|1: BBa_I13504 r7t|1113bp |250bp|w|=
+** The main function of chemokines is the induction of cell migration. Cells will move toward the direction of increment of continuous chemokine concentration gradient. In other words, cells migrate toward the source of chemokine. For example, the induction of lymphocyte to the lymphatic node is due to chemokines. Apply this thinking to our design, we want to use CCL3 and CCL4, or chemokines for macrophages, to assemble macrophages around ViroCatcher. It will raise the possibility that macrophages recognize the proteins of viruses and swallow the ''E. coli'' whole.<br> But there's a problem. CCL3 and CCL4 is two kinds of ligands of receptors of antibody. If we use this design, ViroCatchers will bind with each other, aggregate together, and block our blood vessels. So unfortunately, this design still cannot be used as the removal circuit.
-|2: BBa_I13522 Ar7t|1176bp |292bp|w|=
-|3: BBa_I13401 7t|1095bp |958bp|w|=
-|4: BBa_R0051 pCI|287bp |238bp|m|=
-|5: pTetR<E0240|1176bp |292bp|w|=
-|6: PenI<Term|876bp |739bp|f|=
-|7: Mnt (Strong)<Term|741bp |604bp|m|=
-|8: Mnt (Weak)<Term|741bp |604bp|f|=
-|9: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
-|10: Negative Control|0bp|Contamination~300bp|f|=
-|11: marker 100bp|||n}} }}
-== Experiment of oscillator biobrick parts (9) Gel Extraction ==
+=== Expression of LPS ===
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 04 oscillator part(9).png||c=
+<br>[[File:NYMU 3.jpg]]
-% agarose, 90V, 30min
+* In the [[Team:NYMU-Taipei/Chassis|Chassis]] part of our project, we have mentioned that ViroCatcher is a LPS[7] knock-out stain, in order to avoid the detection by the immune system. Therefore, if we re-express LPS, our ViroCatcher will have the ability to attract immune cells and let immune system macrophage remove ViroCatcher itself along with the viruses bound to the surface[8][9]. To express LPS again in ViroCatcher, we just have to turn on ''msbB'' gene.
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: B0034+CII+Term r2t|475bp |38bp|f|=
-|2: B0034+CII+Term r2t|475bp |38bp|f|=
-|3: B0034+CII+Term r2t|475bp |38bp|f|=
-|4: B0034+CI lam+Term r1t|931bp |38bp|f|=
-|5: B0034+CI lam+Term r1t|931bp |38bp|f|=
-|6: B0034+CI lam+Term r1t|931bp |38bp|f|=
-|7: B0034+Tet R+Term r3t|841bp |38bp|f|=
-|8: B0034+Tet R+Term r3t|841bp |38bp|f|=
-|9: B0034+Tet R+Term r3t|841bp |38bp|f|=
-|10: marker 100bp|||n}} }}
-== Experiment of oscillator biobrick parts (10) (Gel Extraction)==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 05 oscillator part(10).png||c=
-% agarose, 90V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: BBa_I13504 r7t|901bp |0bp|w|=
-|2: BBa_I13401 7t|881bp |0bp|w|=
-|3: PenI+Term|584bp|447bp|f|=
-|4: Mnt (Strong)+Term 5t|449bp |312bp|f|=
-|5: Mnt (Weak)+Term 6t|449bp |312bp|f|=
-|6: TetR+Term 3t|821bp |684bp|f|=
-|7: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (11)==
+==== Homo sapiens chemokine (C-C motif) ligand 3, mRNA (cDNA clone MGC:198546 IMAGE:9054485), complete cds[http://www.ncbi.nlm.nih.gov/nuccore/219521699] ====
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 06 oscillator part(11).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 90V, 30min
+acactcgagc ccacattccg tcacctgctc agaatcatgc aggtctccac tgctgccctt
-{{:Team:NYMU-Taipei/GELC|=
+gctgtcctcc tctgcaccat ggctctctgc aaccagttct ctgcatcact tgctgctgac
-|0: marker 1kb+100bp|||n|=
+acgccgaccg cctgctgctt cagctacacc tcccggcaga ttccacagaa tttcatagct
-|1: marker 1kb|||n|=
+gactactttg agacgagcag ccagtgctcc aagcctggtg tcatcttcct aaccaagcga
-|2: C|287bp |238bp|w|=
+agccggcagg tctgtgctga ccccagtgag gagtgggtcc agaaatatgt cagcgacctg
-|3: M|383bp |316bp|w|=
+gagctgagtg cctgaggggt ccagaagctt cgaggcccag cgacctcggt gggcccagtg
-|4: 3t|1035bp |898bp|f|=
+gggaggagca ggagcctgag ccttgggaac atgcgtgtga cctccacagc tacctcttct
-|5: 4t|876bp |739bp|f|=
+atggactggt tgttgccaaa cagccacact gtgggactct tcttaactta aattttaatt
-|6: 5t|741bp |604bp|m|=
+tatttatact atttagtttt tgtaatttat tttcgatttc acagtgtgtt tgtgattgtt
-|7: 6t|741bp |604bp|f|=
+tgctctgaga gttccccctg tcccctc
-|8: Positive Control E0240|1114bp |238bp|w|=
-|9: Negative Control |0bp |Contamination~300|f|=
-|10:  |bp |bp|n|=
-|11:  |bp |bp|n|=
-|12: r<1t|1143bp |250bp|f|=
-|13: r<2t|687bp |250bp|f|=
-|14: r<7t|1113bp |250bp|f|=
-|15: 3<t|1035bp |898bp|f|=
-|16: 5<t|741bp |604bp|f|=
-|17: Positive Control E0240|1114bp |238bp|w|=
-|18: Negative Control |0bp |Contamination~|f|=
-|19: marker 1kb|||n|=
-|20: marker 100bp|||n}} }}
-== Experiment of oscillator biobrick parts (12)==
+==== Homo sapiens chemokine (C-C motif) ligand 4, mRNA (cDNA clone MGC:126026 IMAGE:40032172), complete cds [http://www.ncbi.nlm.nih.gov/nuccore/74355495]====
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 11 oscillator part(12).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 90V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Lr7t|1321bp |438bp|f|=
-|2: Lr7t|1321bp |438bp|w|=
