http://2009.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Guimar3&year=&month=2009.igem.org - User contributions [en]2024-03-28T08:21:18ZFrom 2009.igem.orgMediaWiki 1.16.5http://2009.igem.org/Team:Valencia/ProjectTeam:Valencia/Project2009-10-21T13:23:41Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<br />
<div style="position:relative; margin-left: 175px; top:-5px; width:60%; color:black; font-size:10pt; font-family:Verdana" align="justify"><br />
<br />
== '''Project description''' ==<br />
<br />
<br><br />
The <b>iGEM Valencia Lighting Cell Display</b> (<b>iLCD</b>) is our project for the present iGEM competition. We are developing '''BioElectronics''', a combination of Electronics and Biology. We think that cell behaviour might be controlled by electrical impulses. For demostrate this, we are making <b>a “bio-screen” of voltage-activated cells</b>, where every “cellular pixel” produces light. It is just like a bacterial photographic system, but '''it's digital'''. Within seconds, instead of hours, you can get an image formed of living cells.<br />
We use the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen<br />
<br />
It is known that for instance <b>neurons, cardiomyocites or muscle cells</b> are able to sense and respond to electrical signals. These cells use a common second messenger system, calcium ion, which promotes a defined response when an electrical pulse is supplied to them. Nevertheless, these cultures present several disadvantadges in order to make use of them from the technological point of view: <br />
<br />
- Get easily contaminated.<br />
<br />
- Genetic manipulation is complicated and expensive.<br />
<br />
- To be very sensible to external conditions. <br />
<br />
Valencia team uses this sensibility of calcium channel to electricity to <b>produce yeast luminiscence as a response to electrical estimulous</b>. This project constitutes the '''FIRST TIME in which the electrical response of <i>Saccharomyces</i> and its potential applications are going to be tested''' building the first '''LEC''' (Light Emitting Cell). The obtained device will be used to build the first''' iLCD''' in history.<br />
<br />
Therefore, the project is divided in several stages from the fabrication of the first '''LEC''' up to the cooperative integration of various LECs in the first '''iLCD'''. The global scheme of the project is summarized in the scheme of the figure:<br />
<br />
<html><br />
<div align="right"><br />
<embed src="https://static.igem.org/mediawiki/2009/b/b4/Esquema_flash_bueno.swf" type="application/x-shockwave-flash" width="550" height="750" quality="high" overflow="hidden" bgcolor="WHITE"></embed> <br />
</div><br />
</html><br />
<!--<div style="position:relative; top:-5px; left:150px; width:600px" align="justify">--><br />
Where three main parts can be appreciated<br />
<br />
* LEC Construction<br />
<br />
* LEC Characterization<br />
<br />
* LEC Integration Device<br />
<br />
The main advantages of using electrical signals instead of chemical stimulation, as in the Coliroid project (Levskaya et al, <i>Synthetic biology: Engineering Escherichia coli to see light</i>. <b>Nature</b> 438, 441-442), are reversibility and high frequency: the system can go back to the resting state and it will take <b>seconds to refresh an image, actually showing animated pictures!</b>. For that reason, we chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
<b>iLCD will be a major advance in Synthetic Biology, opening the field of Green Electronics, integrating electrical signals with cell behaviours</b>. This will reduce the response time of the cells to the activation signal by up to two orders of magnitude, as well as foster the combination of Electronics and Biology. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
<br><br />
[[Image:Valenciarobocop.jpg|500px|center]]<br />
<br />
<br />
<br><br />
<br />
<!-- <div style="position:absolute;top:-450px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ExperimentalTeam:Valencia/WetLab/YeastTeam/Experimental2009-10-20T22:55:09Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
__NOTOC__<br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:700px"><br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<center> <br />
{| <br />
!Methods<br />
!Protocols<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#GELDOC|GelDoc]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Measurement of citoplasmic Ca2+ increase in S. cerevisiae|Citoplasmic Ca<sup>2+</sup> burst]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#PIPPETE ENLARGER|Pippete Enlarger]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing inserts by PCR|BioBrick PCR protocol]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROPHOTOMETER|Spectrophotometer]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing vectors|Preparing vectors]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROFLUORIMETER|Spectrofluorimeter]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Ligating BioBricks into plasmids|Ligation]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#LUMINOMETER|Luminometer]]<br />
|-<br />
|width="200px"| <br />
|width="200px"| <br />
|}<br />
</center><br><br />
=='''Experimental methods'''==<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
To make measurements properly and determinate luminiscence levels, we needed a luminometer. But we couldn’t use one before September. So, if we didn’t want to waste our limited time, we decided to try with other machines.<br />
<br />
This way, we had dt ideas, and we thought a GelDoc camera, an espectophotometer and a espectofluorimeter could be useful for us, at least to determinate the presence/absence of the luminiscence. <br />
<br />
===GELDOC===<br />
<br />
[[Image:Igem2b.JPG|center|400 px|]]<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px"><br />
<br />
That was the first idea we got. It consisted to try to capture the luminiscence produced by our yeast with the camera that is normaly used to take gel photos. We thought that if we increased exposure time, we could acumulate enough luminiscence produced in time to see it, at the photo. <br />
<br />
We put our yeast after the different steps of our protocol in a multi-hole plaque and add the alcaline input. Fastly, we used to close the GelDoc door, but we had doubts about the velocity of the response, and we couldn’t be inside the GelDoc to start the measure at the same time we make the input. In order to make sure our yeasts weren’t making light too fast, we designed a very simple but precise mechanism. We called it PippeteEnlarger.<br />
<br />
===PIPPETE ENLARGER===<br />
<br />
[[Image:Igem1.JPG|thumb|center|500 px|]]<br />
<br />
The Pippete Enlarger is easy to assemble using a pippete, a thin tube and two pippete tips: one has to fit into the tub (so size tip deppends on size tub) and the another one has to be the proper tip to take the volume we want.<br />
<br />
So, we will explain the mechanisme in the way we did it. We needed to make an input of 30 microliters of KOH without open the door. We had to enlarge the pippete to put the tip in the correct hole with the closed door and trigger the mechanism out of the GelDoc. We decided to full the tube with KOH, make pressure in one of the extrems of the tube, preventing by capilarity the liquid go away, and connect the pippete with an intermediary tip in the other extrem (the volume had to be already prefixed). The extrem we were pressing could be released at this point, so we could put the correct tip (in our chase, a yellow tip) to catch the desired volume. Before to be loaded with 30 microliters of KOH, we fixed the tip in the hole we wanted, we closed the door and carry on the pippete outside the GelDoc.<br />
<br />
We were ready to start the measurement, making sure we increased enough the exposure time. Then, we pulled out the 30 microlitres actioning the pippete. It was surprisingly acurate!!! The volume was almost exactly, with 1 or 2 microliters of error. We dind’t got any result.<br />
We could rule out, then, the possibility that our yeasts produce light meanwhile we were putting them in the GelDoc, or we were closing the door...<br />
<br />
GelDoc camera was not an efficient way to detect our luminiscence, so we thought perhaps a spectrophotometer was a more addient machine.<br />
<br />
===SPECTROPHOTOMETER===<br />
<br />
[[Image:Igem19.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem8.JPG|thumb|left|315 px|]]<br />
<br />
Altough an spectophotometer is a machine that measures how cloudy a sample is, by emitting a ray of light, we can “trick” the machine. Sticking a piece of silver paper in one of the faces of the little tank, we prevent the ray of light cross the sample. The idea is to measure only the light produced by the sample, not the “crossing light”.<br />
<br />
We didn’t obtain any result, but that was probably because the spectrophotometer has been designed to detect a very located light ray, not a difused light produced by a bioluminiscent sample.<br />
<br />
===SPECTROFLUORIMETER===<br />
<br />
<br />
[[Image:Igem9.JPG|thumb|center|500 px|]]<br />
<br />
[[Image:MedidafluorimetroVII.jpg|thumb|right|315 px|]]<br />
<br />
[[Image:MedidafluorimetroVI.jpg|thumb|left|315 px|]]<br />
<br />
[[Image:Igem13.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem17.JPG|thumb|left|315 px|]]<br />
<br />
Spectrofluorimeter measures the fluorescence of a sample. That’s because it has the same problem of the spectrophotometer. However, we found that it’s more sensible (it detects a great quantity of noise). So we thought it could be a more proper machine to our purposes.<br />
<br />
We designed a similar experiment, covering the place where the ray of light is emited, in order to measure only the bioluminiscence produced by our yeasts.<br />
<br />
We didn’t obtain any result. But we were worried about the speed of the reaction another time. Then, we decided to rule out the possibility as we did it with the GelDoc: starting the measure before adding the alkaline input.<br />
But this machine was different, so we designed a different experiment.<br />
<br />
We found a hole (normaly closed) in the tap, just uppon the the place where the sample is. Using a piece of termaflex, we crossed it with the pippete, and put it in the hole, isolating the overture and preventing light got in and artefact our result. Another time, that was extremely acurate, and when we closed the door, the tip went exactly to the point where our sample was placed.<br />
This way, we started to measure before adding the input. Next, we pulled out hte 30 microliters of KOH in the little tank. We got depressed when we didn’t obtain results. But for this time, we were in September, and the luminometer was available for us.<br />
<br />
In some days, our hard work was going to give us nice surprises.<br><br><br />
<br />
===LUMINOMETER===<br />
<br><br />
At last, we found a luminometer at Instituto de química molecular aplicada at UPV. Luminometers are more sensible and have more precision than espectrophotometer and espectrofluorimeter. Luminometer is ideal to work with aequorin, but was difficult to us to find one (we were looking for one and found two ^^).<br />
<br />
There are two types of luminometers: continuous and discontinuous. The discontinuous make punctual measures, in our case every 30 seconds. The continuous measures continuously, every second. Is important to note that we use two different luminometer, provided by different manufacturers. For this reasons we can't compare directly the results obtained with one luminometer with the results of the other. According this, when we only compare results in the same graph if they were obtained with the same luminometer. However, an increase (or not) in the luminosity, means the same at two luminometers and the experiments are complementary and reaffirms our conclusions. <br />
<br />
Each luminometer has its own protocol.<br />
<br />
First, we work with a discontinous luminometer. It measures every 30 seconds. We make a lot of measurements, trying to optimize the electrical input with the light generation. It's connected to a computer, where we see the value of luminescence. To measure luminescence, luminometer have a Elisa plate, where we put our yeasts. After, we introduce the Elisa plate into luminometer and click Start on computer. After 15 seconds we have the measure of luminosity.<br />
<br />
After, in the same department, we used a continuous luminometer. This is better because measures instantly, every second and the results obtained are more reliable. With this two luminometer we make the caracterization of ''Aequorin'' and obtained the results that demonstrate that we were right. WE CAN CREATE A CELL-BASED BIOSCREEN. Continuous luminometer have a cuvette where we put the cells. The cuvette must be very closed. We devise a system to applicate the electrical stimulus when the cuvette is closed. This luminometer also have a computer, but it was very old!<br />
<br />
[[Image:HiTech! val.jpg|center|315 px|]]<br />
<br />
==Protocols==<br />
===Measurement of citoplasmic Ca<sup>2+</sup> increase in <i>S. cerevisiae</i>===<br />
<br />
<br />
Modified from the original Denis and Cyert (2002) JCB 156; 29-34. <br />
<br />
'''Material'''<br />
* pEVP11[AEQ] plasmid: apoaequorina expression (Batiza et al.(1996) J.Biol.Chem. 271: 23357-62). <br />
* Coelenterazine solution: Diluted coelenterazine until 590μM in satured N2 metanol. This compound is extremely photosensible and it's inhibited by O<sup>2</sup>. Kept at –20ºC. <br />
** Note: We bought Coelenterazine, Native (CLZn) 50 μg Ref. C-2230 de SIGMA. We put N2 gas into metanol during 5 minutes, and we added inmediately 200μL to the 50μg of coelenterazine. <br />
<br />
* Luminometer. <br />
* Luminometer tubes and ELISA plaques. <br />
<br />
'''Procedure'''<br />
# We recieved pEVP11[AEQ] aequorin transformed yeast from Joaquin Arinyo. <br />
# We let growing up o/n in SD lacking Leu medium to maintain plasmid expression. <br />
# After incubation, measure OD a 660nm y calculate the necessary volum to obtain in 250μL a final OD of 1,8. Put that volum into an eppendorf tube with a hole in its tap. <br />
# Centrifugate 1 minute at 13000rpm. <br />
# Discard the supernatant. <br />
# Resuspend the pellet into 250μL of fresh medium with coelenterazine 2μM (aprox. 3,5μL of coelenterazinestock solution / μL de medio). <br />
# Incubate during 5,5 horas at ambient temperature, in agitation and keeping in the darkness. <br />
# Centrifugate 1 minute at 13000rpm. Discard the supernatant and resuspend in SD lacking Leu fresh medium without coelenterazine (see the proper volum below *). <br />
# Wait 15 min (yeast luminiscence is increased due to a peak of Ca2+ is induced by the glucose (Nakajimashimada et al. (1991) PNAS 88; 6878-82). <br />
# Measure basal luminiscence during 15 minutes. <br />
# Add the correct reactive volum to induce luminiscence. <br />
<br />
In the case of alcaline induction: <br />
<br />
8. Add 170μL of medium. <br />
<br />
9. Add 30μL of KOH 100mM. <br />
<br />
Other stress types: <br />
<br />
*NaCl: 30μL NaCl 5M (0,75M final). <br />
*CaCl<sub>2</sub>: 30μL CaCl<sub>2</sub> 1.33M (200mM final). <br />
*KCl: 30μL KCl 100mM. <br />
<br />
Note: yeasts should be treated sequentialy and in the same way to obtain reproducible results.<br />
<br />
===Preparing inserts by PCR=== <br />
<br />
Total DNA was extracted from our yeast strains.<br><br />
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br><br />
<br />
And our oligos (EcoRI and XbaI sites in bold) were:<br><br />
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br><br />
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br><br />
<br />
<br />
PCR was conducted as follows:<br><br />
<br />
<ol>A first denaturation cycle<br />
<br />
<ol>94º 3min</ol><br />
<br />
Followed by 30 amplification cycles: <br />
<br />
<ol>94º 30s<br><br />
<br />
55º 1min<br><br />
<br />
72º 1min<br></ol><br />
<br />
And a final extension step:<br />
<br />
<ol>72º 7min</ol><br />
<br />
<br />
<br />
[[Image:Gelaeq.JPG]]<br />
<br />
Results:<br><br />
<br />
1 = wt (1 microlitre)<br><br />
2 = wt (2 microlitres)<br><br />
3 = Cch1 (1 microlitre)<br><br />
4 = Mid1 (1 microlitre)<br><br />
5 = Negative Control<br><br />
6 = Possitive Control<br><br />
(We used the same MWM)<br><br />
<br />
Amplicon has 600 pb's.<br />
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> <br />
<br />
Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br><br />
<br />
===Preparing vectors===<br />
<br />
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL1-Gold Ultracompetent Cells of..... We selected transformed cells in a LB + ampicillin medium plaques. <br><br />
<br />
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br><br />
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br><br />
<br />
<br />
===Ligating BioBricks into plasmids===<br />
<br />
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br><br />
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br><br />
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br><br />
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ExperimentalTeam:Valencia/WetLab/YeastTeam/Experimental2009-10-20T22:54:43Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
__NOTOC__<br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:700px"><br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<center> <br />
{| <br />
!Methods<br />
!Protocols<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#GELDOC|GelDoc]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Measurement of citoplasmic Ca2+ increase in S. cerevisiae|Citoplasmic Ca<sup>2+</sup> burst]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#PIPPETE ENLARGER|Pippete Enlarger]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing inserts by PCR|BioBrick PCR protocol]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROPHOTOMETER|Spectrophotometer]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing vectors|Preparing vectors]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROFLUORIMETER|Spectrofluorimeter]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Ligating BioBricks into plasmids|Ligation]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#LUMINOMETER|Luminometer]]<br />
|-<br />
|width="200px"| <br />
|width="200px"| <br />
|}<br />
</center><br><br />
=='''Experimental methods'''==<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
To make measurements properly and determinate luminiscence levels, we needed a luminometer. But we couldn’t use one before September. So, if we didn’t want to waste our limited time, we decided to try with other machines.<br />