-|3: Positive Control E0240|1114bp |238bp|w|=
-|4: r1t|1143bp |250bp|w|=
-|5: r1t|1143bp |250bp|w|=
-|6: r1t|1143bp |250bp|w|=
-|7: r1t|1143bp |250bp|f|=
-|8: r1t|1143bp |250bp|w|=
-|9: r1t|1143bp |250bp|f|=
-|10: r1t|1143bp |250bp|w|=
-|11: r1t|1143bp |250bp|w|=
-|12: r2t|687bp |250bp|w|=
-|13: r2t|687bp |250bp|f|=
-|14: r2t|687bp |250bp|w|=
-|15: r2t|687bp |250bp|w|=
-|16: r2t|687bp |250bp|w|=
-|17: r2t|687bp |250bp|w|=
-|18: r2t|687bp |250bp|w|=
-|19: r2t|687bp |250bp|w|=
-|20: r2t|687bp |250bp|w|=
-|21: r2t|687bp |250bp|w|=
-|22: r2t|687bp |250bp|w|=
-|23: Negative Control |0bp ||w|=
-|24: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (13) 2009/08/13==
+cacagctggg ttctgaagct tctgagttct gcagcctcac ctctgagaaa acctcttttc
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 13 oscillator part(13).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+caccaatacc atgaagctct gcgtgactgt cctgtctctc ctcatgctag tagctgcctt
-% agarose, 90V, 38min
+ctgctctcca gcgctctcag caccaatggg ctcagaccct cccaccgcct gctgcttttc
-{{:Team:NYMU-Taipei/GELC|=
+ttacaccgcg aggaagcttc ctcgcaactt tgtggtagat tactatgaga ccagcagcct
-|0: marker 1kb+100bp|||n|=
+ctgctcccag ccagctgtgg tattccaaac caaaagaagc aagcaagtct gtgctgatcc
-|1: 3t|1035bp |898bp|m|=
+cagtgagacc tgggtccagg agtacgtgta tgacctggaa ctgaactgag ctgctcagag
-|2: 3t|1035bp |898bp|m|=
+acaggaagtc ttcagggaag gtcacctgag cccggatgct tctccatgag acacatctcc
-|3: 3t|1035bp |898bp|f|=
+tccatactca ggactcctct ccgcagttcc tgtcccttct cttaatttaa tcttttttat
-|4: 3t|1035bp |898bp|f|=
+gtgccgtgtt attgtattag
-|5: 3t|1035bp |898bp|m|=
-|6: 4t|876bp |739bp|w|=
-|7: 4t|876bp |739bp|w|=
-|8: 4t|876bp |739bp|f|=
-|9: 4t|876bp |739bp|f|=
-|10: 4t|876bp |739bp|w|=
-|11: 5t|741bp |604bp|f|=
-|12: 5t|741bp |604bp|f|=
-|13: 5t|741bp |604bp|f|=
-|14: 5t|741bp |604bp|f|=
-|15: 5t|741bp |604bp|f|=
-|16: 6t|741bp |604bp|m|=
-|17: 6t|741bp |604bp|m|=
-|18: 6t|741bp |604bp|m|=
-|19: 6t|741bp |604bp|m|=
-|20: 6t|741bp |604bp|m|=
-|21: 1t|1125bp |988bp|w|=
-|22: Positive Control E0240|1114bp |238bp|w|=
-|23: Negative Control |0bp ||w|=
-|24: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (14) (Gel Extraction) 2009/08/13==
+==== Escherichia coli K-12 substr. MG1655 msbB gene sequence[http://biocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10614] ====
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 13 oscillator part(14).png||c=
-% agarose, 90V, 36min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: r1t|929bp ||w|=
-|2: r1t|929bp ||w|=
-|3: marker 1kb+100bp|||n|=
-|4: r2t|473bp ||w|=
-|5: r2t|473bp ||w}} }}
-== Experiment of oscillator biobrick parts (15) 2009/08/15 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 15 oscillator part(15).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Ar7t|1176bp |292bp|w|=
-|2: Ar7t|1176bp |292bp|w|=
-|3: Ar7t|1176bp |292bp|w|=
-|4: Ar2t|749bp |292bp|f|=
-|5: Pr7t|1199bp |315bp|f|=
-|6: Lr7t|1322bp |438bp|w|=
-|7: Lr7t|1322bp |438bp|w|=
-|8: Lr7t|1322bp |438bp|w|=
-|9: Lr7t|1322bp |438bp|w|=
-|10: Cr7t|1171bp |287bp|f|=
-|11: Cr7t|1171bp |287bp|f|=
-|12: Cr7t|1171bp |287bp|f|=
-|13: Cr7t|1171bp |287bp|f|=
-|14: Er7t|1170bp |286bp|f|=
-|15: Er7t|1170bp |286bp|w|=
-|16: Er7t|1170bp |286bp|f|=
-|17: Er7t|1170bp |286bp|w|=
-|18: Er7t|1170bp |286bp|w|=
-|19: Positive Control E0240|1114bp |238bp|w|=
-|23: Negative Control |0bp ||w|=
-|24: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (16) (Gel Extraction) 2009/08/15==
+atgGAAACGA AAAAAAATAA TAGCGAATAC ATTCCTGAGT TTGATAAATC CTTTCGCCAC
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 15 oscillator part(16).png||c=
+CCGCGCTACT GGGGAGCATG GCTGGGCGTA GCAGCGATGG CGGGTATCGC TTTAACGCCG
-% agarose, 100V, 30min
+CCAAAGTTCC GTGATCCCAT TCTGGCACGG CTGGGACGTT TTGCCGGACG ACTGGGAAAA
-{{:Team:NYMU-Taipei/GELC|=
+AGCTCACGCC GTCGTGCGTT AATCAATCTG TCGCTCTGCT TTCCAGAACG TAGTGAAGCT
-|0: marker 1kb+100bp|||n|=
+GAACGCGAAG CGATTGTTGA TGAGATGTTT GCCACCGCGC CGCAAGCGAT GGCAATGATG
-|1: 3t|821bp |684bp |w|=
+GCTGAGTTGG CAATACGCGG GCCGGAGAAA ATTCAGCCGC GCGTTGACTG GCAAGGGCTG
-|2: 3t|821bp |684bp |w|=
+GAGATCATCG AAGAGATGCG GCGTAATAAC GAGAAAGTTA TCTTTCTGGT GCCGCACGGT
-|3: 3t|821bp |684bp |w|=
+TGGGCCGTCG ATATTCCTGC CATGCTGATG GCCTCGCAAG GGCAGAAAAT GGCAGCGATG
-|4: 4t|584bp |447bp |f|=
+TTCCATAATC AGGGCAACCC GGTTTTTGAT TATGTCTGGA ACACGGTGCG TCGTCGCTTT
-|5: 4t|584bp |447bp |f|=
+GGCGGTCGTC TGCATGCGAG AAATGACGGT ATTAAACCAT TCATCCAGTC GGTACGTCAG
-|6: 4t|584bp |447bp |f|=
+GGGTACTGGG GATATTATTT ACCCGATCAG GATCATGGCC CAGAGCACAG CGAATTTGTG
-|7: marker 1kb+100bp|||n}} }}
+GATTTCTTTG CCACCTATAA AGCGACGTTG CCCGCGATTG GTCGTTTGAT GAAAGTGTGC
+CGTGCGCGCG TTGTACCGCT GTTTCCGATT TATGATGGCA AGACGCATCG TCTGACGATT
+CAGGTGCGCC CACCGATGGA TGATCTGTTA GAGGCGGATG ATCATACGAT TGCGCGGCGG
+ATGAATGAAG AAGTCGAGAT TTTTGTTGGT CCGCGACCAG AACAATACAC CTGGATACTA
+AAATTGCTGA AAACTCGCAA ACCGGGCGAA ATCCAGCCGT ATAAGCGCAA AGATCTTTAT
+CCCATCAAAT AA
-== Experiment of oscillator biobrick parts (17) 2009/08/16 ==
+ *Primer Design
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 16 oscillator part(17).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+ gaattcgcggccgcttctag atgGAAACGAAAAAAAATAATAGCGAA 55deg GC:26% length:27bp
-% agarose, 100V, 30min
+ ctgcagcggccgctactagta TTATTTGATGGGATAAAGATCTTTGC 54deg GC:31% length:26bp
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: pH sensor|512bp ||f|=
-|2: pH sensor|512bp ||f|=
-|3: pH sensor|512bp ||f|=
-|4: pH sensor|512bp ||f|=
-|5: r3t|1053bp |250bp |f|=
-|6: r3t|1053bp |250bp |f|=
-|7: r3t|1053bp |250bp |f|=
-|8: r3t|1053bp |250bp |w|=
-|9: Positive Control E0240|1114bp |238bp|w|=
-|10: Negative Control |0bp ||w|=
-|11: marker 1kb+100bp|||n}} }}
+== Goals ==
-== Experiment of oscillator biobrick parts (18) (digestion) 2009/08/17==
+There are two specific aims for the removal part. One is ViroCatcher binding to viruses and being removed, and the other is self-removal after a specified period of time. Since the gene msbB of LPS is knocked out, if there is an insertion of msbB gene into the plasmid, then msbB gene and the LPS functions will express. Once the LPS is expressed, the immune system is turned on and ViroCatcher is swallowed by macrophage through phagocytosis along with many viruses attached.
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 17 oscillator part(18).png||c=
-% agarose, 100V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb|||n|=
-|1: marker 100bp|||n|=
-|2: Cr7t(XN)|311,2701bp|253bp,2701bp|f|=
-|3: Er7t(NP)|36,274,2701bp|253bp,2701bp|w|=
-|4: pH Sensor Plasmid #1 Amplify 1-2 (XP)|296,2057bp|1180,2057bp|f|=
-|5: pH Sensor Plasmid #1 Amplify 3-4 (XP)|296,2057bp|1180,2057bp|f|=
-|6: pH Sensor Plasmid #1 Amplify 1-2 (XN)|2353bp|536,2701bp|f|=
-|6: pH Sensor Plasmid #1 Amplify 3-4 (XN)|2353bp|536,2701bp|f|=
-|7: marker 1kb+100bp|||n}}
-Comments
-* Colony's of lanes 4-7 came from the same plate. Because this part was left over from last year, we didn't know if this plasmid contained K116001 or K116002. This gel's digestion results say K116002.
-}}
+If the machine catches nothing, it is still necessary to remove the ''E. coli'' machine after a period of time. This period of time should be controlled precisely, otherwise the machine will be removed before it catches any viruses. We compose an oscillator and a toggle switch together as our timer.
-== Experiment of oscillator biobrick parts (19) (Gel Extraction) 2009/08/17==
+== Removal Design ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 17 oscillator part(19).png||c=
-% agarose, 100V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 100bp|||n|=
-|1: marker 1kb|||n|=
-|2: Er7t|958bp |74bp |w|=
-|3: Er7t|958bp |74bp |w|=
-|4: Er7t|958bp |74bp |w|=
-|5: Cr7t|959bp |75bp |f|=
-|6: Cr7t|959bp |75bp |f|=
-|7: Cr7t|959bp |75bp |f|=
-|8: marker 1kb|||n|=
-|9: marker 100bp|||n}} }}
+=== Removal for Binding Viruses ===
-== Experiment of oscillator biobrick parts (20) 2009/08/18 ==
+Mentioned before at [[Team:NYMU-Taipei/Signal|Signal]], an output promoter called ompC promoter will be inactivate through the way of the signal transduction of binding with viruses. Obviously, if we use a promoter inhibited by the ompC promoter output protein , when ompC inactivated, the gene we want to express will tun on. Therefore, we come out this design:
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 18 oscillator part(20).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: AR7t|1175bp |292bp |w|=
-|2: AR7t|1175bp |292bp |w|=
-|3: PR7t|1198bp |315bp |m|=
-|4: PR7t|1198bp |315bp |f|=
-|5: CR7t|1170bp |287bp |f|=
-|6: CR7t|1170bp |287bp |f|=
-|7: pMnt|383bp |316bp |m|=
-|8: CI lam|988bp |238bp |m|=
-|9: Positive Control E0240|1114bp |238bp|w|=
-|10: Negative Control |0bp |contamination~700bp|f|=
-|11: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (21) (Gel Extraction) 2009/08/18==
+[[File:NYMU 5.jpg]](this picture must be changed)
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 18 oscillator part(21).png||c=
-% agarose, 100V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: r3t(XP)|841bp |38bp |w|=
-|2: r3t(XP)|841bp |38bp |w|=
-|3: r3t(XP)|841bp |38bp |w|=
-|4: term(XP)|155bp |445bp |w|=
-|5: term(XP)|155bp |445bp |w|=
-|6: term(XP)|155bp |445bp |w|=
-|7: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (22) 2009/08/19 ==
+Use the tetR promoter as a switch for the msbB gene. If the receptor catches a virus, TetR protein absent, tetR promoter will turn on msbB gene, then LPS will be expressed and it will attract the immune system. ViroCatcher will be cleaned up by immune cells together with the trapped viruses.
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 19 oscillator part(22).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|60s|300s|rp=VR|fp=VF2|polName=pfu|pol=0.5|ddH20=39.5}}|c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: nhaA|274bp |0bp |w|=
-|2: Positive Control Term|445bp |316bp|w|=
-|3: Negative Control |0bp ||w|=
-|4: marker 1kb+100bp|||n}}
-PCR of nhaA using this protocol worked.