<br />
This way, we had dt ideas, and we thought a GelDoc camera, an espectophotometer and a espectofluorimeter could be useful for us, at least to determinate the presence/absence of the luminiscence. <br />
<br />
===GELDOC===<br />
<br />
[[Image:Igem2b.JPG|center|400 px|]]<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px"><br />
<br />
That was the first idea we got. It consisted to try to capture the luminiscence produced by our yeast with the camera that is normaly used to take gel photos. We thought that if we increased exposure time, we could acumulate enough luminiscence produced in time to see it, at the photo. <br />
<br />
We put our yeast after the different steps of our protocol in a multi-hole plaque and add the alcaline input. Fastly, we used to close the GelDoc door, but we had doubts about the velocity of the response, and we couldn’t be inside the GelDoc to start the measure at the same time we make the input. In order to make sure our yeasts weren’t making light too fast, we designed a very simple but precise mechanism. We called it PippeteEnlarger.<br />
<br />
===PIPPETE ENLARGER===<br />
<br />
[[Image:Igem1.JPG|thumb|center|500 px|]]<br />
<br />
The Pippete Enlarger is easy to assemble using a pippete, a thin tube and two pippete tips: one has to fit into the tub (so size tip deppends on size tub) and the another one has to be the proper tip to take the volume we want.<br />
<br />
So, we will explain the mechanisme in the way we did it. We needed to make an input of 30 microliters of KOH without open the door. We had to enlarge the pippete to put the tip in the correct hole with the closed door and trigger the mechanism out of the GelDoc. We decided to full the tube with KOH, make pressure in one of the extrems of the tube, preventing by capilarity the liquid go away, and connect the pippete with an intermediary tip in the other extrem (the volume had to be already prefixed). The extrem we were pressing could be released at this point, so we could put the correct tip (in our chase, a yellow tip) to catch the desired volume. Before to be loaded with 30 microliters of KOH, we fixed the tip in the hole we wanted, we closed the door and carry on the pippete outside the GelDoc.<br />
<br />
We were ready to start the measurement, making sure we increased enough the exposure time. Then, we pulled out the 30 microlitres actioning the pippete. It was surprisingly acurate!!! The volume was almost exactly, with 1 or 2 microliters of error. We dind’t got any result.<br />
We could rule out, then, the possibility that our yeasts produce light meanwhile we were putting them in the GelDoc, or we were closing the door...<br />
<br />
GelDoc camera was not an efficient way to detect our luminiscence, so we thought perhaps a spectrophotometer was a more addient machine.<br />
<br />
===SPECTROPHOTOMETER===<br />
<br />
[[Image:Igem19.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem8.JPG|thumb|left|315 px|]]<br />
<br />
Altough an spectophotometer is a machine that measures how cloudy a sample is, by emitting a ray of light, we can “trick” the machine. Sticking a piece of silver paper in one of the faces of the little tank, we prevent the ray of light cross the sample. The idea is to measure only the light produced by the sample, not the “crossing light”.<br />
<br />
We didn’t obtain any result, but that was probably because the spectrophotometer has been designed to detect a very located light ray, not a difused light produced by a bioluminiscent sample.<br />
<br />
===SPECTROFLUORIMETER===<br />
<br />
<br />
[[Image:Igem9.JPG|thumb|center|500 px|]]<br />
<br />
[[Image:MedidafluorimetroVII.jpg|thumb|right|315 px|]]<br />
<br />
[[Image:MedidafluorimetroVI.jpg|thumb|left|315 px|]]<br />
<br />
[[Image:Igem13.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem17.JPG|thumb|left|315 px|]]<br />
<br />
Spectrofluorimeter measures the fluorescence of a sample. That’s because it has the same problem of the spectrophotometer. However, we found that it’s more sensible (it detects a great quantity of noise). So we thought it could be a more proper machine to our purposes.<br />
<br />
We designed a similar experiment, covering the place where the ray of light is emited, in order to measure only the bioluminiscence produced by our yeasts.<br />
<br />
We didn’t obtain any result. But we were worried about the speed of the reaction another time. Then, we decided to rule out the possibility as we did it with the GelDoc: starting the measure before adding the alkaline input.<br />
But this machine was different, so we designed a different experiment.<br />
<br />
We found a hole (normaly closed) in the tap, just uppon the the place where the sample is. Using a piece of termaflex, we crossed it with the pippete, and put it in the hole, isolating the overture and preventing light got in and artefact our result. Another time, that was extremely acurate, and when we closed the door, the tip went exactly to the point where our sample was placed.<br />
This way, we started to measure before adding the input. Next, we pulled out hte 30 microliters of KOH in the little tank. We got depressed when we didn’t obtain results. But for this time, we were in September, and the luminometer was available for us.<br />
<br />
In some days, our hard work was going to give us nice surprises.<br><br><br />
<br />
===LUMINOMETER===<br />
<br />
At last, we found a luminometer at Instituto de química molecular aplicada at UPV. Luminometers are more sensible and have more precision than espectrophotometer and espectrofluorimeter. Luminometer is ideal to work with aequorin, but was difficult to us to find one (we were looking for one and found two ^^).<br />
<br />
There are two types of luminometers: continuous and discontinuous. The discontinuous make punctual measures, in our case every 30 seconds. The continuous measures continuously, every second. Is important to note that we use two different luminometer, provided by different manufacturers. For this reasons we can't compare directly the results obtained with one luminometer with the results of the other. According this, when we only compare results in the same graph if they were obtained with the same luminometer. However, an increase (or not) in the luminosity, means the same at two luminometers and the experiments are complementary and reaffirms our conclusions. <br />
<br />
Each luminometer has its own protocol.<br />
<br />
First, we work with a discontinous luminometer. It measures every 30 seconds. We make a lot of measurements, trying to optimize the electrical input with the light generation. It's connected to a computer, where we see the value of luminescence. To measure luminescence, luminometer have a Elisa plate, where we put our yeasts. After, we introduce the Elisa plate into luminometer and click Start on computer. After 15 seconds we have the measure of luminosity.<br />
<br />
After, in the same department, we used a continuous luminometer. This is better because measures instantly, every second and the results obtained are more reliable. With this two luminometer we make the caracterization of ''Aequorin'' and obtained the results that demonstrate that we were right. WE CAN CREATE A CELL-BASED BIOSCREEN. Continuous luminometer have a cuvette where we put the cells. The cuvette must be very closed. We devise a system to applicate the electrical stimulus when the cuvette is closed. This luminometer also have a computer, but it was very old!<br />
<br />
[[Image:HiTech! val.jpg|center|315 px|]]<br />
<br />
==Protocols==<br />
===Measurement of citoplasmic Ca<sup>2+</sup> increase in <i>S. cerevisiae</i>===<br />
<br />
<br />
Modified from the original Denis and Cyert (2002) JCB 156; 29-34. <br />
<br />
'''Material'''<br />
* pEVP11[AEQ] plasmid: apoaequorina expression (Batiza et al.(1996) J.Biol.Chem. 271: 23357-62). <br />
* Coelenterazine solution: Diluted coelenterazine until 590μM in satured N2 metanol. This compound is extremely photosensible and it's inhibited by O<sup>2</sup>. Kept at –20ºC. <br />
** Note: We bought Coelenterazine, Native (CLZn) 50 μg Ref. C-2230 de SIGMA. We put N2 gas into metanol during 5 minutes, and we added inmediately 200μL to the 50μg of coelenterazine. <br />
<br />
* Luminometer. <br />
* Luminometer tubes and ELISA plaques. <br />
<br />
'''Procedure'''<br />
# We recieved pEVP11[AEQ] aequorin transformed yeast from Joaquin Arinyo. <br />
# We let growing up o/n in SD lacking Leu medium to maintain plasmid expression. <br />
# After incubation, measure OD a 660nm y calculate the necessary volum to obtain in 250μL a final OD of 1,8. Put that volum into an eppendorf tube with a hole in its tap. <br />
# Centrifugate 1 minute at 13000rpm. <br />
# Discard the supernatant. <br />
# Resuspend the pellet into 250μL of fresh medium with coelenterazine 2μM (aprox. 3,5μL of coelenterazinestock solution / μL de medio). <br />
# Incubate during 5,5 horas at ambient temperature, in agitation and keeping in the darkness. <br />
# Centrifugate 1 minute at 13000rpm. Discard the supernatant and resuspend in SD lacking Leu fresh medium without coelenterazine (see the proper volum below *). <br />
# Wait 15 min (yeast luminiscence is increased due to a peak of Ca2+ is induced by the glucose (Nakajimashimada et al. (1991) PNAS 88; 6878-82). <br />
# Measure basal luminiscence during 15 minutes. <br />
# Add the correct reactive volum to induce luminiscence. <br />
<br />
In the case of alcaline induction: <br />
<br />
8. Add 170μL of medium. <br />
<br />
9. Add 30μL of KOH 100mM. <br />
<br />
Other stress types: <br />
<br />
*NaCl: 30μL NaCl 5M (0,75M final). <br />
*CaCl<sub>2</sub>: 30μL CaCl<sub>2</sub> 1.33M (200mM final). <br />
*KCl: 30μL KCl 100mM. <br />
<br />
Note: yeasts should be treated sequentialy and in the same way to obtain reproducible results.<br />
<br />
===Preparing inserts by PCR=== <br />
<br />
Total DNA was extracted from our yeast strains.<br><br />
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br><br />
<br />
And our oligos (EcoRI and XbaI sites in bold) were:<br><br />
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br><br />
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br><br />
<br />
<br />
PCR was conducted as follows:<br><br />
<br />
<ol>A first denaturation cycle<br />
<br />
<ol>94º 3min</ol><br />
<br />
Followed by 30 amplification cycles: <br />
<br />
<ol>94º 30s<br><br />
<br />
55º 1min<br><br />
<br />
72º 1min<br></ol><br />
<br />
And a final extension step:<br />
<br />
<ol>72º 7min</ol><br />
<br />
<br />
<br />
[[Image:Gelaeq.JPG]]<br />
<br />
Results:<br><br />
<br />
1 = wt (1 microlitre)<br><br />
2 = wt (2 microlitres)<br><br />
3 = Cch1 (1 microlitre)<br><br />
4 = Mid1 (1 microlitre)<br><br />
5 = Negative Control<br><br />
6 = Possitive Control<br><br />
(We used the same MWM)<br><br />
<br />
Amplicon has 600 pb's.<br />
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> <br />
<br />
Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br><br />
<br />
===Preparing vectors===<br />
<br />
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL1-Gold Ultracompetent Cells of..... We selected transformed cells in a LB + ampicillin medium plaques. <br><br />
<br />
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br><br />
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br><br />
<br />
<br />
===Ligating BioBricks into plasmids===<br />
<br />
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br><br />
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br><br />
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br><br />
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ExperimentalTeam:Valencia/WetLab/YeastTeam/Experimental2009-10-20T22:53:58Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
__NOTOC__<br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:700px"><br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<center> <br />
{| <br />
!Methods<br />
!Protocols<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#GELDOC|GelDoc]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Measurement of citoplasmic Ca2+ increase in S. cerevisiae|Citoplasmic Ca<sup>2+</sup> burst]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#PIPPETE ENLARGER|Pippete Enlarger]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing inserts by PCR|BioBrick PCR protocol]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROPHOTOMETER|Spectrophotometer]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing vectors|Preparing vectors]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROFLUORIMETER|Spectrofluorimeter]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Ligating BioBricks into plasmids|Ligation]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#LUMINOMETER|Luminometer]]<br />
|-<br />
|width="200px"| <br />
|width="200px"| <br />
|}<br />
</center><br><br />
=='''Experimental methods'''==<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
To make measurements properly and determinate luminiscence levels, we needed a luminometer. But we couldn’t use one before September. So, if we didn’t want to waste our limited time, we decided to try with other machines.<br />
<br />
This way, we had dt ideas, and we thought a GelDoc camera, an espectophotometer and a espectofluorimeter could be useful for us, at least to determinate the presence/absence of the luminiscence. <br />
<br />
===GELDOC===<br />
<br />
[[Image:Igem2b.JPG|center|400 px|]]<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px"><br />
<br />
That was the first idea we got. It consisted to try to capture the luminiscence produced by our yeast with the camera that is normaly used to take gel photos. We thought that if we increased exposure time, we could acumulate enough luminiscence produced in time to see it, at the photo. <br />
<br />
We put our yeast after the different steps of our protocol in a multi-hole plaque and add the alcaline input. Fastly, we used to close the GelDoc door, but we had doubts about the velocity of the response, and we couldn’t be inside the GelDoc to start the measure at the same time we make the input. In order to make sure our yeasts weren’t making light too fast, we designed a very simple but precise mechanism. We called it PippeteEnlarger.<br />
<br />
===PIPPETE ENLARGER===<br />
<br />
[[Image:Igem1.JPG|thumb|center|500 px|]]<br />
<br />
The Pippete Enlarger is easy to assemble using a pippete, a thin tube and two pippete tips: one has to fit into the tub (so size tip deppends on size tub) and the another one has to be the proper tip to take the volume we want.<br />
<br />
So, we will explain the mechanisme in the way we did it. We needed to make an input of 30 microliters of KOH without open the door. We had to enlarge the pippete to put the tip in the correct hole with the closed door and trigger the mechanism out of the GelDoc. We decided to full the tube with KOH, make pressure in one of the extrems of the tube, preventing by capilarity the liquid go away, and connect the pippete with an intermediary tip in the other extrem (the volume had to be already prefixed). The extrem we were pressing could be released at this point, so we could put the correct tip (in our chase, a yellow tip) to catch the desired volume. Before to be loaded with 30 microliters of KOH, we fixed the tip in the hole we wanted, we closed the door and carry on the pippete outside the GelDoc.<br />
<br />
We were ready to start the measurement, making sure we increased enough the exposure time. Then, we pulled out the 30 microlitres actioning the pippete. It was surprisingly acurate!!! The volume was almost exactly, with 1 or 2 microliters of error. We dind’t got any result.<br />
We could rule out, then, the possibility that our yeasts produce light meanwhile we were putting them in the GelDoc, or we were closing the door...<br />
<br />
GelDoc camera was not an efficient way to detect our luminiscence, so we thought perhaps a spectrophotometer was a more addient machine.<br />
<br />
===SPECTROPHOTOMETER===<br />
<br />
[[Image:Igem19.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem8.JPG|thumb|left|315 px|]]<br />
<br />
Altough an spectophotometer is a machine that measures how cloudy a sample is, by emitting a ray of light, we can “trick” the machine. Sticking a piece of silver paper in one of the faces of the little tank, we prevent the ray of light cross the sample. The idea is to measure only the light produced by the sample, not the “crossing light”.<br />
<br />
We didn’t obtain any result, but that was probably because the spectrophotometer has been designed to detect a very located light ray, not a difused light produced by a bioluminiscent sample.<br />
<br />
===SPECTROFLUORIMETER===<br />
<br />
<br />
[[Image:Igem9.JPG|thumb|center|500 px|]]<br />
<br />
[[Image:MedidafluorimetroVII.jpg|thumb|right|315 px|]]<br />
<br />
[[Image:MedidafluorimetroVI.jpg|thumb|left|315 px|]]<br />
<br />
[[Image:Igem13.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem17.JPG|thumb|left|315 px|]]<br />
<br />
Spectrofluorimeter measures the fluorescence of a sample. That’s because it has the same problem of the spectrophotometer. However, we found that it’s more sensible (it detects a great quantity of noise). So we thought it could be a more proper machine to our purposes.<br />
<br />
We designed a similar experiment, covering the place where the ray of light is emited, in order to measure only the bioluminiscence produced by our yeasts.<br />
<br />
We didn’t obtain any result. But we were worried about the speed of the reaction another time. Then, we decided to rule out the possibility as we did it with the GelDoc: starting the measure before adding the alkaline input.<br />
But this machine was different, so we designed a different experiment.<br />
<br />
We found a hole (normaly closed) in the tap, just uppon the the place where the sample is. Using a piece of termaflex, we crossed it with the pippete, and put it in the hole, isolating the overture and preventing light got in and artefact our result. Another time, that was extremely acurate, and when we closed the door, the tip went exactly to the point where our sample was placed.<br />
This way, we started to measure before adding the input. Next, we pulled out hte 30 microliters of KOH in the little tank. We got depressed when we didn’t obtain results. But for this time, we were in September, and the luminometer was available for us.<br />
<br />
In some days, our hard work was going to give us nice surprises.<br><br><br />
<br />
===LUMINOMETER===<br />
<br />