-}}
+=== Timed Removal ===
-== Experiment of oscillator biobrick parts (23) 2009/08/19 ==
+If the receptor does not catch anything, the ompC promoter will not be turned on, and the removal gene will not be expressed, so ViroCatcher cannot be removed when it catches nothing. How to make sure our Viro Catcher is removed from the human body? We worked out this set of design:
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 19 oscillator part(23).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: 4<t|876bp |739bp |m|=
-|2: 4<t|876bp |739bp |m|=
-|3: 4<t|876bp |739bp |m|=
-|4: 4<t|876bp |739bp |m|=
-|5: 5<t|741bp |604bp |f|=
-|6: 5<t|741bp |604bp |f|=
-|7: 5<t|741bp |604bp |f|=
-|8: 5<t|741bp |604bp |f|=
-|9: 6<t|741bp |604bp |m|=
-|10: 6<t|741bp |604bp |m|=
-|11: 6<t|741bp |604bp |m|=
-|12: 6<t|741bp |604bp |m|=
-|13: M<R7t|1267bp |383bp |f|=
-|14: M<R7t|1267bp |383bp |f|=
-|15: M<r7t|1267bp |383bp |f|=
-|16: M<r7t|1267bp |383bp |f|=
-|17: M|383bp |316bp |w|=
-|18: P|315bp |238bp |w|=
-|19: 1|988bp |238bp |m|=
-|20: 5|604bp |316bp |m|=
-|21: 6|604bp |316bp |m|=
-|22: Positive Control E0240|1114bp |238bp|w|=
-|23: Negative Control |0bp |contamination~300,1100bp|f|=
-|24: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (24) 2009/08/20 ==
+[[File:NYMU 4.jpg]]
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 20 oscillator part(24).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 27min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: nhaA -->(l)|512bp |238bp |w|=
-|2: A<r2t|749bp |292bp |f|=
-|3: E<r3t|1109bp |286bp |f|=
-|4: E<r3t|1109bp |286bp |f|=
-|5: E<r3t|1109bp |286bp |f|=
-|6: 4t|876bp |739bp |f|=
-|7: 5t|741bp |604bp |f|=
-|8: 6t|741bp |604bp |f|=
-|9: Positive Control E0240|1114bp |238bp|w|=
-|10: Negative Control |0bp ||w|=
-|11: marker 1kb+100bp|||n}}
-Comments:
-* Next time, for the failed ligations, revert back to using old enzymes and redo. Maybe it's something to do with not being familiar enough with the new brands.
-* Ligating digested PCR product nhaA(XP) onto an empty pSB1A2 plasmid (obtained from extracting it from digesting E0240(XP)) worked.
-}}
+This circuit is composed of three parts - oscillator, toggle switch, and remover. Oscillator and toggle switch work together as the timer. The oscillator is consist of two genes. One gene activate the other gene and get a negative feedback. When output proteins of oscillator reach a threshold that preset, then the promoter of toggle switch will be activate, and output protein of toggle switch will suddenly activate the promoter of remover.
-== Experiment of oscillator biobrick parts (25) 2009/08/21 ==
+The following picture shows how the timer works by modeling:<br>
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 21 oscillator part(25).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+[[File:NYMU threshold.png|350px]]
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: E<r3t-->(l)|1109bp |286bp |w|=
-|2: E<r3t|1109bp |286bp |f|=
-|3: E<r3t|1109bp |286bp |f|=
-|4: E<r3t|1109bp |286bp |f|=
-|5: E<r3t|1109bp |286bp |f|=
-|6: E<r3t|1109bp |286bp |f|=
-|7: E<r3t|1109bp |286bp |f|=
-|8: E<r3t|1109bp |286bp |f|=
-|9: Positive Control E0240|1114bp |238bp|w|=
-|10: Negative Control |0bp |contamination~700,1100,1400|f|=
-|11: marker 1kb+100bp|||n}}
-Comments: liquid incubation of number 1}}
+We stop the timer by setting a threshold. As the protein produced by the oscillator promoter accumulates and reaches a certain threshold, the output promoter activity would suddenly change. This output promoter is connected to removal gene ''msbB''. Therefore, at the time that timer stops, LPS expressed and attract macrophages.
+This setting can control the micromachine to trigger an immune response after a period of time. This period of time is controlled precisely, otherwise ViroCatcher will be removed too fast or too late. Anyway, no matter what kind of situation, our ViroCatcher will be removed.
-== Experiment of oscillator biobrick parts (26) 2009/08/22 ==
+== Experiment Results ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 22 oscillator part(26).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+====Protocol of Promoter Strength Testing====
-% agarose, 100V, 28min
+#extract the Biobrick promoter
-{{:Team:NYMU-Taipei/GELC|=
+#combine it with GFP generator {{:Team:NYMU-Taipei/BBa|I13504}} with the promoter and then transform
-|0: marker 1kb+100bp|||n|=
+#colony PCR
-|1: P<r3t|1138bp |315bp |f|=
+#liquid incubation and plasmid extraction
-|2: P<r3t|1138bp |315bp |f|=
+#measure the amount of fluroresence by using an ELISA reader with a 96 well plate
-|3: P<r3t|1138bp |315bp |f|=
+#data collection
-|4: P<r3t|1138bp |315bp |f|=
+#using pTet as the standard having the value of 1
-|5: 4<t|876bp |739bp |f|=
+#characterize the basal level expression without any inducer or repressor interaction
-|6: 4<t|876bp |739bp |f|=
-|7: 4<t|876bp |739bp |w|=
-|8: 4<t-->(4)|876bp |739bp |w|=
-|9: Positive Control E0240|1113bp |250bp|w|=
-|10: Negative Control |0bp |contamination~700|f|=
-|11: marker 1kb+100bp|||n}}
-Comments:
+==== Oscillator Modeling ====
-*4t in lane 5 seems strange. It is not correct,but not fail either. Lane 7 and 8 are correct. They could do liquid incubation.
+[[/Modeling|Modeling]]
-*There are no colony on the yesterday's plate Ar2t, so there is no need to do colony PCR.
+==== Promoter Strength Testing ====
+[[Team:NYMU-Taipei/Project/Promoter Strength Testing|Reporting Assay of Promoter Strength Testing]]
-*Ligation&Transformation: Ar7t、Pr7t、Lr7t(33.3uL competent cell each)
+====Colony PCR Gel Pictures====
-}}
-== Experiment of oscillator biobrick parts (27) 2009/08/23 colony PCR==
+{| border="1"
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 23 oscillator part(27).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+|  [[image:NYMU Gel 1.png|640px]] || '''Figure 1.''' 1.pTet with generator ({{:Team:NYMU-Taipei/BBa|K195610}}) 2.pLac with generator ({{:Team:NYMU-Taipei/BBa|K195612}}) 3.pRE with generator ({{:Team:NYMU-Taipei/BBa|K195609}})
-% agarose, 100V, 28min
+|}
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: A<r7t-->(1)|1176bp |292bp |w|=
-|2: A<r7t|1176bp |292bp |w|=
-|3: P<r7t-->(2)|1199bp |315bp |w|=
-|4: P<r7t|1199bp |315bp |w|=
-|5: L<r7t-->(3)|1322bp |438bp |w|=
-|6: L<r7t|1322bp |438bp |w|=
-|7: P<r3t|1138bp |315bp |f|=
-|8: P<r3t|1138bp |315bp |f|=
-|9: Positive Control E0240|1113bp |250bp|w|=
-|10: Negative Control |0bp ||w|=
-|11: marker 1kb+100bp|||n}}
-Comments:
+{| border="1"
-*all the colonies that are transformed yesterday are all correct. Pr3t is from the checking plate 090821.