At last, we found a luminometer at Instituto de química molecular aplicada at UPV. Luminometers are more sensible and have more precision than espectrophotometer and espectrofluorimeter. Luminometer is ideal to work with aequorin, but was difficult to us to find one (we were looking for one and found two ^^).<br />
<br />
There are two types of luminometers: continuous and discontinuous. The discontinuous make punctual measures, in our case every 30 seconds. The continuous measures continuously, every second. Is important to note that we use two different luminometer, provided by different manufacturers. For this reasons we can't compare directly the results obtained with one luminometer with the results of the other. According this, when we only compare results in the same graph if they were obtained with the same luminometer. However, an increase (or not) in the luminosity, means the same at two luminometers and the experiments are complementary and reaffirms our conclusions. <br />
<br />
Each luminometer has its own protocol.<br />
<br />
First, we work with a discontinous luminometer. It measures every 30 seconds. We make a lot of measurements, trying to optimize the electrical input with the light generation. It's connected to a computer, where we see the value of luminescence. To measure luminescence, luminometer have a Elisa plate, where we put our yeasts. After, we introduce the Elisa plate into luminometer and click Start on computer. After 15 seconds we have the measure of luminosity.<br />
<br />
After, in the same department, we used a continuous luminometer. This is better because measures instantly, every second and the results obtained are more reliable. With this two luminometer we make the caracterization of ''Aequorin'' and obtained the results that demonstrate that we were right. WE CAN CREATE A CELL-BASED BIOSCREEN. Continuous luminometer have a cuvette where we put the cells. The cuvette must be very closed. We devise a system to applicate the electrical stimulus when the cuvette is closed. This luminometer also have a computer, but it was very old!<br />
<br />
[[Image:HiTech! val.jpg|315 px|]]<br />
<br />
==Protocols==<br />
===Measurement of citoplasmic Ca<sup>2+</sup> increase in <i>S. cerevisiae</i>===<br />
<br />
<br />
Modified from the original Denis and Cyert (2002) JCB 156; 29-34. <br />
<br />
'''Material'''<br />
* pEVP11[AEQ] plasmid: apoaequorina expression (Batiza et al.(1996) J.Biol.Chem. 271: 23357-62). <br />
* Coelenterazine solution: Diluted coelenterazine until 590μM in satured N2 metanol. This compound is extremely photosensible and it's inhibited by O<sup>2</sup>. Kept at –20ºC. <br />
** Note: We bought Coelenterazine, Native (CLZn) 50 μg Ref. C-2230 de SIGMA. We put N2 gas into metanol during 5 minutes, and we added inmediately 200μL to the 50μg of coelenterazine. <br />
<br />
* Luminometer. <br />
* Luminometer tubes and ELISA plaques. <br />
<br />
'''Procedure'''<br />
# We recieved pEVP11[AEQ] aequorin transformed yeast from Joaquin Arinyo. <br />
# We let growing up o/n in SD lacking Leu medium to maintain plasmid expression. <br />
# After incubation, measure OD a 660nm y calculate the necessary volum to obtain in 250μL a final OD of 1,8. Put that volum into an eppendorf tube with a hole in its tap. <br />
# Centrifugate 1 minute at 13000rpm. <br />
# Discard the supernatant. <br />
# Resuspend the pellet into 250μL of fresh medium with coelenterazine 2μM (aprox. 3,5μL of coelenterazinestock solution / μL de medio). <br />
# Incubate during 5,5 horas at ambient temperature, in agitation and keeping in the darkness. <br />
# Centrifugate 1 minute at 13000rpm. Discard the supernatant and resuspend in SD lacking Leu fresh medium without coelenterazine (see the proper volum below *). <br />
# Wait 15 min (yeast luminiscence is increased due to a peak of Ca2+ is induced by the glucose (Nakajimashimada et al. (1991) PNAS 88; 6878-82). <br />
# Measure basal luminiscence during 15 minutes. <br />
# Add the correct reactive volum to induce luminiscence. <br />
<br />
In the case of alcaline induction: <br />
<br />
8. Add 170μL of medium. <br />
<br />
9. Add 30μL of KOH 100mM. <br />
<br />
Other stress types: <br />
<br />
*NaCl: 30μL NaCl 5M (0,75M final). <br />
*CaCl<sub>2</sub>: 30μL CaCl<sub>2</sub> 1.33M (200mM final). <br />
*KCl: 30μL KCl 100mM. <br />
<br />
Note: yeasts should be treated sequentialy and in the same way to obtain reproducible results.<br />
<br />
===Preparing inserts by PCR=== <br />
<br />
Total DNA was extracted from our yeast strains.<br><br />
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br><br />
<br />
And our oligos (EcoRI and XbaI sites in bold) were:<br><br />
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br><br />
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br><br />
<br />
<br />
PCR was conducted as follows:<br><br />
<br />
<ol>A first denaturation cycle<br />
<br />
<ol>94º 3min</ol><br />
<br />
Followed by 30 amplification cycles: <br />
<br />
<ol>94º 30s<br><br />
<br />
55º 1min<br><br />
<br />
72º 1min<br></ol><br />
<br />
And a final extension step:<br />
<br />
<ol>72º 7min</ol><br />
<br />
<br />
<br />
[[Image:Gelaeq.JPG]]<br />
<br />
Results:<br><br />
<br />
1 = wt (1 microlitre)<br><br />
2 = wt (2 microlitres)<br><br />
3 = Cch1 (1 microlitre)<br><br />
4 = Mid1 (1 microlitre)<br><br />
5 = Negative Control<br><br />
6 = Possitive Control<br><br />
(We used the same MWM)<br><br />
<br />
Amplicon has 600 pb's.<br />
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> <br />
<br />
Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br><br />
<br />
===Preparing vectors===<br />
<br />
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL1-Gold Ultracompetent Cells of..... We selected transformed cells in a LB + ampicillin medium plaques. <br><br />
<br />
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br><br />
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br><br />
<br />
<br />
===Ligating BioBricks into plasmids===<br />
<br />
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br><br />
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br><br />
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br><br />
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ExperimentalTeam:Valencia/WetLab/YeastTeam/Experimental2009-10-20T22:12:50Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
__NOTOC__<br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:700px"><br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<center> <br />
{| <br />
!Methods<br />
!Protocols<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#GELDOC|GelDoc]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Measurement of citoplasmic Ca2+ increase in S. cerevisiae|Citoplasmic Ca<sup>2+</sup> burst]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#PIPPETE ENLARGER|Pippete Enlarger]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing inserts by PCR|BioBrick PCR protocol]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROPHOTOMETER|Spectrophotometer]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing vectors|Preparing vectors]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROFLUORIMETER|Spectrofluorimeter]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Ligating BioBricks into plasmids|Ligation]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#LUMINOMETER|Luminometer]]<br />
|-<br />
|width="200px"| <br />
|width="200px"| <br />
|}<br />
</center><br><br />
=='''Experimental methods'''==<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
To make measurements properly and determinate luminiscence levels, we needed a luminometer. But we couldn’t use one before September. So, if we didn’t want to waste our limited time, we decided to try with other machines.<br />
<br />
This way, we had dt ideas, and we thought a GelDoc camera, an espectophotometer and a espectofluorimeter could be useful for us, at least to determinate the presence/absence of the luminiscence. <br />
<br />
===GELDOC===<br />
<br />
[[Image:Igem2b.JPG|center|400 px|]]<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px"><br />
<br />
That was the first idea we got. It consisted to try to capture the luminiscence produced by our yeast with the camera that is normaly used to take gel photos. We thought that if we increased exposure time, we could acumulate enough luminiscence produced in time to see it, at the photo. <br />
<br />
We put our yeast after the different steps of our protocol in a multi-hole plaque and add the alcaline input. Fastly, we used to close the GelDoc door, but we had doubts about the velocity of the response, and we couldn’t be inside the GelDoc to start the measure at the same time we make the input. In order to make sure our yeasts weren’t making light too fast, we designed a very simple but precise mechanism. We called it PippeteEnlarger.<br />
<br />
===PIPPETE ENLARGER===<br />
<br />
[[Image:Igem1.JPG|thumb|center|500 px|]]<br />
<br />
The Pippete Enlarger is easy to assemble using a pippete, a thin tube and two pippete tips: one has to fit into the tub (so size tip deppends on size tub) and the another one has to be the proper tip to take the volume we want.<br />
<br />
So, we will explain the mechanisme in the way we did it. We needed to make an input of 30 microliters of KOH without open the door. We had to enlarge the pippete to put the tip in the correct hole with the closed door and trigger the mechanism out of the GelDoc. We decided to full the tube with KOH, make pressure in one of the extrems of the tube, preventing by capilarity the liquid go away, and connect the pippete with an intermediary tip in the other extrem (the volume had to be already prefixed). The extrem we were pressing could be released at this point, so we could put the correct tip (in our chase, a yellow tip) to catch the desired volume. Before to be loaded with 30 microliters of KOH, we fixed the tip in the hole we wanted, we closed the door and carry on the pippete outside the GelDoc.<br />
<br />
We were ready to start the measurement, making sure we increased enough the exposure time. Then, we pulled out the 30 microlitres actioning the pippete. It was surprisingly acurate!!! The volume was almost exactly, with 1 or 2 microliters of error. We dind’t got any result.<br />
We could rule out, then, the possibility that our yeasts produce light meanwhile we were putting them in the GelDoc, or we were closing the door...<br />
<br />
GelDoc camera was not an efficient way to detect our luminiscence, so we thought perhaps a spectrophotometer was a more addient machine.<br />
<br />
===SPECTROPHOTOMETER===<br />
<br />
[[Image:Igem19.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem8.JPG|thumb|left|315 px|]]<br />
<br />
Altough an spectophotometer is a machine that measures how cloudy a sample is, by emitting a ray of light, we can “trick” the machine. Sticking a piece of silver paper in one of the faces of the little tank, we prevent the ray of light cross the sample. The idea is to measure only the light produced by the sample, not the “crossing light”.<br />
<br />
We didn’t obtain any result, but that was probably because the spectrophotometer has been designed to detect a very located light ray, not a difused light produced by a bioluminiscent sample.<br />
<br />
===SPECTROFLUORIMETER===<br />
<br />
<br />
[[Image:Igem9.JPG|thumb|center|500 px|]]<br />
<br />
[[Image:MedidafluorimetroVII.jpg|thumb|right|315 px|]]<br />
<br />
[[Image:MedidafluorimetroVI.jpg|thumb|left|315 px|]]<br />
<br />
[[Image:Igem13.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem17.JPG|thumb|left|315 px|]]<br />
<br />
Spectrofluorimeter measures the fluorescence of a sample. That’s because it has the same problem of the spectrophotometer. However, we found that it’s more sensible (it detects a great quantity of noise). So we thought it could be a more proper machine to our purposes.<br />
<br />
We designed a similar experiment, covering the place where the ray of light is emited, in order to measure only the bioluminiscence produced by our yeasts.<br />
<br />
We didn’t obtain any result. But we were worried about the speed of the reaction another time. Then, we decided to rule out the possibility as we did it with the GelDoc: starting the measure before adding the alkaline input.<br />
But this machine was different, so we designed a different experiment.<br />
<br />
We found a hole (normaly closed) in the tap, just uppon the the place where the sample is. Using a piece of termaflex, we crossed it with the pippete, and put it in the hole, isolating the overture and preventing light got in and artefact our result. Another time, that was extremely acurate, and when we closed the door, the tip went exactly to the point where our sample was placed.<br />
This way, we started to measure before adding the input. Next, we pulled out hte 30 microliters of KOH in the little tank. We got depressed when we didn’t obtain results. But for this time, we were in September, and the luminometer was available for us.<br />
<br />
In some days, our hard work was going to give us nice surprises.<br><br><br />
<br />
===LUMINOMETER===<br />
<br />
At last, we found a luminometer at Instituto de química molecular aplicada at UPV. First, we work with a discontinous luminometer. It measures every 30 seconds. Now, WE HAVE RESULTS! Luminometer have enough sensibility. We were very happy!<br />
<br />
We make a lot of measurements, trying to optimize the electrical input with the light generation. After, in the same department, we used a continuous luminometer. This is better because measures instantly, every second and the results obtained are more reliable. With this two luminometer we make the caracterization of ''Aequorin'' and obtained the results that demonstrate that we were right. WE CAN CREATE A CELL-BASED BIOSCREEN.<br />
<br />
Luminometers are easy to use. Discontinuous luminometer is connected to a computer, where we see the value of luminescence. To measure luminescence, luminometer have a Elisa plate, where we put our yeasts. After, we introduce the Elisa plate into luminometer and click Start on computer. After 15 seconds we have the measure of luminosity.<br />
<br />
Continuous luminometer have a cuvette where we put the cells. The cuvette must be very closed. We devise a system to applicate the electrical stimulus when the cuvette is closed. This luminometer also have a computer, but it was very old!<br />
<br />
[[Image:HiTech! val.jpg|315 px|]]<br />
<br />
==Protocols==<br />
===Measurement of citoplasmic Ca<sup>2+</sup> increase in <i>S. cerevisiae</i>===<br />
<br />
<br />
Modified from the original Denis and Cyert (2002) JCB 156; 29-34. <br />
<br />
'''Material'''<br />
* pEVP11[AEQ] plasmid: apoaequorina expression (Batiza et al.(1996) J.Biol.Chem. 271: 23357-62). <br />
* Coelenterazine solution: Diluted coelenterazine until 590μM in satured N2 metanol. This compound is extremely photosensible and it's inhibited by O<sup>2</sup>. Kept at –20ºC. <br />
** Note: We bought Coelenterazine, Native (CLZn) 50 μg Ref. C-2230 de SIGMA. We put N2 gas into metanol during 5 minutes, and we added inmediately 200μL to the 50μg of coelenterazine. <br />
<br />
* Luminometer. <br />
* Luminometer tubes and ELISA plaques. <br />
<br />
'''Procedure'''<br />
# We recieved pEVP11[AEQ] aequorin transformed yeast from Joaquin Arinyo. <br />
# We let growing up o/n in SD lacking Leu medium to maintain plasmid expression. <br />
# After incubation, measure OD a 660nm y calculate the necessary volum to obtain in 250μL a final OD of 1,8. Put that volum into an eppendorf tube with a hole in its tap. <br />
# Centrifugate 1 minute at 13000rpm. <br />
# Discard the supernatant. <br />
# Resuspend the pellet into 250μL of fresh medium with coelenterazine 2μM (aprox. 3,5μL of coelenterazinestock solution / μL de medio). <br />
# Incubate during 5,5 horas at ambient temperature, in agitation and keeping in the darkness. <br />
# Centrifugate 1 minute at 13000rpm. Discard the supernatant and resuspend in SD lacking Leu fresh medium without coelenterazine (see the proper volum below *). <br />
# Wait 15 min (yeast luminiscence is increased due to a peak of Ca2+ is induced by the glucose (Nakajimashimada et al. (1991) PNAS 88; 6878-82). <br />
# Measure basal luminiscence during 15 minutes. <br />
# Add the correct reactive volum to induce luminiscence. <br />
<br />
In the case of alcaline induction: <br />
<br />
8. Add 170μL of medium. <br />
<br />
9. Add 30μL of KOH 100mM. <br />
<br />
Other stress types: <br />
<br />
*NaCl: 30μL NaCl 5M (0,75M final). <br />
*CaCl<sub>2</sub>: 30μL CaCl<sub>2</sub> 1.33M (200mM final). <br />
*KCl: 30μL KCl 100mM. <br />
<br />
Note: yeasts should be treated sequentialy and in the same way to obtain reproducible results.<br />
<br />
===Preparing inserts by PCR=== <br />
<br />
Total DNA was extracted from our yeast strains.<br><br />
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br><br />
<br />
And our oligos (EcoRI and XbaI sites in bold) were:<br><br />
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br><br />
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br><br />
<br />
<br />
PCR was conducted as follows:<br><br />
<br />
<ol>A first denaturation cycle<br />
<br />
<ol>94º 3min</ol><br />
<br />
Followed by 30 amplification cycles: <br />
<br />
<ol>94º 30s<br><br />
<br />
55º 1min<br><br />
<br />
72º 1min<br></ol><br />
<br />
And a final extension step:<br />
<br />
<ol>72º 7min</ol><br />
<br />
<br />
<br />
[[Image:Gelaeq.JPG]]<br />
<br />
Results:<br><br />
<br />
1 = wt (1 microlitre)<br><br />
2 = wt (2 microlitres)<br><br />
3 = Cch1 (1 microlitre)<br><br />
4 = Mid1 (1 microlitre)<br><br />
5 = Negative Control<br><br />
6 = Possitive Control<br><br />
(We used the same MWM)<br><br />
<br />
Amplicon has 600 pb's.<br />
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> <br />
<br />
Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br><br />
<br />
===Preparing vectors===<br />
<br />
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL1-Gold Ultracompetent Cells of..... We selected transformed cells in a LB + ampicillin medium plaques. <br><br />
<br />
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br><br />
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br><br />
<br />
<br />
===Ligating BioBricks into plasmids===<br />
<br />
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br><br />
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br><br />
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br><br />
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T22:06:37Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div style="position:relative; top:-5px; left:70px; width:700px" align="justify"><br />