+|  [[image:NYMU Gel 2-1.png|640px]]   || '''Figure 2.''' L1~L2 pTet with generator ({{:Team:NYMU-Taipei/BBa|K195610}}) L3~L4 pPenI with generator ({{:Team:NYMU-Taipei/BBa|K195611}}) L5~L6 pLac with generator ({{:Team:NYMU-Taipei/BBa|K195612}})
-*haven't done the liquid incubation yet, should I do the liquid?
+|}
-*Lr7t is green enough to be identified. Ar7t and Pr7t are not sure enough for me to identify.
-*'''r7t''' is BBa_I13504 from Biobrick, not the ligation from r<7t.
+{| border="1"
+|  [[image:NYMU Gel 5-1.png|640px]]  ||  '''Figure 3.''' L1~L4 pLuxR with generator ({{:Team:NYMU-Taipei/BBa|K195615}}) L5 pCI with generator ({{:Team:NYMU-Taipei/BBa|K195613}}) L6~L8 pLasR with generator ({{:Team:NYMU-Taipei/BBa|K195616}})
+|}
-*Today's transformation :
+{| border="1"
-**Ar<2t
+| [[image:NYMU Gel 4-1.png|640px]]  ||  '''Figure 4.''' L1~L4 p22 with generator ({{:Team:NYMU-Taipei/BBa|K195614}}) L5~L8 pLuxR with generator ({{:Team:NYMU-Taipei/BBa|K195615}})
-**Ar<7t
+|}
-*'''Ar''' is BBa_J13002 from Biobrick.
-}}
-== Experiment of oscillator biobrick parts (28) 2009/08/23 testing the reheating gel ==
+{| border="1"
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 23 oscillator part(28).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
+| [[image:NYMU Gel 6-1.png|640px]] ||  '''Figure 5.''' L1~L6 pRE with PenI repressor gene ({{:Team:NYMU-Taipei/BBa|K195621}})
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: r1t|1176bp |292bp |w|=
-|2: CI lam|988bp |238bp |m|=
-|3: pMnt|1199bp |315bp |w|=
-|4: unknown|bp |bp |f|=
-|5: unknown|bp |bp |f|=
-|6: unknown|bp |bp |f|=
-|7: marker 1kb+100bp|||n}}
-Comments:
+|}
-* This gel is made by many pieces of gel and be reheat once. The result seems that this gel could be use to check DNA length, not suitable for gel extraction.
-* CI lam is from the old PCR tube. The result is not that reliable since it is not fresh enough. But the result is strange because it is not success or failure either.
+====Graph of Experiments====
-*pMnt seems to be right since that the right marker is upper than th left one, so the length is not sure.
-}}
+{| border="1"
-== Experiment of oscillator biobrick parts (29) 2009/08/26 ==
+|  [[image:NYMU Promoter Strength Test-1.png|640px]]  ||  '''Figure 1.''' This is the relative promoter strength to pTet, which was tested by measuring the flurorescence with an ELISA Reader. pLux and pLas are inducible promoters, so their measured promoter strength is their basal level strength.
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 26 oscillator part(29).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Pr3t|1138bp |315bp |f|=
-|2: Pr3t|1138bp |315bp |m|=
-|3: Pr3t|1138bp |315bp |f|=
-|4: Pr3t|1138bp |315bp |f|=
-|5: Pr3t|1138bp |315bp |f|=
-|6: Pr3t|1138bp |315bp |f|=
-|7: Pr3t|1138bp |315bp |f|=
-|8: Pr3t|1138bp |315bp |f|=
-|9: Positive Control E0240|1113bp |250bp|w|=
-|10: Negative Control |0bp |Contamination~1400bp|f|=
-|11: marker 1kb+100bp|||n}}
-Comments:
+|}
-*It is not that correct since those colony have not 100% correct.
+{| border="1"
-*Pr3t in lane 2 seems to be correct in the upper band, while it also has the wrong length band.
+|  [[image:NYMU Chart (Lr2tEr7t) without line-1.png|640px]]  || '''Figure 2.''' This is the component testing with the activator CII at the downstream of pLac inducing pRE to express GFP.
+|}
+{| border="1"
+|  [[image:NYMU Chart (oscillator) 3-1.png|640px]]  || ''' Figure 3.''' This is the measurement by using an ELISA reader, graphing Fluorescence versus O.D of the Time Delay device(I) ({{:Team:NYMU-Taipei/BBa|K195622}})
+|}
-}}
+=== ''msbB'' gene PCR Results ===
-== Experiment of oscillator biobrick parts (29) 2009/08/27 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 27 oscillator part(30).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Pr3t|1138bp |315bp |f|=
-|2: Pr3t|1138bp |315bp |f|=
-|3: Pr3t|1138bp |315bp |f|=
-|4: Pr3t|1138bp |315bp |f|=
-|5: Pr3t|1138bp |315bp |f|=
-|6: nhaA+ E0240|1396bp |512bp |f|=
-|7: nhaA+ E0240|1396bp |512bp |f|=
-|8: nhaA+ E0240|1396bp |512bp |f|=
-|9: Positive Control E0240|1113bp |250bp|w|=
-|10: Negative Control |0bp |Contamination~1400bp|f|=
-|11: marker 1kb+100bp|||n}}
-Comment:
+{| border="1"
+|  [[image:NYMU MsbB.png|640px]] || '''Figure 1.''' This gel picture shows the result of PCR by L1~L5 is the length of msbB gene. L6 is negative control.
+|}
-*all of those bands are fail. It means that nhaA+E0240 didn't ligate well.
+== References ==
-*DO the ligation again?
+[1]  [[File:NYMU_Cutaneous_Injection_of_Human_Subjects_with_Macrophage_Inflammatory_Protein-1_Induces_Significant_Recruitment_of_Neutrophils_and_Monocytes1.pdf‎]]
+[2]  [[File:Activation_of_Human_Peripheral_Blood_Mononuclear_Cells_by_Nonpathogenic_Bacteria_In_Vitro_-_Evidence_of_NK_Cells_as_Primary_Targets.pdf]]
+[3]  [[File:Macrophage_activation_switching_-_an_asset_for_the_resolution_of_inflammation.pdf]]
-}}
+[4]  [http://www.springerlink.com/content/g262813537x0t254/ The effect of various inflammatory agents on the phagocytosis and cytokine profile of mouse and rat macrophages]
-== Experiment of oscillator biobrick parts (30) 2009/08/28 ==
+[5]  [http://partsregistry.org/wiki/index.php/Part:BBa_P1010/ Part:BBa_P1010]
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 28 oscillator part(31).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Pr3t|1138bp |315bp |f|=
-|2: Pr3t|1138bp |315bp |f|=
-|3: Pr3t|1138bp |315bp |w|=
-|4: Pr3t|1138bp |315bp |f|=
-|5: Pr3t|1138bp |315bp |f|=
-|6: Pr3t|1138bp |315bp |w|=
-|7: Ar2t|749bp |292bp |f|=
-|8: Ar2t|749bp |292bp |w|=
-|9: Positive Control E0240|1113bp |250bp|w|=
-|10: Negative Control |0bp ||w|=
-|11: marker 1kb+100bp|||n}}
-Comments:
+[6]  [http://partsregistry.org/wiki/index.php/Part:BBa_K145230/ Part:BBa_K145230]
-* It is great progress that we have finally done the ligation of the Ar2t. Doing the liquid this time, including correct one and fail one.
+[7]  [http://en.wikipedia.org/wiki/Lipopolysaccharide#Lipid_A/ LPS]
-* Pr3t is correct. Doing the liquid culture tomorrow from the checking plate 090828.
+[8]  [[File:NYMU LPS濃度對於細胞CD14的表現的影響.pdf]]
+[9]  [[File:Ginger extract inhibits LPS induced macrophage activation and function.pdf]]
-}}
+{{:Team:NYMU-Taipei/Footer}}
-== Experiment of oscillator biobrick parts (31) 2009/08/31 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 31 oscillator part(32).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Ar2t<Er7t|1689bp |749bp |f|=
-|2: Ar2t<Er7t|1689bp |749bp |f|=
-|3: Ar2t<Er7t|1689bp |749bp |f|=
-|4: Ar2t<Er7t|1689bp |749bp |f|=
-|5: Ar2t<Er7t|1689bp |749bp |f|=
-|6: Ar2t<Er7t|1689bp |749bp |f|=
-|7: Ar2t<Er7t|1689bp |749bp |f|=
-|8: Ar2t<Er7t|1689bp |749bp |f|=
-|9: Positive Control E0240|1113bp |250bp|w|=
-|10: Negative Control |0bp |Contamination~700bp|f|=
-|11: marker 1kb+100bp|||n}}
-Comments:
-*Because the ligation is fail, I restarted from the ligation again. I changed the protocol, which I used 5.5uL inserted DNA instead of using 4uL inserted DNA.
-*Since there are still have colony on the plate, we will run colony PCR again with the ligation I did today(L<r7t and Ar2t<Er7t.}}
-== Experiment of oscillator biobrick parts (32) Gel Extraction 2009/08/31 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 31 oscillator part(33).png||c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: 4t|584bp |447bp |f|=
-|2: 4t|584bp |447bp |f|=
-|3: 4t|584bp |447bp |f|=
-|4: 4t|584bp |447bp |f|=
-|5: r2t|475bp |38bp |w|=
-|6: r2t|475bp |38bp |w|=
-|7: r2t|475bp |38bp |w|=
-|8: r2t|475bp |38bp |w|=
-|9: marker 1kb+100bp|||n}}
-Comments:
-*The failure of 4t is due to the digestion, so we have to digest it again.
-*r2t is fine, so we have extract them from the gel.}}
-== Experiment of oscillator biobrick parts (33) 2009/09/01 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 01 oscillator part(34).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
-|2: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
-|3: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
-|4: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
-|5: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
-|6: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
-|7: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
-|8: L<r2t|895bp |438bp |w|=
-|9: L<r2t|895bp |438bp |f|=
-|10: L<r2t|895bp |438bp |f|=
-|11: L<r2t|895bp |438bp |f|=
-|12: L<r2t|895bp |438bp |f|=
-|13: L<r2t|895bp |438bp |w|=
-|14: L<r2t|895bp |438bp |f|=
-|15: Ar2t<Er7t(090831 ligation)|1689bp |749bp |w|=
-|16: Ar2t<Er7t(090831 ligation)|1689bp |749bp |f|=
-|17: Ar2t<Er7t(090831 ligation)|1689bp |749bp |f|=
-|18: Ar2t<Er7t(090831 ligation)|1689bp |749bp |w|=
-|19: Ar2t<Er7t(090831 ligation)|1689bp |749bp |w|=
-|20: Ar2t<Er7t(090831 ligation)|1689bp |749bp |f|=
-|21: Ar2t<Er7t(090831 ligation)|1689bp |749bp |m|=
-|22: Positive Control E0240|1114bp |238bp|w|=
-|23: Negative Control |0bp |contamination~250,1400bp|f|=
-|24: marker 1kb+100bp|||n}}
-Comments:
-* Liquid incubation should be done by the next day.
-* I have do the liquid of the 9 and 19. Only 19 is correct. I will do the Digestion and Ligation tomorrow.
-}}
-== Experiment of oscillator biobrick parts (34) Gel Extraction 2009/09/02 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 02 oscillator part(35).png||c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Ar2tEr7t|1476bp |537bp |w|=
-|2: Ar2tEr7t|1476bp |537bp |w|=
-|3: Ar2tEr7t|1476bp |537bp |w|=
-|4: Ar2t|537bp |80bp |f|=
-|5: Ar2t|537bp |80bp |f|=
-|6: Ar2t|537bp |80bp |f|=
-|7: marker 1kb+100bp|||n}}
-Comments:
-*The failure of Ar2t is strange, maybe it is that I put too much DNA in the digestion.
-*Ar2tEr7t is not digested well, next time we should not put too much DNA.
-*concentration measurement before the digestion
-}}
-== Experiment of oscillator biobrick parts (35) 2009/09/03 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 03 oscillator part(36).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|140s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
-|2: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
-|3: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
-|4: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
-|5: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
-|6: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
-|7: Er3t<Ar2tEr7t|2567bp |1109bp |m|=
-|8: Er3t<Ar2tEr7t|2567bp |1109bp |f|=
-|9: Positive Control E0240|1113bp |250bp|w|=
-|10: Negative Control |0bp |Contamination~290bp,1300bp,1400bp |f|=
-|11: marker 1kb+100bp|||n}}
-Comments:
-*There is a lot of contamination in the negative control. We speculated that it might be due to buffer since that eyelight used the old taq and buffer.