<br><br />
==Experimental results==<br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity. we choose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
===Chemical input===<br />
<br><br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, after a lot of different trials, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graph, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we preferred to make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one knock out mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another knock out mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Although every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The absence of the -OH group prevents the opening of calcium channels and makes yeast produce no light.<br />
<br />
<br />
We wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emitted light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emission under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of KOH added (from 15 microliters to 120) is related to the luminiscent peak. Although there is not linearly proportional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterising the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at certain times (arrows), we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
'''We use two luminometers''', one luminometer discontinuous and the other is continuous. Each luminometer uses different units, depends on the manufacturer. For this reasons we can't compare directly the results obtained with one luminometer with the results of the other. According this, when we only compare results in the same graph if they were obtained with the same luminometer. However, an increase (or not) in the luminosity, means the same at two luminometers and the experiments are complementary and reaffirms our conclusions.<br />
<br />
We reproduced the mentionated Viladevall et al's protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produced in a very similar way. We tried with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]</div>Guimar3http://2009.igem.org/Team:Valencia/HumanTeam:Valencia/Human2009-10-20T21:16:02Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br><br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:650px"><br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<div align="justify" style="position:relative; top:-5px; left:0; width:693px"><br />
<br />
<html><div style="width:425px;text-align:left" id="__ss_2299319"><a style="font:14px Helvetica,Arial,Sans-serif;display:block;margin:12px 0 3px 0;text-decoration:underline;" href="https://static.igem.org/mediawiki/2009/0/0d/Sins,_Ethics_and_Biology.pdf" title="Sins, Ethics And Biology - A Comprehensive Approach">Sins, Ethics And Biology - A Comprehensive Approach</a><object style="margin:0px" width="680" height="568"><param name="movie" value="http://static.slidesharecdn.com/swf/ssplayer2.swf?doc=sinsethicsandbiology-acomprehensiveapproach-091020160529-phpapp02&stripped_title=sins-ethics-and-biology-a-comprehensive-approach" /><param name="allowFullScreen" value="true"/><param name="allowScriptAccess" value="always"/><embed src="http://static.slidesharecdn.com/swf/ssplayer2.swf?doc=sinsethicsandbiology-acomprehensiveapproach-091020160529-phpapp02&stripped_title=sins-ethics-and-biology-a-comprehensive-approach" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="680" height="568"></embed></object></div></html><br />
<!-- [[Image:Portada teamvalhp.jpg|center|500 px]] --><br />
<br><br />
Synthetic Biology is a revolutionary scientific discipline. The ability to design and construct new biological systems with useful properties opens up a challenging scenario for the technological development of humanity. However, new science needs new regulation, and Human Practices dealing with Synthetic Biology are needed in order to have an ethical, legal and regulatory framework allowing the development of this novel scientific area.<br />
<br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2009/0/0d/Sins,_Ethics_and_Biology.pdf" target="_blank"> <b>Sins, Ethics and Biology, a Comprehensive Approach</b> </a> </html> is more than a review on Human Practices and Synthetic Biology: it emcompasses a classical review of scientific reports on Human Practices; the first comparative analysis of previous iGEM HP projects; interviews with well known experts; and the largest survey on ethics and synthetic biology ever made.<br />
<br />
The complete report will be edited as a book and you will be able to get it at bubok.com (more information coming soon) oras a free pdf file and its goal is to help researchers and people interested in SB to assess the new risks, possibilities, and ethical issues of this discipline.<br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:-15px; width:900px"><br />
[[Image:Pàgina 7 (esquerra)val.jpg|left|340 px]] [[Image:Pàgina 8 (dreta)val.jpg|right|340 px]]<br />
</div><br />
<br><br><br><br><br><br />
<br />
[[Image:Pubmed botonet.png|left|150 px]][https://2009.igem.org/Team:Valencia/Human/Review '''The Review'''] : We have prepared a classical review on scientific reports about Synthetic Biology and its ethical consequences. With more thant 30 references, you will get a complete overview of the present status of this new emerging field. Ideas of well-known scientist about different topics are gathered here: Definition of SB, The engineering principles of the field, Applications, new chemically different biomolecules, ethical problems with genetic engineering, Europe and USA and teaching and learning SB.<br />
<br><br><br />
[[Image:Igem botonets.png|left|150 px]]'''Human Practices: iGEM 2005-2008''': We are the first to study all the reports on previous iGEM editions, and gathered their conclusions in a single work. In this part of the book you will understand the ethical concerns of iGEM participants and its evolution during the whole life of the competition.<br />
<br><br><br><br><br><br />
[[Image:Botonet Survey.jpg|left|150 px]][https://2009.igem.org/Team:Valencia/Human/Survey '''The Survey''']: With more than '''1200 answers''' we have made the largest survey on Synthetic Biology of the history. It was adressed to a very different public including scientific and no scientific people, people from inside and outside the iGEM, and Students and Teachers from all over the world. To encourage iGEM participants to fill our survey we prepared [https://2009.igem.org/Team:Valencia/Human_Practice/Medalls medals] that teams can show in their wiki according to their degree of participation. This Survey has also helped us to get the largest collection of Synthetic Biology's [https://2009.igem.org/Team:Valencia/Definitions definitions].<br />
<br />
<br><br><br />
[[Image:Botonet Experts.jpg| 150 px | left]][https://2009.igem.org/Team:Valencia/Human/Experts '''The Experts''']: We have personally interviewed two well-known experts, Antoine Danchin and Markus Schmidt to gather their opinions about every aspect of Synthetic Biology. They have also filled our survey so you can compare your answers to theirs, how close are your ideas to the ones of the experts?<br />
</div></div>Guimar3http://2009.igem.org/File:Pubmed_botonet.pngFile:Pubmed botonet.png2009-10-20T21:15:44Z<p>Guimar3: </p>
<hr />
<div></div>Guimar3http://2009.igem.org/File:Igem_botonets.pngFile:Igem botonets.png2009-10-20T21:07:51Z<p>Guimar3: </p>
<hr />
<div></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ExperimentalTeam:Valencia/WetLab/YeastTeam/Experimental2009-10-20T19:59:29Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
__NOTOC__<br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:700px"><br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<center> <br />
{| <br />
!Methods<br />
!Protocols<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#GELDOC|GelDoc]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Measurement of citoplasmic Ca2+ increase in S. cerevisiae|Citoplasmic Ca<sup>2+</sup> burst]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#PIPPETE ENLARGER|Pippete Enlarger]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing inserts by PCR|BioBrick PCR protocol]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROPHOTOMETER|Spectrophotometer]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing vectors|Preparing vectors]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROFLUORIMETER|Spectrofluorimeter]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Ligating BioBricks into plasmids|Ligation]]<br />
|-<br />
|width="200px"| <br />
|width="200px"| <br />
|}<br />
</center><br><br />
=='''Experimental methods'''==<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
To make measurements properly and determinate luminiscence levels, we needed a luminometer. But we couldn’t use one before September. So, if we didn’t want to waste our limited time, we decided to try with other machines.<br />
<br />
This way, we had dt ideas, and we thought a GelDoc camera, an espectophotometer and a espectofluorimeter could be useful for us, at least to determinate the presence/absence of the luminiscence. <br />
<br />
===GELDOC===<br />
<br />
[[Image:Igem2b.JPG|center|400 px|]]<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px"><br />
<br />
That was the first idea we got. It consisted to try to capture the luminiscence produced by our yeast with the camera that is normaly used to take gel photos. We thought that if we increased exposure time, we could acumulate enough luminiscence produced in time to see it, at the photo. <br />
<br />
We put our yeast after the different steps of our protocol in a multi-hole plaque and add the alcaline input. Fastly, we used to close the GelDoc door, but we had doubts about the velocity of the response, and we couldn’t be inside the GelDoc to start the measure at the same time we make the input. In order to make sure our yeasts weren’t making light too fast, we designed a very simple but precise mechanism. We called it PippeteEnlarger.<br />
<br />
===PIPPETE ENLARGER===<br />
<br />
[[Image:Igem1.JPG|thumb|center|500 px|]]<br />
<br />
The Pippete Enlarger is easy to assemble using a pippete, a thin tube and two pippete tips: one has to fit into the tub (so size tip deppends on size tub) and the another one has to be the proper tip to take the volume we want.<br />
<br />
So, we will explain the mechanisme in the way we did it. We needed to make an input of 30 microliters of KOH without open the door. We had to enlarge the pippete to put the tip in the correct hole with the closed door and trigger the mechanism out of the GelDoc. We decided to full the tube with KOH, make pressure in one of the extrems of the tube, preventing by capilarity the liquid go away, and connect the pippete with an intermediary tip in the other extrem (the volume had to be already prefixed). The extrem we were pressing could be released at this point, so we could put the correct tip (in our chase, a yellow tip) to catch the desired volume. Before to be loaded with 30 microliters of KOH, we fixed the tip in the hole we wanted, we closed the door and carry on the pippete outside the GelDoc.<br />
<br />
We were ready to start the measurement, making sure we increased enough the exposure time. Then, we pulled out the 30 microlitres actioning the pippete. It was surprisingly acurate!!! The volume was almost exactly, with 1 or 2 microliters of error. We dind’t got any result.<br />
We could rule out, then, the possibility that our yeasts produce light meanwhile we were putting them in the GelDoc, or we were closing the door...<br />
<br />
GelDoc camera was not an efficient way to detect our luminiscence, so we thought perhaps a spectrophotometer was a more addient machine.<br />
<br />
===SPECTROPHOTOMETER===<br />
<br />
[[Image:Igem19.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem8.JPG|thumb|left|315 px|]]<br />
<br />
Altough an spectophotometer is a machine that measures how cloudy a sample is, by emitting a ray of light, we can “trick” the machine. Sticking a piece of silver paper in one of the faces of the little tank, we prevent the ray of light cross the sample. The idea is to measure only the light produced by the sample, not the “crossing light”.<br />
<br />
We didn’t obtain any result, but that was probably because the spectrophotometer has been designed to detect a very located light ray, not a difused light produced by a bioluminiscent sample.<br />
<br />
===SPECTROFLUORIMETER===<br />
<br />
<br />
[[Image:Igem9.JPG|thumb|center|500 px|]]<br />
<br />
[[Image:MedidafluorimetroVII.jpg|thumb|right|315 px|]]<br />
<br />
[[Image:MedidafluorimetroVI.jpg|thumb|left|315 px|]]<br />
<br />
[[Image:Igem13.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem17.JPG|thumb|left|315 px|]]<br />
<br />
Spectrofluorimeter measures the fluorescence of a sample. That’s because it has the same problem of the spectrophotometer. However, we found that it’s more sensible (it detects a great quantity of noise). So we thought it could be a more proper machine to our purposes.<br />
<br />
We designed a similar experiment, covering the place where the ray of light is emited, in order to measure only the bioluminiscence produced by our yeasts.<br />
<br />
We didn’t obtain any result. But we were worried about the speed of the reaction another time. Then, we decided to rule out the possibility as we did it with the GelDoc: starting the measure before adding the alkaline input.<br />
But this machine was different, so we designed a different experiment.<br />
<br />
We found a hole (normaly closed) in the tap, just uppon the the place where the sample is. Using a piece of termaflex, we crossed it with the pippete, and put it in the hole, isolating the overture and preventing light got in and artefact our result. Another time, that was extremely acurate, and when we closed the door, the tip went exactly to the point where our sample was placed.<br />
This way, we started to measure before adding the input. Next, we pulled out hte 30 microliters of KOH in the little tank. We got depressed when we didn’t obtain results. But for this time, we were in September, and the luminometer was available for us.<br />
<br />
In some days, our hard work was going to give us nice surprises.<br><br><br />
<br />
===LUMINOMETER===<br />
<br />
At last, we found a luminometer at Instituto de química molecular aplicada at UPV. First, we work with a discontinous luminometer. It measures every 30 seconds. Now, WE HAVE RESULTS! Luminometer have enough sensibility. We were very happy!<br />
<br />
We make a lot of measurements, trying to optimize the electrical input with the light generation. After, in the same department, we used a continuous luminometer. This is better because measures instantly, every second and the results obtained are more reliable. With this two luminometer we make the caracterization of ''Aequorin'' and obtained the results that demonstrate that we were right. WE CAN CREATE A CELL-BASED BIOSCREEN.<br />
<br />
Luminometers are easy to use. Discontinuous luminometer is connected to a computer, where we see the value of luminescence. To measure luminescence, luminometer have a Elisa plate, where we put our yeasts. After, we introduce the Elisa plate into luminometer and click Start on computer. After 15 seconds we have the measure of luminosity.<br />
<br />
Continuous luminometer have a cuvette where we put the cells. The cuvette must be very closed. We devise a system to applicate the electrical stimulus when the cuvette is closed. This luminometer also have a computer, but it was very old!<br />
<br />
[[Image:HiTech! val.jpg]]<br />
<br />
==Protocols==<br />
===Measurement of citoplasmic Ca<sup>2+</sup> increase in <i>S. cerevisiae</i>===<br />
<br />
<br />
Modified from the original Denis and Cyert (2002) JCB 156; 29-34. <br />
<br />
'''Material'''<br />
* pEVP11[AEQ] plasmid: apoaequorina expression (Batiza et al.(1996) J.Biol.Chem. 271: 23357-62). <br />
* Coelenterazine solution: Diluted coelenterazine until 590μM in satured N2 metanol. This compound is extremely photosensible and it's inhibited by O<sup>2</sup>. Kept at –20ºC. <br />
** Note: We bought Coelenterazine, Native (CLZn) 50 μg Ref. C-2230 de SIGMA. We put N2 gas into metanol during 5 minutes, and we added inmediately 200μL to the 50μg of coelenterazine. <br />
<br />
* Luminometer. <br />
* Luminometer tubes and ELISA plaques. <br />
<br />
'''Procedure'''<br />
# We recieved pEVP11[AEQ] aequorin transformed yeast from Joaquin Arinyo. <br />
# We let growing up o/n in SD lacking Leu medium to maintain plasmid expression. <br />
# After incubation, measure OD a 660nm y calculate the necessary volum to obtain in 250μL a final OD of 1,8. Put that volum into an eppendorf tube with a hole in its tap. <br />
# Centrifugate 1 minute at 13000rpm. <br />
# Discard the supernatant. <br />
# Resuspend the pellet into 250μL of fresh medium with coelenterazine 2μM (aprox. 3,5μL of coelenterazinestock solution / μL de medio). <br />
# Incubate during 5,5 horas at ambient temperature, in agitation and keeping in the darkness. <br />
# Centrifugate 1 minute at 13000rpm. Discard the supernatant and resuspend in SD lacking Leu fresh medium without coelenterazine (see the proper volum below *). <br />
# Wait 15 min (yeast luminiscence is increased due to a peak of Ca2+ is induced by the glucose (Nakajimashimada et al. (1991) PNAS 88; 6878-82). <br />
# Measure basal luminiscence during 15 minutes. <br />
# Add the correct reactive volum to induce luminiscence. <br />
<br />
In the case of alcaline induction: <br />
<br />
8. Add 170μL of medium. <br />
<br />
9. Add 30μL of KOH 100mM. <br />
<br />
Other stress types: <br />
<br />
*NaCl: 30μL NaCl 5M (0,75M final). <br />
*CaCl<sub>2</sub>: 30μL CaCl<sub>2</sub> 1.33M (200mM final). <br />
*KCl: 30μL KCl 100mM. <br />
<br />
Note: yeasts should be treated sequentialy and in the same way to obtain reproducible results.<br />
<br />
===Preparing inserts by PCR=== <br />
<br />
Total DNA was extracted from our yeast strains.<br><br />
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br><br />
<br />
And our oligos (EcoRI and XbaI sites in bold) were:<br><br />
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br><br />
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br><br />
<br />
<br />
PCR was conducted as follows:<br><br />
<br />
<ol>A first denaturation cycle<br />
<br />
<ol>94º 3min</ol><br />
<br />
Followed by 30 amplification cycles: <br />
<br />
<ol>94º 30s<br><br />
<br />
55º 1min<br><br />
<br />
72º 1min<br></ol><br />
<br />
And a final extension step:<br />
<br />
<ol>72º 7min</ol><br />
<br />
<br />
<br />
[[Image:Gelaeq.JPG]]<br />
<br />
Results:<br><br />
<br />
1 = wt (1 microlitre)<br><br />
2 = wt (2 microlitres)<br><br />
3 = Cch1 (1 microlitre)<br><br />
4 = Mid1 (1 microlitre)<br><br />
5 = Negative Control<br><br />
6 = Possitive Control<br><br />
(We used the same MWM)<br><br />
<br />
Amplicon has 600 pb's.<br />
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> <br />
<br />
Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br><br />
<br />
===Preparing vectors===<br />
<br />
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL1-Gold Ultracompetent Cells of..... We selected transformed cells in a LB + ampicillin medium plaques. <br><br />
<br />
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br><br />
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br><br />
<br />
<br />
===Ligating BioBricks into plasmids===<br />
<br />
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br><br />
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br><br />
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br><br />
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T18:54:10Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div style="position:relative; top:-5px; left:70px; width:700px" align="justify"><br />
<br><br />
==Experimental results==<br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity. we choose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
===Chemical input.===<br />
<br><br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br><br></div>Guimar3http://2009.igem.org/Team:Valencia/ProjectTeam:Valencia/Project2009-10-20T17:47:43Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:800px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
== '''Project description''' ==<br />
<br />
<br><br />
The <b>iGEM Valencia Lighting Cell Display</b> (<b>iLCD</b>) is our project for the present iGEM competition. We are developing '''BioElectronics''', a combination of Electronics and Biology. We think that cell behaviour might be controlled by electrical impulses. <br />
<br />
For demostrate this, we are making <b>a “bio-screen” of voltage-activated cells</b>, where every “cellular pixel” produces light. It is just like a bacterial photographic system, but it's digital. Within seconds, instead of hours, you can get an image formed of living cells. We use the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen<br />
<br />
It is known that for instance <b>neurons, cardiomyocites or muscle cells</b> are able to sense and respond to electrical signals. These cells use a common second messenger system, calcium ion, which promotes a defined response when an electrical pulse is supplied to them. Nevertheless, these cultures present several disadvantadges in order to make use of them from the technological point of view: <br />
<br />
- Get easily contaminated.<br />
<br />
- Genetic manipulation is complicated and expensive.<br />
<br />
- To be very sensible to external conditions. <br />
<br />
Valencia team uses this sensibility of calcium channel to electricity to <b>produce yeast luminiscence as a response to electrical estimulous</b>. This project constitutes the '''FIRST TIME in which the electrical response of <i>Saccharomyces</i> and its potential applications are going to be tested''' building the first '''LEC''' (Light Emitting Cell). The obtained device will be used to build the first''' iLCD''' in history.<br />
<br />
Therefore, the project is divided in several stages from the fabrication of the first '''LEC''' up to the cooperative integration of various LECs in the first '''iLCD'''. The global scheme of the project is summarized in the scheme of the figure:<br />
<br />
<html><br />
<div align="right"><br />
<embed src="https://static.igem.org/mediawiki/2009/b/b4/Esquema_flash_bueno.swf" type="application/x-shockwave-flash" width="550" height="750" quality="high" overflow="hidden" bgcolor="WHITE"></embed> <br />
</div><br />
</html><br />
<!--<div style="position:relative; top:-5px; left:150px; width:600px" align="justify">--><br />
<div align="justify" style="position:relative; top:-5px; left:150px; width:600px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
Where three main parts can be appreciated<br />
<br />
* LEC Construction<br />
<br />
* LEC Characterization<br />
<br />
* LEC Integration Device<br />
<br />
The main advantages of using electrical signals instead of chemical stimulation, as in the Coliroid project (Levskaya et al, <i>Synthetic biology: Engineering Escherichia coli to see light</i>. <b>Nature</b> 438, 441-442), are reversibility and high frequency: the system can go back to the resting state and it will take <b>seconds to refresh an image, actually showing animated pictures!</b>. For that reason, we chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
<b>iLCD will be a major advance in Synthetic Biology, advancing on the field of BioElectronics, integrating electrical signals with cell behaviours</b>. This will reduce the response time of the cells to the activation signal by up to two orders of magnitude, as well as foster the combination of Electronics and Biology. Thus, our engineered yeast are a state-of-art bioelectronic device. This simple mechanism will be the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
<br><br />
[[Image:Valenciarobocop.jpg|500px|center]]<br />
<br />
<br />
<br><br />
<br />
<!-- <div style="position:absolute;top:-450px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --></div>Guimar3http://2009.igem.org/Team:Valencia/ProjectTeam:Valencia/Project2009-10-20T17:43:17Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:800px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
== '''Project description''' ==<br />
<br />
<br><br />
The <b>iGEM Valencia Lighting Cell Display</b> (<b>iLCD</b>) is our project for the present iGEM competition. We are developing '''BioElectronics''', a combination of Electronics and Biology. We think that cell behaviour might be controlled by electrical impulses. For demostrate this, we are making <b>a “bio-screen” of voltage-activated cells</b>, where every “cellular pixel” produces light. It is just like a bacterial photographic system, but it's digital. Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
It is known that for instance <b>neurons, cardiomyocites or muscle cells</b> are able to sense and respond to electrical signals. These cells use a common second messenger system, calcium ion, which promotes a defined response when an electrical pulse is supplied to them. Nevertheless, these cultures present several disadvantadges in order to make use of them from the technological point of view: <br />
<br />
- Get easily contaminated.<br />
<br />
- Genetic manipulation is complicated and expensive.<br />
<br />
- To be very sensible to external conditions. <br />
<br />
Valencia team uses this sensibility of calcium channel to electricity to <b>produce yeast luminiscence as a response to electrical estimulous</b>. This project constitutes the '''FIRST TIME in which the electrical response of <i>Saccharomyces</i> and its potential applications are going to be tested''' building the first '''LEC''' (Light Emitting Cell). The obtained device will be used to build the first''' iLCD''' in history.<br />
<br />
Therefore, the project is divided in several stages from the fabrication of the first '''LEC''' up to the cooperative integration of various LECs in the first '''iLCD'''. The global scheme of the project is summarized in the scheme of the figure:<br />
<br />
<html><br />
<div align="right"><br />
<embed src="https://static.igem.org/mediawiki/2009/b/b4/Esquema_flash_bueno.swf" type="application/x-shockwave-flash" width="550" height="750" quality="high" overflow="hidden" bgcolor="WHITE"></embed> <br />
</div><br />
</html><br />
<!--<div style="position:relative; top:-5px; left:150px; width:600px" align="justify">--><br />
<div align="justify" style="position:relative; top:-5px; left:150px; width:600px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
Where three main parts can be appreciated<br />
<br />
* LEC Construction<br />
<br />
* LEC Characterization<br />
<br />
* LEC Integration Device<br />
<br />
The main advantages of using electrical signals instead of chemical stimulation, as in the Coliroid project (Levskaya et al, <i>Synthetic biology: Engineering Escherichia coli to see light</i>. <b>Nature</b> 438, 441-442), are reversibility and high frequency: the system can go back to the resting state and it will take <b>seconds to refresh an image, actually showing animated pictures!</b>. For that reason, we chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
<b>iLCD will be a major advance in Synthetic Biology, advancing on the field of BioElectronics, integrating electrical signals with cell behaviours</b>. This will reduce the response time of the cells to the activation signal by up to two orders of magnitude, as well as foster the combination of Electronics and Biology. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
<br><br />
[[Image:Valenciarobocop.jpg|500px|center]]<br />
<br />
<br />
<br><br />
<br />
<!-- <div style="position:absolute;top:-450px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --></div>Guimar3http://2009.igem.org/Team:Valencia/Project/ResultsTeam:Valencia/Project/Results2009-10-20T17:32:02Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<div style="position:relative; top:-5px; left:70px; width:600px"><br />
<br><br />
[[Image:Logo_banner.jpg|400px|center]]<br />
<br />
<br><br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:600px; color:black; font-size:10.5pt; font-family: Verdana"> <br />
We have: <br><br />
<ol><li>We advanced Bioelectronics allowing enabling bidirectional communication of monocellular organisms and electronic components.<br><br></li><br />
<li>Built a fast and responsive 'digital imaging' system based on living cells.<br><br></li><br />
<li>Built a home-made yet professionally accurate [https://2009.igem.org/Team:Valencia/Hardware system to control] cells behaviour pout of electricity.<br><br></li><br />
<li>Developped an impressive [https://2009.igem.org/Team:Valencia/Human Human Practices] part of the project.<br><br></li><br />
<li>Helped TUDelft and NTU-Singapore whith their respectives surveys. We have also helped to Paris Team answering their questions about their iPhone application<br><br></li><br />
<li>Characterized a new part: [https://2009.igem.org/Team:Valencia/Parts/Characterization ''Aequorin'']</li><br />
</ol><br />
<br />
<br><br><br><br><br />
</div></div>Guimar3http://2009.igem.org/Team:Valencia/Parts/CharacterizationTeam:Valencia/Parts/Characterization2009-10-20T17:27:29Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div style="position:relative; top:-5px; left:70px; width:700px" align="justify"><br />
<br><br />
==General information==<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
AEQ is a gene which encodes for aequorin, our luminiscent protein.<br />
<br />
[[Image:aequorin.GIF|300px|center]]<br />
<br />
It's a photoprotein isolated from luminescent jellyfish (like various Aequorea species like Aequorea victoria) and a variety of other marine organisms. It was originally isolated from the coelenterate by Osamu Shimomura, and it has been used as a reporter gene in different superior eukariotes. Nowadays, there are different aequorin types, depending on the target organism. <br><br />
The aequorin which we are working with has been introduced in our yeasts by a plasmid called pEVP11/AEQ, wich encondes aequorin sequence showed below. Cells containing this plasmid are able to sintetize apoaequorin, the apoprotein of 22 kDa, and keep it in their citoplasm. So, that apoprotein can't produce luminiscence by itself, but when it binds to its cofactor coelenterazine, in presence of Ca2+, full aequorin emits light.<br><br />
The two components of aequorin reconstitute spontaneously, forming the functional protein. The protein bears three EF-hand motifs that function as binding sites for Ca2+ ions. When Ca2+ occupies such sites, the protein undergoes a conformational change and converts through oxidation its prosthetic group, coelenterazine, into excited coelenteramide and CO2 (as we explain in Wetlab overview). As the excited coelenteramide relaxes to the ground state, blue light (wavelength = 469 nm) is emitted.<br><br />
<br />
==Sequence==<br />
<br />
<br />
Aequorin sequence is (primer binding sites are underlined in green):<br><br />
<br />
[[Image:Aeqseqval.JPG|500px|center]]<br />
<br />
==Characterization==<br />
<br />
===Chemical input.===<br />
<br><br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.</div>Guimar3http://2009.igem.org/Team:Valencia/OurModelTeam:Valencia/OurModel2009-10-20T17:27:20Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
== '''Detailed model description''' ==<br />
<br><br />
We have based our Project on the budding yeast '''''Saccharomyces cerevisiae'''''. Although it is a model organism for the study of many biological processes, there are only a few reports on '''yeast electrophysiology'''. That’s why we began to work with a model built up for '''excitable cells''' (neurons and cardiomyocites) in which several parts can be distinguished: <br />
<br />
<br />
*'''Modelling Ionic Current Flow through VDCCs'''<br><br />
If we assume that the whole calcium currents occur through this calcium channels and that the instantaneous current-voltage relation is linear, we can describe the ionic current <i>I<sub>Ca</sub></i> by the Ohm's law:<br><br />
<br />
[[Image:eq1.jpg|center]]<br />
<br />
Where <i>g</i> is the conductance associated with the channel, <i>V</i> is the transmembrane potential and <i>E<sub>Ca</sub></i> is the Nerst potential, related to the different ionic concentration inside and outside the cell.<br />
<br><br />
Considering that these channels are only permeable to calcium and have two states -open or closed-, the total conductance associated with the population of VDCCs can be expressed as the maximal conductance [[Image:gbarra.jpg]] times the fraction of all channels that are open. This fraction is determined by hypothetical activation and inactivation variables <i>m</i> and <i>h</i>, which depend on voltage and time:<br />
<br />
[[Image:eq2.jpg|center]]<br />
[[Image:2.1.jpg|center]]<br />
<br />
[[Image:Minf.jpg]] is the steady-state value of ''m'' and [[Image:Taum.jpg]] is the time constant. They are defined functions of voltage:<br />
<br />
[[Image:2.1.1.jpg|center]]<br />
[[Image:2.1.2.jpg|center]]<br />
<br />
<br />
<br />
<br />
<br />
[[Image:2.2.jpg|center]]<br />
[[Image:2.3.jpg|center]]<br />
<br />
<i>K</i> is the halfway inactivation concentration and <i>[Ca<sup>2+</sup>]<sub>o</sub></i> is the constant extracellular calcium concentration.<br />
<br />
Now, we have to model how transmembrane potential changes in time. To do this, we can consider the following membrane-equivalent electrial circuit, where all ionic currents involved in initiation and propagation of the action potential are represented:<br />
<br />
[[Image:V_circuit.gif|center]]<br />
<br />
We can know the transmembrane potential at any time after applying an electrical input by solving this equation:<br />
<br />
[[Image:eq3.jpg|center]]<br />
<br />
However, we have assumed that our stimulus triggers the excitatory post-synaptic potential (EPSP), so it's not necessary to solve the previous equation. But modelling the calcium influx is only the first step...<br />
<br><br><br />
*'''Modelling Free Intracellular Calcium Concentration'''<br><br />
The change in free intracellular calcium concentration is mostly due to the influx of calcium ions described above, but there are several factors which also contribute. For instance, we have considered calcium buffers and calcium remove by membrane pumps. <br />
<br />
<br />
<table cellpadding="5" cellspacing="5" overflow="hidden" align="center"><br />
<tr><br />
<td><br />
<u>'''Calcium current'''</u><br> <br />
The relation between the calcium inward current <i>I<sub>Ca</sub></i> and the change in intracellular calcium concentration is given by:<br />
<br />
[[Image:eq4.jpg|center]]<br />
<br />
<i>F</i> is the Faraday's constant, <i>[Ca<sup>2+</sup>]</i> is the calcium concentration just below the plasma membrane and <i>Vol</i> is the cell volume considered.<br />
</td><br />
<td><br />
[[Image:V_CaCurrent.jpg|250px|center]]<br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<br />
<br />
<table cellpadding="5" cellspacing="5" overflow="hidden" align="center"><br />
<tr><br />
<td><br />
[[Image:V_Buffer2.jpg|310px|center]]<br />
</td><br />
<td><br />
<u>'''Calcium buffers'''</u><br><br />
At this point we have taken into account the presence of calcium buffers such as calmodulin, calcineurin, calbindin, and other ones in the cell. To make the model easier, we have assumed that calcium binds to a single binding site on a single buffer as it is expressed here:<br />
[[Image:V_Buffer.jpg|150px|center]]<br />
<br />
<i>f</i> and <i>b</i> are the forward and backward rates of the binding reaction:<br />
<br />
[[Image:eq5.jpg|center]]<br />
<br />
<br />
</td><br />
</tr><br />
</table><br />
<br />
<table cellpadding="5" cellspacing="5" overflow="hidden" align="center"><br />
<tr><br />
<td><br />
<u>'''Calcium pumps'''</u><br><br />
Once the buffering system has reduced the amount of free intracellular calcium, the remaining calcium ions must be removed from the cell in order to maintain calcium homeostasis. We have described the behaviour of calcium pumps by the following first-order equation:<br />
<br />
[[Image:eq6.jpg|center]]<br />
<br />
Where <i>[Ca<sup>2+</sup>]<sub>eq</sub></i> is the equilibrium concentration of the pump, <i>[Ca<sup>2+</sup>]</i> is the calcium concentration in the shell just below the membrane and <i>t<sub>pump</sub></i> is the pump's time constant, which depends on voltage:<br />
<br />
[[Image:6.1.jpg|center]]<br />
</td><br />
<td><br />
[[Image:V_Pump.jpg|200px|center]]<br />
<br />
<br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
We have neglected the intracellular diffusion of calcium due to the different concentrations between the inner perimembranal area and deeper areas of the citoplasm, we have considered that the calcium release from intracellular organelles (for instance, endoplasmic reticulum and mitochondria) may reduce these concentration differences. Thus, we assume the calcium concentration just below the plasma membrane as whole intracellular calcium.<br />
<br />
<br />
<br />