-*The length seems to be right, but it is still need to be measured by GFP machine to check if it could be oscillate.
-}}
-== Experiment of oscillator biobrick parts (36) Gel Extraction 2009/09/03 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 03 oscillator part(37).png||c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Ar2t(8-2)|537bp |80bp |f|=
-|2: Ar2t(8-2)|537bp |80bp |f|=
-|3: Ar2t(8-2)|537bp |80bp |f|=
-|4: Er3t|897bp |74bp |w|=
-|5: Er3t|897bp |74bp |w|=
-|6: Er3t|897bp |74bp |w|=
-|7: -|||n|=
-|8: 4t|584bp |447bp |w|=
-|9: 4t|584bp |447bp |w|=
-|10: 4t|584bp |447bp |w|=
-|11: marker 1kb+100bp|||n}}
-Comments:
-*Ar2t still fails. Er3t is the one that we are trying to ligate with Ar2t.
-}}
-== Experiment of oscillator biobrick parts (37) 2009/09/04 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 04 oscillator part(38).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|110s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Lr2t<Er7t|1834bp |895bp |f|=
-|2: Lr2t<Er7t|1834bp |895bp |f|=
-|3: Lr2t<Er7t|1834bp |895bp |f|=
-|4: Lr2t<Er7t|1834bp |895bp |f|=
-|5: Lr2t<Er7t|1834bp |895bp |w|=
-|6: P<r2t|772bp |315bp |f|=
-|7: P<r2t|772bp |315bp |w|=
-|8: P<r2t|772bp |315bp |f|=
-|9: P<r2t|772bp |315bp |w|=
-|10: P<r2t|772bp |315bp |f|=
-|11: Ar2t<Er3t|1628bp |749bp |f|=
-|12: Ar2t<Er3t|1628bp |749bp |f|=
-|13: Ar2t<Er3t|1628bp |749bp |w|=
-|14: Ar2t<Er3t|1628bp |749bp |f|=
-|15: Ar2t<Er3t|1628bp |749bp |f|=
-|16: r<4t|816bp |250bp |w|=
-|17: r<4t|816bp |250bp |f|=
-|18: r<4t|816bp |250bp |w|=
-|19: r<4t|816bp |250bp |w|=
-|20: r<4t|816bp |250bp |w|=
-|21: r<4t|816bp |250bp |w|=
-|22: Positive Control E0240|1114bp |238bp|w|=
-|23: Negative Control |0bp ||m|=
-|24: marker 1kb+100bp|||n}}
-Comments
-*There is no contamination since I use the old buffer and enzyme. In addition, I change to use new dNTP and I speculated the contamination might be due to new buffer.
-*Need to make liquid incubation by using checking plate
-}}
-== Experiment of oscillator biobrick parts (38) Gel Extraction 2009/09/09 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 09 oscillator part(39).png||c=
-% agarose, 100V, 28min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 100bp|||n|=
-|1: marker 1kb|||n|=
-|2: r4t|604bp |38bp |w|=
-|3: r4t|604bp |38bp |w|=
-|4: r4t|604bp |38bp |w|=
-|5: -|||n|=
-|6: Ar2tEr7t|707bp |?bp |w|=
-|7: Er3tAr2tEr7t|707bp|?bp|w|=
-|8: marker 1kb|||n|=
-|9: marker 100bp|||n|=}}
-Comments:
-*r4t is correct though it is not digested well enough.
-}}
-== Experiment of oscillator biobrick parts (39) 2009/09/11 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 11 oscillator part(40).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|110s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: A<r4t|878bp |292bp |f|=
-|2: E<r4t|872bp |286bp |w|=
-|3: E<r4t|872bp |286bp |w|=
-|4: E<r4t|872bp |286bp |w|=
-|5: E<r4t|872bp |286bp |w|=
-|6: E<r4t|872bp |286bp |w|=
-|7: E<r4t|872bp |286bp |w|=
-|8: Pr2t<Er7t|1712bp |772bp |f|=
-|9: Pr2t<Er7t|1712bp |772bp |f|=
-|10: Pr2t<Er7t|1712bp |772bp |f|=
-|11: Pr2t<Er7t|1712bp |772bp |f|=
-|12: Pr2t<Er7t|1712bp |772bp |f|=
-|13: Pr2t<Er7t|1712bp |772bp |f|=
-|14: Positive Control E0240|1114bp |238bp|w|=
-|15: Negative Control |0bp ||w|=
-|16: marker 1kb+100bp|||n}}
-Comments
-*It is awful that the plate of Ar4t only have one colony on it. Maybe it is due to the bad digestion of pTet(A). Should the experiment be started from the digestion of pTet or ligation?
-*Pr2t<Er7t could do the colony PCR again to check if there are another correct colony.
-}}
-== Experiment of oscillator biobrick parts (40) 2009/09/15 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 15 oscillator part(41).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|100s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Pr2t<Er7t|1712bp |772bp |f|=
-|2: Pr2t<Er7t|1712bp |772bp |f|=
-|3: Pr2t<Er7t|1712bp |772bp |f|=
-|4: Pr2t<Er7t|1712bp |772bp |f|=
-|5: Pr2t<Er7t|1712bp |772bp |m|=
-|6: A<r4t|878bp |292bp |f|=
-|7: A<r4t|878bp |292bp |f|=
-|8: A<r4t|878bp |292bp |f|=
-|9: Positive Control E0240|1114bp |238bp|w|=
-|10: Negative Control |0bp |contamination~700bp|f|=
-|11: marker 1kb+100bp|||n}}
-Comments:
-*Redo the colony PCR again and use more colony to check if there is a correct colony.
-*Lane 5 is strange, maybe it is the P<Er7t because the r2t hasn't been ligated correctly.
-*Ar4t keeps fail, however there are some small colony we can pick up.