In our project, the mechanism for the production of light through a yeast-based system is similar to the one described by the previous model. Therefore, after determining experimentally yeasts’ response to this type of input, we decided to fit the model to our '''experimental results''' and determine the differences between neurons and yeasts’ '''VDCCs''' (Voltage-Dependent Calcium Channels). In particular, this fitting allowed us to determine the '''conductance''' (''g'') of yeasts’ calcium channels:<br />
<br />
[[Image:eq_llevat.jpg|center]]<br />
<br />
It has to be noted that we took into account some particular properties of yeasts’ plasma membrane, for instance, its transmembrane potential, which is so much lower than in neurons.<br />
<br />
The following figure shows our experimental data (dotted line) and the theoretical results predicted by our model considering the determined conductance of '''21,386 µS''':<br />
<br />
[[Image:Fitting.jpg|center]]<br />
<br />
</div></div>Guimar3http://2009.igem.org/Team:Valencia/ModellingTeam:Valencia/Modelling2009-10-20T17:26:52Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:700px"><br />
== '''Modelling''' ==<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
Our aim in this part of the Project is the development of a model which describes how intracellular calcium concentration changes in time when we apply electrical stimulation, this is, a potential difference across the plasma membrane. We have considered very interesting to make different approaches to this problem: on the one hand, a deterministic model of the calcium influx through the voltage-dependent calcium channels (VDCCs) of excitable cells (neurons and muscle cells) and yeasts -based on the Hodgkin-Huxley model modified by Yamada et al [ISBN:0262111330]-, and, on the other hand, we have included stochastic methods for a further study of these gates, particularly of its activation/inactivation. We are working hard to offer you this model in an easy and clear way, also trying to allow you to interact with the system.<br />
<br><br><br />
*'''What are VDCCs?'''<br />
<br />
Living cells are surrounded by semipermeable membranes containing specialized proteins providing for exchange of various atoms and molecules between extracellular and intracellular spaces. Two basic mechanisms of <b>transmembrane transport</b> have been recognized: carriers and channels.<br />
<br />
[[Image:V_VDCCs.gif|300px|center]]<br />
<br />
Carriers, such as the Ca<sup>2+</sup> pump, Na<sup>+</sup>-Ca<sup>2+</sup> exchanger, or Na<sup>+</sup>-K<sup>+</sup> pump, transport ions against concentration and/or electrical gradients are coupled to metabolic energy consumption. Membrane <b>channels</b> are viewed as pores, which, when opened, allow passive transport downhill the electric and/or concentration gradients. Opening of a channel can be accomplished in two ways:<br><br />
#by binding of a specific ligand either directly to the channel or to another membrane protein coupled to the channel <br><br />
#by a change in <b>transmembrane voltage</b>.<br />
The first pathway is characteristic for ligand-gated channels, such as the glutamate or acetylcholine receptors. The second pathway activates the so-called <b>voltage-gated channels</b>. The foundation of biophysical analyses of voltage-gated ion channels was laid in the pioneering works of <b>Hodgkin and Huxley</b> in the 1930s and culminated in the 1950s by formulating the Hodgkin-Huxley model of action potential (Hodgkin and Huxley, 1952 [PMC1392413]). <br><br />
<b>Voltage-gated calcium channels</b> were first identified by Fatt and Katz (1953) [PMC1366030] in crustacean muscle. Then it was discovered that there are different channel subtypes in excitable cells and, some years later, it was accepted that there are analog calcium channels in yeast plasma membrane.<br />
<br><br><br />
<!--<br />
*'''Modelling Ionic Current Flow through VDCCs'''<br><br />
If we assume that the whole calcium currents occur through this calcium channels and that the instantaneous current-voltage relation is linear, we can describe the ionic current <i>I<sub>Ca</sub></i> by the Ohm's law:<br><br />
<br />
[[Image:eq1.jpg|center]]<br />
<br />
Where <i>g</i> is the conductance associated with the channel, <i>V</i> is the transmembrane potential and <i>E<sub>Ca</sub></i> is the Nerst potential, related to the different ionic concentration inside and outside the cell.<br />
<br><br />
Considering that these channels are only permeable to calcium and have two states -open or closed-, the total conductance associated with the population of VDCCs can be expressed as the maximal conductance [[Image:gbarra.jpg]] times the fraction of all channels that are open. This fraction is determined by hypothetical activation and inactivation variables <i>m</i> and <i>h</i>, which depend on voltage and time:<br />
<br />
[[Image:eq2.jpg|center]]<br />
[[Image:2.1.jpg|center]]<br />
<br />
[[Image:Minf.jpg]] is the steady-state value of ''m'' and [[Image:Taum.jpg]] is the time constant. They are defined functions of voltage:<br />
<br />
[[Image:2.1.1.jpg|center]]<br />
[[Image:2.1.2.jpg|center]]<br />
<br />
<br />
<br />
<br />
<br />
[[Image:2.2.jpg|center]]<br />
[[Image:2.3.jpg|center]]<br />
<br />
<i>K</i> is the halfway inactivation concentration and <i>[Ca<sup>2+</sup>]<sub>o</sub></i> is the constant extracellular calcium concentration.<br />
<br />
<br />
Now, we have to model how transmembrane potential changes in time. To do this, we can consider the following membrane-equivalent electrial circuit, where all ionic currents involved in initiation and propagation of the action potential are represented:<br />
<br />
[[Image:V_circuit.gif|center]]<br />
<br />
We can know the transmembrane potential at any time after applying an electrical input by solving this equation:<br />
<br />
[[Image:eq3.jpg|center]]<br />
<br />
However, we have assumed that our stimulus triggers the excitatory post-synaptic potential (EPSP), so it's not necessary to solve the previous equation. But modelling the calcium influx is only the first step...<br />
<br><br><br />
*'''Modelling Free Intracellular Calcium Concentration'''<br><br />
The change in free intracellular calcium concentration is mostly due to the influx of calcium ions described above, but there are several factors which also contribute. For instance, we have considered calcium buffers and calcium remove by membrane pumps.<br />
<br />
**<u>Calcium current</u><br><br />
The relation between the calcium inward current <i>I<sub>Ca</sub></i> and the change in intracellular calcium concentration is given by:<br />
<br />
[[Image:eq4.jpg|center]]<br />
<br />
<i>F</i> is the Faraday's constant, <i>[Ca<sup>2+</sup>]</i> is the calcium concentration just below the plasma membrane and <i>Vol</i> is the cell volume considered. <br />
<br />
[[Image:V_CaCurrent.jpg|250px|center]]<br />
<br />
**<u>Calcium buffers</u><br />
At this point we have taken into account the presence of calcium buffers such as calmodulin, calcineurin, calbindin, and other ones in the cell. To make the model easier, we have assumed that calcium binds to a single binding site on a single buffer as it is expressed here:<br />
<br />
[[Image:V_Buffer.jpg|150px|center]]<br />
<br />
<i>f</i> and <i>b</i> are the forward and backward rates of the binding reaction:<br />
<br />
[[Image:eq5.jpg|center]]<br />
<br />
[[Image:V_Buffer2.jpg|300px|center]]<br />
<br />
**<u>Calcium pumps</u><br />
Once the buffering system has reduced the amount of free intracellular calcium, the remaining calcium ions must be removed from the cell in order to maintain calcium homeostasis. We have described the behaviour of calcium pumps by the following first-order equation:<br />
<br />
[[Image:eq6.jpg|center]]<br />
<br />
Where <i>[Ca<sup>2+</sup>]<sub>eq</sub></i> is the equilibrium concentration of the pump, <i>[Ca<sup>2+</sup>]</i> is the calcium concentration in the shell just below the membrane and <i>t<sub>pump</sub></i> is the pump's time constant, which depends on voltage:<br />
<br />
[[Image:6.1.jpg|center]]<br />
<br />
[[Image:V_Pump.jpg|200px|center]]<br />
<br />
We have neglected the intracellular diffusion of calcium due to the different concentrations between the inner perimembranal area and deeper areas of the citoplasm, we have considered that the calcium release from intracellular organelles (for instance, endoplasmic reticulum and mitochondria) may reduce these concentration differences. Thus, we assume the calcium concentration just below the plasma membrane as whole intracellular calcium.--><br />
<br />
<!-- <div style="position:absolute;top:250px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --><br />
<!-- </div> --></div>Guimar3http://2009.igem.org/Team:Valencia/Hardware/iLCDTeam:Valencia/Hardware/iLCD2009-10-20T17:24:14Z<p>Guimar3: </p>
<hr />
<div>__NOTOC__<br />
{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
=='''iLCD: LEC array'''==<br />
<br><br />
Having established that yeast responds with light to electrical pulses, that is having build a Light Emitting Cell or LEC, we considered to control an array of 96 totally independent pixels, so we could create '''animated pictures''' and it would be the first screen that works with living cells.<br> <br><br />
To do this we had two problems, to control each pixel independently and build a stand with 96 pairs of electrodes (one for each pixel) to stimulate the yeast.<br><br><br />
1) '''Controlling''' 96 pixels.<br />
Our screen is a matrix of 8 columns by 12 rows. Thus, we can decide which row and column we want to activate at all times through a card with 20 digital outputs, one per row and column. For example, to turn the cell in position 3,4 of the screen, activate the outputs corresponding to row 3 and column 4. The card is controlled by a program executed in LabVIEW.<br><br><br />
[[Image: V_ScreenCircuit.jpg|500px|center]]<br />
<br><br />
2) '''Constructing''' the support.<br />
<br />
We have developed a system capable of selectively controlling the input of amplitude- and time-varying electrical pulses to a 24 channel-wide [http://sine.ni.com/nips/cds/view/p/lang/en/nid/201630 data acquisition card]. These pulses are the signal for the coordinated switch on and off of an array of pixels (let them be Diodes, LEDs, or Cells, LECs). The system is capable of reproducing different black and white images that will be transmitted to the pixel resulting in animated pictures.<br />
<br />
In order to design and build this device a LabVIEW program has been implemented to divide each desired image (jpg file) in 96 parts. Depending on the colour intensity of each part, our program sends simultaneously through the data acquisition card (connected to a laptop through USB) a voltage signal that permits the activation of the corresponding pixels.<br />
<br />
<!--imatge del flow chart del algoritme--><br />
<br />
*iLCD recipe<br />
Material you will need in order to build your own iLCD:<br />
<br />
- a laptop<br />
<br />
- a data acquisition card<br />
<br />
- our LabView program<br />
<br />
- images you want to animate<br />
<br />
- Light Emitting Cells (LECs)<br />
<br />
<br><br><br><br></div>Guimar3http://2009.igem.org/Team:Valencia/Hardware/iLCDTeam:Valencia/Hardware/iLCD2009-10-20T17:24:00Z<p>Guimar3: </p>
<hr />
<div>__NOTOC__<br />
{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
=='''iLCD: LEC array'''==<br />
<br />
Having established that yeast responds with light to electrical pulses, that is having build a Light Emitting Cell or LEC, we considered to control an array of 96 totally independent pixels, so we could create '''animated pictures''' and it would be the first screen that works with living cells.<br> <br><br />
To do this we had two problems, to control each pixel independently and build a stand with 96 pairs of electrodes (one for each pixel) to stimulate the yeast.<br><br><br />
1) '''Controlling''' 96 pixels.<br />
Our screen is a matrix of 8 columns by 12 rows. Thus, we can decide which row and column we want to activate at all times through a card with 20 digital outputs, one per row and column. For example, to turn the cell in position 3,4 of the screen, activate the outputs corresponding to row 3 and column 4. The card is controlled by a program executed in LabVIEW.<br><br><br />
[[Image: V_ScreenCircuit.jpg|500px|center]]<br />
<br><br />
2) '''Constructing''' the support.<br />
<br />
We have developed a system capable of selectively controlling the input of amplitude- and time-varying electrical pulses to a 24 channel-wide [http://sine.ni.com/nips/cds/view/p/lang/en/nid/201630 data acquisition card]. These pulses are the signal for the coordinated switch on and off of an array of pixels (let them be Diodes, LEDs, or Cells, LECs). The system is capable of reproducing different black and white images that will be transmitted to the pixel resulting in animated pictures.<br />
<br />
In order to design and build this device a LabVIEW program has been implemented to divide each desired image (jpg file) in 96 parts. Depending on the colour intensity of each part, our program sends simultaneously through the data acquisition card (connected to a laptop through USB) a voltage signal that permits the activation of the corresponding pixels.<br />
<br />
<!--imatge del flow chart del algoritme--><br />
<br />
*iLCD recipe<br />
Material you will need in order to build your own iLCD:<br />
<br />
- a laptop<br />
<br />
- a data acquisition card<br />
<br />
- our LabView program<br />
<br />
- images you want to animate<br />
<br />
- Light Emitting Cells (LECs)<br />
<br />
<br><br><br><br></div>Guimar3http://2009.igem.org/Team:Valencia/HumanTeam:Valencia/Human2009-10-20T17:21:14Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br><br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:650px"><br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<div align="justify" style="position:relative; top:-5px; left:0; width:693px"><br />
[[Image:Portada teamvalhp.jpg|center|500 px]]<br />
<br><br />
Synthetic Biology is a revolutionary scientific discipline. The ability to design and construct new biological systems with useful properties opens up a challenging scenario for the technological development of humanity. However, new science needs new regulation, and Human Practices dealing with Synthetic Biology are needed in order to have an ethical, legal and regulatory framework allowing the development of this novel scientific area.<br />
<br />
<br><br />
<br />
'''Sins, Ethics and Biology, a Comprehensive Approach''' is more than a review on Human Practices and Synthetic Biology: it emcompasses a classical review of scientific reports on Human Practices; the first comparative analysis of previous iGEM HP projects; interviews with well known experts; and the largest survey on ethics and synthetic biology ever made.<br />
<br />
The complete report will be edited as a book and you will be able to get it at bubok.com (more information coming soon) oras a free pdf file and its goal is to help researchers and people interested in SB to assess the new risks, possibilities, and ethical issues of this discipline.<br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:-15px; width:900px"><br />
[[Image:Pàgina 7 (esquerra)val.jpg|left|340 px]] [[Image:Pàgina 8 (dreta)val.jpg|right|340 px]]<br />
</div><br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
[[Image:Botonet pubmed.jpg|left|150 px]]'''The Review''' : We have prepared a classical review on scientific reports about Synthetic Biology and its ethical consequences. With more thant 30 references, you will get a complete overview of the present status of this new emerging field. Ideas of well-known scientist about different topics are gathered here: Definition of SB, The engineering principles of the field, Applications, new chemically different biomolecules, ethical problems with genetic engineering, Europe and USA and teaching and learning SB.<br />
<br><br><br />
[[Image:Botonet Human Practices 2005-2008.jpg|left|150 px]]'''Human Practices: iGEM 2005-2008''': We are the first to study all the reports on previous iGEM editions, and gathered their conclusions in a single work. In this part of the book you will understand the ethical concerns of iGEM participants and its evolution during the whole life of the competition.<br />
<br><br><br><br><br><br />
[[Image:Botonet Survey.jpg|left|150 px]]'''The Survey''': With more than '''1200 answers''' we have made the largest survey on Synthetic Biology of the history. It was adressed to a very different public including scientific and no scientific people, people from inside and outside the iGEM, and Students and Teachers from all over the world. To encourage iGEM participants to fill our survey we prepared [https://2009.igem.org/Team:Valencia/Human_Practice/Medalls medals] that teams can show in their wiki according to their degree of participation. This Survey has also helped us to get the largest collection of Synthetic Biology's [https://2009.igem.org/Team:Valencia/Definitions definitions].<br />
<br />
<br><br><br />
<br />
[[Image:Botonet Experts.jpg| 150 px | left]]'''The Interviews''': We have personally interviewed two well-known experts, Antoine Danchin and Markus Schmidt to gather their opinions about every aspect of Synthetic Biology. They have also filled our survey so you can compare your answers to theirs, how close are your ideas to the ones of the experts?<br />
</div></div>Guimar3http://2009.igem.org/Team:Valencia/HumanTeam:Valencia/Human2009-10-20T17:19:47Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br><br />
<div align="justify" style="position:relative; top:-5px; left:50px; width:650px"><br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<div align="justify" style="position:relative; top:-5px; left:0; width:693px"><br />
[[Image:Portada teamvalhp.jpg|right|500 px]]Synthetic Biology is a revolutionary scientific discipline. The ability to design and construct new biological systems with useful properties opens up a challenging scenario for the technological development of humanity. However, new science needs new regulation, and Human Practices dealing with Synthetic Biology are needed in order to have an ethical, legal and regulatory framework allowing the development of this novel scientific area.<br />
<br />
<br><br />
<br />
'''Sins, Ethics and Biology, a Comprehensive Approach''' is more than a review on Human Practices and Synthetic Biology: it emcompasses a classical review of scientific reports on Human Practices; the first comparative analysis of previous iGEM HP projects; interviews with well known experts; and the largest survey on ethics and synthetic biology ever made.<br />
<br />
The complete report will be edited as a book and you will be able to get it at bubok.com (more information coming soon) oras a free pdf file and its goal is to help researchers and people interested in SB to assess the new risks, possibilities, and ethical issues of this discipline.<br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:-15px; width:900px"><br />
[[Image:Pàgina 7 (esquerra)val.jpg|left|340 px]] [[Image:Pàgina 8 (dreta)val.jpg|right|340 px]]<br />
</div><br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
[[Image:Botonet pubmed.jpg|left|150 px]]'''The Review''' : We have prepared a classical review on scientific reports about Synthetic Biology and its ethical consequences. With more thant 30 references, you will get a complete overview of the present status of this new emerging field. Ideas of well-known scientist about different topics are gathered here: Definition of SB, The engineering principles of the field, Applications, new chemically different biomolecules, ethical problems with genetic engineering, Europe and USA and teaching and learning SB.<br />
<br><br><br />
[[Image:Botonet Human Practices 2005-2008.jpg|left|150 px]]'''Human Practices: iGEM 2005-2008''': We are the first to study all the reports on previous iGEM editions, and gathered their conclusions in a single work. In this part of the book you will understand the ethical concerns of iGEM participants and its evolution during the whole life of the competition.<br />
<br><br><br><br><br><br />
[[Image:Botonet Survey.jpg|left|150 px]]'''The Survey''': With more than '''1200 answers''' we have made the largest survey on Synthetic Biology of the history. It was adressed to a very different public including scientific and no scientific people, people from inside and outside the iGEM, and Students and Teachers from all over the world. To encourage iGEM participants to fill our survey we prepared [https://2009.igem.org/Team:Valencia/Human_Practice/Medalls medals] that teams can show in their wiki according to their degree of participation. This Survey has also helped us to get the largest collection of Synthetic Biology's [https://2009.igem.org/Team:Valencia/Definitions definitions].<br />
<br />
<br><br><br />
<br />
[[Image:Botonet Experts.jpg| 150 px | left]]'''The Interviews''': We have personally interviewed two well-known experts, Antoine Danchin and Markus Schmidt to gather their opinions about every aspect of Synthetic Biology. They have also filled our survey so you can compare your answers to theirs, how close are your ideas to the ones of the experts?<br />
</div></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T17:16:29Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div style="position:relative; top:-5px; left:70px; width:700px" align="justify"><br />
<br><br />
==Experimental results==<br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity. we choose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
===Chemical input.===<br />
<br><br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.</div>Guimar3http://2009.igem.org/Team:Valencia/Parts/CharacterizationTeam:Valencia/Parts/Characterization2009-10-20T17:14:10Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div style="position:relative; top:-5px; left:70px; width:700px" align="justify"><br />
<br><br />
==General information==<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
AEQ is a gene which encodes for aequorin, our luminiscent protein.<br />
<br />
[[Image:aequorin.GIF|300px|center]]<br />
<br />
It's a photoprotein isolated from luminescent jellyfish (like various Aequorea species like Aequorea victoria) and a variety of other marine organisms. It was originally isolated from the coelenterate by Osamu Shimomura, and it has been used as a reporter gene in different superior eukariotes. Nowadays, there are different aequorin types, depending on the target organism. <br><br />
The aequorin which we are working with has been introduced in our yeasts by a plasmid called pEVP11/AEQ, wich encondes aequorin sequence showed below. Cells containing this plasmid are able to sintetize apoaequorin, the apoprotein of 22 kDa, and keep it in their citoplasm. So, that apoprotein can't produce luminiscence by itself, but when it binds to its cofactor coelenterazine, in presence of Ca2+, full aequorin emits light.<br><br />
The two components of aequorin reconstitute spontaneously, forming the functional protein. The protein bears three EF-hand motifs that function as binding sites for Ca2+ ions. When Ca2+ occupies such sites, the protein undergoes a conformational change and converts through oxidation its prosthetic group, coelenterazine, into excited coelenteramide and CO2 (as we explain in Wetlab overview). As the excited coelenteramide relaxes to the ground state, blue light (wavelength = 469 nm) is emitted.<br><br />
<br />
==Sequence==<br />
<br />
<br />
Aequorin sequence is (primer binding sites are underlined in green):<br><br />
<br />
[[Image:Aeqseqval.JPG|500px|center]]<br />
<br />
==Characterization==<br />
<br />
===Chemical input.===<br />
<br><br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.</div>Guimar3http://2009.igem.org/Team:Valencia/Parts/CharacterizationTeam:Valencia/Parts/Characterization2009-10-20T17:13:47Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div style="position:relative; top:-5px; left:70px; width:700px" align="justify"><br />
<br><br />
==General information==<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:30px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
AEQ is a gene which encodes for aequorin, our luminiscent protein.<br />
<br />
[[Image:aequorin.GIF|300px|center]]<br />
<br />
It's a photoprotein isolated from luminescent jellyfish (like various Aequorea species like Aequorea victoria) and a variety of other marine organisms. It was originally isolated from the coelenterate by Osamu Shimomura, and it has been used as a reporter gene in different superior eukariotes. Nowadays, there are different aequorin types, depending on the target organism. <br><br />
The aequorin which we are working with has been introduced in our yeasts by a plasmid called pEVP11/AEQ, wich encondes aequorin sequence showed below. Cells containing this plasmid are able to sintetize apoaequorin, the apoprotein of 22 kDa, and keep it in their citoplasm. So, that apoprotein can't produce luminiscence by itself, but when it binds to its cofactor coelenterazine, in presence of Ca2+, full aequorin emits light.<br><br />
The two components of aequorin reconstitute spontaneously, forming the functional protein. The protein bears three EF-hand motifs that function as binding sites for Ca2+ ions. When Ca2+ occupies such sites, the protein undergoes a conformational change and converts through oxidation its prosthetic group, coelenterazine, into excited coelenteramide and CO2 (as we explain in Wetlab overview). As the excited coelenteramide relaxes to the ground state, blue light (wavelength = 469 nm) is emitted.<br><br />
<br />
==Sequence==<br />
<br />
<br />
Aequorin sequence is (primer binding sites are underlined in green):<br><br />
<br />
[[Image:Aeqseqval.JPG|500px|center]]<br />
<br />
==Characterization==<br />
<br />
===Chemical input.===<br />
<br><br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T17:13:25Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity. we choose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
===Chemical input.===<br />
<br><br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T17:08:02Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity. we choose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|center|520px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|700px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks.<br />
<br />
That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T17:05:13Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity. we choose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T17:03:25Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
[[Image:Combinació.jpg|center|thumb|700px| Comparation of the repetibility between our yeasts, our yeasts without coelenterazine, medium whit coelenterazine and mutants]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:Combinació.jpg|700px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T16:57:18Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every next shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|center|thumb|700px| Here, we can see that the process can be repeat consecutively]]<br />
<br />
===SCREEN===<br />
<br><br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T16:51:58Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|center|thumb|700px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 5 seconds]]<br />
<br />
[[Image:1,5V 10s.jpg|center|thumb|700px| Light emitted when 1,5V are applicated during 10 seconds]]<br />
<br />
[[Image:4,5V 5s.jpg|center|thumb|700px| Light emitted when 4,5V are applicated during 5 seconds]]<br />
<br />
[[Image:10V 1s disc.jpg|center|thumb|700px| Light emitted when 10V are applicated during 1 second]]<br />
<br />
[[Image:10V 2s.jpg|center|thumb|700px| Light emitted when 10V are applicated during 2 seconds]]<br />
<br />
[[Image:24V 0,5s.jpg|center|thumb|700px| Light emitted when 24V are applicated during 0,5 seconds]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|500px]]<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T16:48:41Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* '''Mid1''': one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''Cch1''': another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''': Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* '''KCl''': another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Caracterització KOH.jpg|cente|thumb|500px| Light emitted under diferent concentrations of the chemical input]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|500px]]<br />
<br />
[[Image:1,5V 10s.jpg|500px]]<br />
<br />
[[Image:4,5V 5s.jpg|500px]]<br />
<br />
[[Image:10V 1s disc.jpg|500px]]<br />
<br />
[[Image:10V 2s.jpg|500px]]<br />
<br />
[[Image:24V 0,5s.jpg|500px]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|center|thumb|700px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|center|thumb|700px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|center|thumb|700px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|center|thumb|700px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|center|thumb|700px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|500px]]<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]</div>Guimar3http://2009.igem.org/File:Caracteritzaci%C3%B3_KOH.jpgFile:Caracterització KOH.jpg2009-10-20T16:47:13Z<p>Guimar3: </p>
<hr />
<div></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T16:42:21Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* Mid1: one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* Cch1: another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* EDTA: Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* KCl: another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|500px]]<br />
<br />
[[Image:1,5V 10s.jpg|500px]]<br />
<br />
[[Image:4,5V 5s.jpg|500px]]<br />
<br />
[[Image:10V 1s disc.jpg|500px]]<br />
<br />
[[Image:10V 2s.jpg|500px]]<br />
<br />
[[Image:24V 0,5s.jpg|500px]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|thumb|500px| Our yeasts with coelentrazine ]]<br />
<br />
[[Image:Wt-coe cont.jpg|thumb|500px| Our yeastse without coelenterazine]]<br />
<br />
[[Image:SD+coe cont.jpg|thumb|500px| Medium with coelenterazine]]<br />
<br />
[[Image:Cch1 cont.jpg|thumb|500px| Mutant yeasts, deficients in calcium channels]]<br />
<br />
[[Image:Comparació disc.jpg|thumb|500px| Comparation of the results]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|500px]]<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T16:37:30Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* Mid1: one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* Cch1: another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* EDTA: Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* KCl: another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|500px]]<br />
<br />
[[Image:1,5V 10s.jpg|500px]]<br />
<br />
[[Image:4,5V 5s.jpg|500px]]<br />
<br />
[[Image:10V 1s disc.jpg|500px]]<br />
<br />
[[Image:10V 2s.jpg|500px]]<br />
<br />
[[Image:24V 0,5s.jpg|500px]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Wt cont.jpg|500px]]<br />
<br />
[[Image:Wt-coe cont.jpg|500px]]<br />
<br />
[[Image:SD+coe cont.jpg|500px]]<br />
<br />
[[Image:Cch1 cont.jpg|500px]]<br />
<br />
[[Image:Comparació disc.jpg|500px]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|500px]]<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T16:33:45Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* Mid1: one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* Cch1: another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* EDTA: Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* KCl: another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
<br />
===Electrical input===<br />
<br><br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
[[Image:1,5V 5st.jpg|500px]]<br />
<br />
[[Image:1,5V 10s.jpg|500px]]<br />
<br />
[[Image:4,5V 5s.jpg|500px]]<br />
<br />
[[Image:10V 1s disc.jpg|500px]]<br />
<br />
[[Image:10V 2s.jpg|500px]]<br />
<br />
[[Image:24V 0,5s.jpg|500px]]<br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Comparació disc.jpg|500px]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|500px]]<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:10V 2s.jpg|600px]]<br />
<br />
[[Image:24V 0,5s.jpg|600px]]<br />
<br />
[[Image:Wt cont.jpg|600px]]<br />
<br />
[[Image:Wt-coe cont.jpg|600px]]<br />
<br />
[[Image:SD+coe cont.jpg|600px]]<br />
<br />
[[Image:Cch1 cont.jpg|700px]]<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]<br />
<br />
[[Image:Exp Arinyo.jpg|600px]]<br />
<br />
[[Image:Comparació koh.jpg|600px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T16:31:05Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* Mid1: one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* Cch1: another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* EDTA: Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* KCl: another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
<br />
===Electrical input===<br />
<br />
<br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
<br />
(Gràfiques) <br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
[[Image:Comparació disc.jpg|500px]]<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
[[Image:Manteniment resposta disc.jpg|500px]]<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:10V 2s.jpg|600px]]<br />
<br />
[[Image:24V 0,5s.jpg|600px]]<br />
<br />
[[Image:Wt cont.jpg|600px]]<br />
<br />
[[Image:Wt-coe cont.jpg|600px]]<br />
<br />
[[Image:SD+coe cont.jpg|600px]]<br />
<br />
[[Image:Cch1 cont.jpg|700px]]<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:1,5V 5st.jpg|600px]]<br />
<br />
[[Image:1,5V 10s.jpg|600px]]<br />
<br />
[[Image:4,5V 5s.jpg|600px]]<br />
<br />
[[Image:10V 1s disc.jpg|600px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]<br />
<br />
[[Image:Exp Arinyo.jpg|600px]]<br />
<br />
[[Image:Comparació koh.jpg|600px]]</div>Guimar3http://2009.igem.org/File:Manteniment_resposta_disc.jpgFile:Manteniment resposta disc.jpg2009-10-20T16:29:22Z<p>Guimar3: </p>
<hr />
<div></div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T11:47:57Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
<br />
[under construction]<br />
<br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* Mid1: one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* Cch1: another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* EDTA: Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* KCl: another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
<br />
===Electrical input===<br />
<br />
<br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
<br />
(Gràfiques) <br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
<br />
(Gràfica del discontinu en els mutants, etc)<br />
<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
(Gràfica de la repetibilitat en electricitat)<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:10V 2s.jpg|600px]]<br />
<br />
[[Image:24V 0,5s.jpg|600px]]<br />
<br />
[[Image:Wt cont.jpg|600px]]<br />
<br />
[[Image:Wt-coe cont.jpg|600px]]<br />
<br />
[[Image:SD+coe cont.jpg|600px]]<br />
<br />
[[Image:Cch1 cont.jpg|700px]]<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:1,5V 5st.jpg|600px]]<br />
<br />
[[Image:1,5V 10s.jpg|600px]]<br />
<br />
[[Image:4,5V 5s.jpg|600px]]<br />
<br />
[[Image:10V 1s disc.jpg|600px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]<br />
<br />
[[Image:Exp Arinyo.jpg|600px]]<br />
<br />
[[Image:Comparació koh.jpg|600px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T11:47:03Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
The last goal of our project is to make a bio-screen made with cell pixels as we have described. But, before to be able to build this iLCD, we had to characterize the cell light emission if we wanted to control it better.<br />
We thought about two possible ways to make cells produce light: First, the producion of light with a chemical imput and, second, making the cells glow with electricity <br />
<br />
<br />
===Chemical input.===<br />
<br />
In order to make our yeasts produce light, we firstly reproduce experiments made by Viladevall et al, After a lot of different tries, we finally could characterize the luminiscence curve in a discontinuos luminometer. <br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see in the graphic, a peak of light is emited about 450 seconds before adding 60 microliters of KOH to 170 microliters of medium with WT transformed yeasts. Although we were almost sure that the mechanism that triggered that flash of light was the expected, we found properly make the same experiment with different kind of controls and make sure we were not observing any artiffact:<br />
<br />
* Mid1: one mutant for a Calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* Cch1: another mutant for Calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* EDTA: Aulthough every compound necessary for the reaction is present (including Ca2+ channels) light is not emited because EDTA is a divalent ion quelant, so Ca2+ is quenched and not useful for the emission.<br />
<br />
* KCl: another negative control. The Absence of the -OH group prevents the oppening of calcium channels and makes yeasts produce no light.<br />
<br />
<br />
<br />
But we wanted to characterize in detail this kind of response.<br />
To complete the work with the chemical input, we though KOH amounts could influence in the quantity of emited light, so we repited the experiment with different concentrations of KOH.<br />