-}}
-== Experiment of oscillator biobrick parts (41) 2009/09/17 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 17 oscillator part(42).png|{{:Team:NYMU-Taipei/PCR|60s|15s|110s|100s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 29in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: A<r4t|878bp |292bp |w|=
-|2: A<r4t|878bp |292bp |w|=
-|3: A<r4t|878bp |292bp |w|=
-|4: A<r4t|878bp |292bp |w|=
-|5: A<r4t|878bp |292bp |w|=
-|6: A<r4t|878bp |292bp |w|=
-|7: A<r4t|878bp |292bp |w|=
-|8: A<r4t|878bp |292bp |w|=
-|9: A<r4t|878bp |292bp |w|=
-|10: A<r4t|878bp |292bp |w|=
-|11: A<r4t|878bp |292bp |w|=
-|12: Pr2t<Er7t|1712bp |772bp |f|=
-|13: Pr2t<Er7t|1712bp |772bp |f|=
-|14: Pr2t<Er7t|1712bp |772bp |f|=
-|15: Pr2t<Er7t|1712bp |772bp |f|=
-|16: Pr2t<Er7t|1712bp |772bp |f|=
-|17: Pr2t<Er7t|1712bp |772bp |f|=
-|18: Pr2t<Er7t|1712bp |772bp |w|=
-|19: Pr2t<Er7t|1712bp |772bp |m|=
-|20: Pr2t<Er7t|1712bp |772bp |f|=
-|21: Pr2t<Er7t|1712bp |772bp |f|=
-|22: Positive Control E0240|1114bp |238bp|w|=
-|23: Negative Control |0bp |contamination~300bp,700bp|f|=
-|24: marker 1kb+100bp|||n}}
-Comments:
-}}
-== Experiment of oscillator biobrick parts (42) 2009/09/18 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 18 oscillator part(43).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|40s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: pLuxR|293bp |238bp |w|=
-|2: pLuxR|293bp |238bp |w|=
-|3: pCI|287bp |238bp |w|=
-|4: pCI|287bp |238bp |w|=
-|5: p22|292bp |238bp |w|=
-|6: p22|292bp |238bp |w|=
-|7: pLasR|395bp |238bp |w|=
-|8: pLasR|395bp |238bp |w|=
-|9: Positive Control Term|445bp |316bp|w|=
-|10: Negative Control |0bp |contamination~700bp|f|=
-|11: marker 1kb+100bp|||n}}}}
-== Experiment of oscillator biobrick parts (43) 2009/09/22 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 22 oscillator part(44).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|70s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 100bp|||n|=
-|1: p22+r7t|1175bp |292bp |m|=
-|2: p22+r7t|1175bp |292bp |w|=
-|3: p22+r7t|1175bp |292bp |w|=
-|4: p22+r7t|1175bp |292bp |w|=
-|5: pLuxR+r7t|1176bp |293bp |w|=
-|6: pLuxR+r7t|1176bp |293bp |w|=
-|7: pLuxR+r7t|1176bp |293bp |w|=
-|8: pLuxR+r7t|1176bp |293bp |w|=
-|9: Positive Control E0240|1114bp |238bp|w|=
-|10: Negative Control |0bp ||w|=
-|11: marker 100bp|||n}}}}
-== Experiment of oscillator biobrick parts (44) 2009/09/24 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 24 oscillator part(45).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 100bp|||n|=
-|1: pLuxR+r7t|1176bp |293bp |m|=
-|2: pLuxR+r7t|1176bp |293bp |w|=
-|3: pLuxR+r7t|1176bp |293bp |w|=
-|4: pCI+r7t|1170bp |287bp |m|=
-|5: pLasR+r7t|1278bp |395bp |w|=
-|6: pLasR+r7t|1278bp |395bp |w|=
-|7: pLasR+r7t|1278bp |395bp |w|=
-|8: pLasR+r7t|1278bp |395bp |w|=
-|9: Positive Control E0240|1114bp |238bp|w|=
-|10: Negative Control |0bp |contamination~1100bp|w|=
-|11: marker 100bp|||n}}
-Comments:
-*It is strange that the colony of pCI+r7t is glowing obviously, but the length seems to be wrong.
-}}
-== Experiment of oscillator biobrick parts (45) (Gel Extraction) 2009/09/28==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 28 oscillator part(46).png||c=
-% agarose, 100V, 30min
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 1kb+100bp|||n|=
-|1: Pr2tEr7t-18|1500bp |560bp |w|=
-|2: Pr2tEr7t-18|1500bp |560bp |w|=
-|3: Pr2tEr7t-18|1500bp |560bp |w|=
-|4: Pr2tEr7t-19|1500bp |560bp |m|=
-|5: Pr2tEr7t-19|1500bp |560bp |m|=
-|6: Pr2tEr7t-19|1500bp |560bp |m|=
-|7: unknown|841bp |38bp |m|=
-|8: unknown|841bp |38bp |m|=
-|9: unknown|841bp |38bp |m|=
-|10: unknown|841bp |38bp |m|=
-|11: marker 1kb+100bp|||n}} }}
-== Experiment of oscillator biobrick parts (46) 2009/10/17 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 10 17 oscillator part(47).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 28in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 100bp|||n|=
-|1: Er4t<Pr2t|1414bp |872bp |f|=
-|2: Er4t<Pr2t|1414bp |872bp |f|=
-|3: Er4t<Pr2t|1414bp |872bp |f|=
-|4: Er4t<Pr2t|1414bp |872bp |f|=
-|5: Er4t<Pr2t|1414bp |872bp |f|=
-|6: Er4t<Pr2t|1414bp |872bp |f|=
-|7: Er4t<Pr2t|1414bp |872bp |f|=
-|8: Er4t<Pr2t|1414bp |872bp |f|=
-|9: Positive Control Lr7t|1321bp |438bp|w|=
-|10: Negative Control |0bp |contamination~1100bp|w|=
-|11: marker 100bp|||n}}}}
-== Experiment of oscillator biobrick parts (47) 2009/10/18 ==
-{{:Team:NYMU-Taipei/GEL|NYMU 2009 10 18 oscillator part(48).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-% agarose, 100V, 30in
-{{:Team:NYMU-Taipei/GELC|=
-|0: marker 100bp|||n|=
-|1: marker 1kb|||n|=
-|2: Ar4t<Pr3t|1786bp |878bp |f|=
-|3: Ar4t<Pr3t|1786bp |878bp |m|=
-|4: Ar4t<Pr3t|1786bp |878bp |f|=
-|5: Er4t<Pr2t|1414bp |872bp |f|=
-|6: Er4t<Pr2t|1414bp |872bp |f|=
-|7: Er4t<Pr2t|1414bp |872bp |f|=
-|8: Er4t<Pr2t|1414bp |872bp |f|=
-|9: Er4t<Pr2t|1414bp |872bp |f|=
-|10: Er4t<Pr2t|1414bp |872bp |w|=
-|11: Er4t<Pr2t|1414bp |872bp |m|=
-|12: Er4t<Pr2t|1414bp |872bp |f|=
-|13: Er4t<Pr2t|1414bp |872bp |f|=
-|14: Positive Control Ar7t|1175bp |292bp|w|=
-|15: Negative Control |0bp |contamination~1100bp|w|=
-|16: Negative Control |0bp |contamination~1100bp|w|=
-|17: marker 1kb|||n|=
-|18: marker 100bp|||n}}}}