<br />
[[Image:Comparació koh.jpg|500px]]<br />
<br />
As we can see, the volume of added KOH (from 15 microliters to 120) is related to the luminiscent peak. Although there is not directly proporcional, luminiscence intensity is increased when we increase the quantity of KOH we put in the sample (always 170 microliters of medium with yeasts).<br />
<br />
Characterizasing the response to the KOH we also found interesting to determinate the reproducibility of the process.<br />
<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]<br />
<br />
<br />
By adding 30 microliters of KOH at the time where the rows indicates us, we discovered that before the first peak, cells couldn’t return to the basals levels, and every new shock make yeasts produce light in higher levels than the last one.<br />
<br />
<br />
===Electrical input===<br />
<br />
<br />
When the experiments with an alkali input showed us that yeasts were able to produce light because of their transformation, we tried with our ambitious goal: stimulate calcium channels with an electrical input.<br />
<br />
We reproduced the mentionated Arinyo’s protocol, incubating the transformed yeasts with coelenterazine, but changing the KOH by electricity. Surprisingly, we found that light was also produce in a very similar way. We tryied with different times and voltages in order to find the optim conditions for a big peak of light. Some of our graphics are theese:<br />
<br />
<br />
(Gràfiques) <br />
<br />
We realised that the time of exposure to the electrical stimulus was crucial, even more that the aplied voltage. That means, if we increased the voltage at very short times, cells could produce a more abrupt peak of light. But if we increased the time of exposure to the electricity, we observe a less defined response, with more flattened peaks. That’s probably because a big exposure time of electrical input damages and killes the yeasts, making them to release their components to the medium, including the aequorin-coelenterazine-Ca2+ complex, so the emission of light is more uniform in time, instead of the production of the flash produced by the Calcium enetering in the cell.<br />
In the case of very little voltages (like 1,5V) this observation is not carried out by our yeasts. The reason must be that the electrical input is too low, so yeasts don’t die so easily as with more elevated voltage, and a better response is produce with a more prolongated electrical shock.<br />
<br />
[[Image:6V variats disc.jpg|500px]]<br />
<br />
This graphic clearly show us that using a same voltage, we obtain a better response with the shortest time of the electrical input. <br />
<br />
Our controls discard the idea of an artifact. For example, light could be made by a spark produced during the discharge. It was not very probable, because the peak observed was produce near 400 seconds before of the stimulus. But, another time, when cells without coelenterazine or mutants are used, we see no light.<br />
<br />
<br />
(Gràfica del discontinu en els mutants, etc)<br />
<br />
<br />
<br />
Studying the repetibility of the process, this is a little different from the chemical stimulus, but the system has a similar behaviour, and we can stimulate several times the same sample getting a response. However, every nex shock produces a fewer peak of light. We hace two hypothesis: one of them is that a part of our yeasts die meanwhile the electrical stimulus. The other one is that coelenterazine is not reusable, so a proportion of it runs down in every emission of light.<br />
<br />
(Gràfica de la repetibilitat en electricitat)<br />
<br />
===SCREEN===<br />
<br />
Using that information and ability of our yeasts, we decided to design a bio-screen, where every single pixel was composed of a group of luminiscent cells and individualy stimulated with a cable. We could, then, control which pixel gets iluminated, forming the image/picture we want (whose resolution depends on the number of pixels we have).<br />
<br />
This simple mechanism is the first example of electronic communication between computers and single celled organisms. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
'''It is just like a bacterial photographic system, but it's digital.''' Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
And, the chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
[[Image:10V 2s.jpg|600px]]<br />
<br />
[[Image:24V 0,5s.jpg|600px]]<br />
<br />
[[Image:Wt cont.jpg|600px]]<br />
<br />
[[Image:Wt-coe cont.jpg|600px]]<br />
<br />
[[Image:SD+coe cont.jpg|600px]]<br />
<br />
[[Image:Cch1 cont.jpg|700px]]<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:1,5V 5st.jpg|600px]]<br />
<br />
[[Image:1,5V 10s.jpg|600px]]<br />
<br />
[[Image:4,5V 5s.jpg|600px]]<br />
<br />
[[Image:10V 1s disc.jpg|600px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]<br />
<br />
[[Image:Exp Arinyo.jpg|600px]]<br />
<br />
[[Image:Comparació koh.jpg|600px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T11:40:08Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:60px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
[[Image:10V 2s.jpg|600px]]<br />
<br />
[[Image:24V 0,5s.jpg|600px]]<br />
<br />
[[Image:Wt cont.jpg|600px]]<br />
<br />
[[Image:Wt-coe cont.jpg|600px]]<br />
<br />
[[Image:SD+coe cont.jpg|600px]]<br />
<br />
[[Image:Cch1 cont.jpg|700px]]<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:1,5V 5st.jpg|600px]]<br />
<br />
[[Image:1,5V 10s.jpg|600px]]<br />
<br />
[[Image:4,5V 5s.jpg|600px]]<br />
<br />
[[Image:10V 1s disc.jpg|600px]]<br />
<br />
[[Image:6V variats disc.jpg|600px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]<br />
<br />
[[Image:Exp Arinyo.jpg|600px]]<br />
<br />
[[Image:Comparació koh.jpg|600px]]<br />
<br />
[[Image:Repetibilitat KOH.jpg|600px]]</div>Guimar3http://2009.igem.org/File:Repetibilitat_KOH.jpgFile:Repetibilitat KOH.jpg2009-10-20T11:39:33Z<p>Guimar3: </p>
<hr />
<div></div>Guimar3http://2009.igem.org/Team:Valencia/AcknowledgementsTeam:Valencia/Acknowledgements2009-10-20T11:34:16Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:700px"><br />
=='''Acknowledgements'''== <br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
* [http://quiro.uab.es/jarino/Joaquin Joaquin Ariño] and Asier ([http://www.blues.uab.es/~imbb23/ Departamento de Bioquimica y Biologia Celular]), Universidad Autonoma de Barcelona. These project wouldn't have been possible without the continuos help and support of the group of Joaquin Ariño in UAB (Universitat Autònoma de Barcelona). The paper 'Characterization of the Calcium-mediated Response to Alkaline Stress in Saccharomyces cerevisiae' by Viladevall, et al, has been our bible during these months. Asier and Joaquin have been extremely kind and have always helped us with the protocol, our results or even emotinal support when things didn't go as expected. Again, without them this project wouldn't have been possible.<br />
<br />
* [http://www.upv.es Universitat Politècnica de València].<br />
<br />
* [http://www.uv.es Universitat de València].<br />
<br />
* [http://www.etsii.upv.es Escuela Tecnica Superior de Ingenieros Industriales de la Universidad Politécnica de Valencia].<br />
<br />
* Instituto de Bioingeniería y Tecnología orientada al ser humano. Universidad Politécnica de Valencia.<br />
<br />
* Alba Crespo Molto for her help in the visual field.<br />
<br />
* Vicerectorado de Investigación desarrollo e innovación de la Universidad Politécnica de Valencia.<br />
<br />
* [http://www.uv.es/cavanilles Institut Cavanilles de la Universitat de Valencia].<br />
<br />
* Project Ingenio mathematica [http://www.i-math.org/?q=en i-math].<br />
<br />
* European community's Seventh Framework Programme (FP7/2007-2013) under /grant agreement/ nº 212894. Targeting enviromental pollution with engineered microbial systems ''à la carte'' ([http://www.sb-tarpol.eu/ TARPOL]).<br />
<br />
* Sergi Morais Ezquerro, Ángel Maquieira Català and Miguel Ángel González Martínez. Mesuring luminiscense was hard and nearly impossible without the help of the [http://iqma.webs.upv.es/ Instituto de química molecular aplicada] (Applied Molecular Chemistry Institute). They let us use their two luminometers and for the first time we saw the light. We have been more than a month in their laboratory, using their equipment and tools, and they have been always there to help us when we had problems.<br />
<br />
* Raquel Galian. Back when we didn't have our amazing results, we had to look for a suitable mesuring device. Raquel let us the spectoflurimeter, helped us with its function and maintenance and cheer us up when we were down.<br />
<br />
* Irene Murillo. Ninonano helped us with our coelenterazine dissolutions and always welcomed us with a huge smile.</div>Guimar3http://2009.igem.org/Team:Valencia/AcknowledgementsTeam:Valencia/Acknowledgements2009-10-20T11:32:28Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:700px"><br />
=='''Acknowledgements'''== <br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
* [http://quiro.uab.es/jarino/Joaquin Joaquin Ariño] and Asier ([http://www.blues.uab.es/~imbb23/ Departamento de Bioquimica y Biologia Celular]), Universidad Autonoma de Barcelona. These project wouldn't have been possible without the continuos help and support of the group of Joaquin Ariño in UAB (Universitat Autònoma de Barcelona). The paper 'Characterization of the Calcium-mediated Response to Alkaline Stress in Saccharomyces cerevisiae' by Viladevall, et al, has been our bible during these months. Asier and Joaquin have been extremely kind and have always helped us with the protocol, our results or even emotinal support when things didn't go as expected. Again, without them this project wouldn't have been possible.<br />
<br />
* [http://www.upv.es Universitat Politècnica de València].<br />
* [http://www.uv.es Universitat de València].<br />
* [http://www.etsii.upv.es Escuela Tecnica Superior de Ingenieros Industriales de la Universidad Politécnica de Valencia].<br />
* Instituto de Bioingeniería y Tecnología orientada al ser humano. Universidad Politécnica de Valencia.<br />
* Alba Crespo Molto for her help in the visual field.<br />
* Vicerectorado de Investigación desarrollo e innovación de la Universidad Politécnica de Valencia.<br />
* [http://www.uv.es/cavanilles Institut Cavanilles de la Universitat de Valencia].<br />
* Project Ingenio mathematica [http://www.i-math.org/?q=en i-math].<br />
* European community's Seventh Framework Programme (FP7/2007-2013) under /grant agreement/ nº 212894. Targeting enviromental pollution with engineered microbial systems ''à la carte'' ([http://www.sb-tarpol.eu/ TARPOL]).<br />
* Sergi Morais Ezquerro, Ángel Maquieira Català and Miguel Ángel González Martínez. Mesuring luminiscense was hard and nearly impossible without the help of the [http://iqma.webs.upv.es/ Instituto de química molecular aplicada] (Applied Molecular Chemistry Institute). They let us use their two luminometers and for the first time we saw the light. We have been more than a month in their laboratory, using their equipment and tools, and they have been always there to help us when we had problems.<br />
* Raquel Galian. Back when we didn't have our amazing results, we had to look for a suitable mesuring device. Raquel let us the spectoflurimeter, helped us with its function and maintenance and cheer us up when we were down.<br />
* Irene Murillo. Ninonano helped us with our coelenterazine dissolutions and always welcomed us with a huge smile.</div>Guimar3http://2009.igem.org/Team:Valencia/AcknowledgementsTeam:Valencia/Acknowledgements2009-10-20T09:03:19Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:600px"><br />
=='''Acknowledgements'''== <br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:600px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
* [http://quiro.uab.es/jarino/Joaquin Joaquin Ariño] ([http://www.blues.uab.es/~imbb23/ Departamento de Bioquimica y Biologia Celular]), Universidad Autonoma de Barcelona.<br />
* [http://www.upv.es Universitat Politècnica de València].<br />
* [http://www.uv.es Universitat de València].<br />
* [http://www.etsii.upv.es Escuela Tecnica Superior de Ingenieros Industriales de la Universidad Politécnica de Valencia].<br />
* Instituto de Bioingeniería y Tecnología orientada al ser humano. Universidad Politécnica de Valencia.<br />
* Alba Crespo Molto for her help in the visual field.<br />
* Vicerectorado de Investigación desarrollo e innovación de la Universidad Politécnica de Valencia.<br />
* [http://www.uv.es/cavanilles Institut Cavanilles de la Universitat de Valencia].<br />
* Project Ingenio mathematica [http://www.i-math.org/?q=en i-math].<br />
* European community's Seventh Framework Programme (FP7/2007-2013) under /grant agreement/ nº 212894. Targeting enviromental pollution with engineered microbial systems ''à la carte'' ([http://www.sb-tarpol.eu/ TARPOL]).</div>Guimar3http://2009.igem.org/Team:Valencia/AcknowledgementsTeam:Valencia/Acknowledgements2009-10-20T09:03:04Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:600px"><br />
=='''Acknowledgements'''== <br />
<div align="justify" style="position:relative; top:-5px; left:1px; width:600px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
* [http://quiro.uab.es/jarino/Joaquin Joaquin Ariño] ([http://www.blues.uab.es/~imbb23/ Departamento de Bioquimica y Biologia Celular]), Universidad Autonoma de Barcelona.<br />
* [http://www.upv.es Universitat Politècnica de València].<br />
* [http://www.uv.es Universitat de València].<br />
* [http://www.etsii.upv.es Escuela Tecnica Superior de Ingenieros Industriales de la Universidad Politécnica de Valencia].<br />
* Instituto de Bioingeniería y Tecnología orientada al ser humano. Universidad Politécnica de Valencia.<br />
* Alba Crespo Molto for her help in the visual field.<br />
* Vicerectorado de Investigación desarrollo e innovación de la Universidad Politécnica de Valencia.<br />
* [http://www.uv.es/cavanilles Institut Cavanilles de la Universitat de Valencia].<br />
* Project Ingenio mathematica [http://www.i-math.org/?q=en i-math].<br />
* European community's Seventh Framework Programme (FP7/2007-2013) under /grant agreement/ nº 212894. Targeting enviromental pollution with engineered microbial systems ''à la carte'' ([http://www.sb-tarpol.eu/ TARPOL]).</div>Guimar3http://2009.igem.org/Team:Valencia/AcknowledgementsTeam:Valencia/Acknowledgements2009-10-20T09:01:32Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:70px; width:600px"><br />
=='''Acknowledgements'''== <br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
* [http://quiro.uab.es/jarino/Joaquin Joaquin Ariño] ([http://www.blues.uab.es/~imbb23/ Departamento de Bioquimica y Biologia Celular]), Universidad Autonoma de Barcelona.<br />
* [http://www.upv.es Universitat Politècnica de València].<br />
* [http://www.uv.es Universitat de València].<br />
* [http://www.etsii.upv.es Escuela Tecnica Superior de Ingenieros Industriales de la Universidad Politécnica de Valencia].<br />
* Instituto de Bioingeniería y Tecnología orientada al ser humano. Universidad Politécnica de Valencia.<br />
* Alba Crespo Molto for her help in the visual field.<br />
* Vicerectorado de Investigación desarrollo e innovación de la Universidad Politécnica de Valencia.<br />
* [http://www.uv.es/cavanilles Institut Cavanilles de la Universitat de Valencia].<br />
* Project Ingenio mathematica [http://www.i-math.org/?q=en i-math].<br />
* European community's Seventh Framework Programme (FP7/2007-2013) under /grant agreement/ nº 212894. Targeting enviromental pollution with engineered microbial systems ''à la carte'' ([http://www.sb-tarpol.eu/ TARPOL]).</div>Guimar3http://2009.igem.org/File:Temes_treballs_08_09.pdfFile:Temes treballs 08 09.pdf2009-10-20T08:17:37Z<p>Guimar3: </p>
<hr />
<div></div>Guimar3http://2009.igem.org/Team:ValenciaTeam:Valencia2009-10-20T08:13:02Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM2}}<br />
<br />
<div align="justify" style="position:relative; top:-35px; left:70px; width:500px"><br />
<br />
<center><html><object width="450" height="270"><param name="movie" value="http://www.youtube.com/v/doyubOELLD4&hl=es&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/doyubOELLD4&hl=es&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object></html></center><br />
<br />
<br><br><br />
<br />
== '''iGEM Valencia Lighting Cell Display (iLCD)''' ==<br />
<br><br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana">The <b>iGEM Valencia Lighting Cell Display</b> (<b>iLCD</b>) is our project for the present iGEM competition. We plan to '''control cell behaviour whith an electrical stimulous'''. Our intention is to advance in the development of '''BioElectronics''' allowing enabling bidirectional communication of monocellular organisms and electronic components. <br />
<br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana">To demostrate that this is possible we try to make <b>a “bio-screen” of voltage-activated cells</b>, where every “cellular pixel” produces light. Using electrical signals instead of chemical stimulation, as in the Coliroid project (Levskaya et al, <i>Synthetic biology: Engineering Escherichia coli to see light</i>. <b>Nature</b> 438, 441-442), <b>we will be able to see animated pictures!</b><br />
<br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana"><b>Engineered yeasts that are able to sense and respond to electrical signals will be used</b>. We will design an electronic device which allows the cooperative work of all the cells in such a way that they will be able to <b>reproduce an image in movement, building up a "bio-screen" for the first time in history</b>.<br />
<br />
<br />
<html><br />
<head><br />
<script type="text/javascript"><br />
<br />
function mouseOverBanner()<br />
{<br />
document.getElementById("b11").src="https://static.igem.org/mediawiki/2009/8/89/Logo_banner.jpg"<br />
}<br />
function mouseOutBanner()<br />
{<br />
document.getElementById("b11").src="https://static.igem.org/mediawiki/2009/5/51/Manel_Logo.JPG"<br />
}<br />
<br />
</script><br />
</head><br />
<br />
<body style=" background-color: black"><br />
<div style="position:relative; left:68px"><br />
<table border="0" cellpadding="0" cellspacing="0" width="400px" height="400px" ><br />
<tr><br />
<td><a href="https://2009.igem.org/Team:Valencia" target="_top" onmouseover="mouseOverBanner()"<br />
onmouseout="mouseOutBanner()"><br />
<img border="0" alt="iLCD" src="https://static.igem.org/mediawiki/2009/5/51/Manel_Logo.JPG" width="400" id="b11" /></a></td><br />
</tr><br />
</table><br />
<br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana">We are also going to reflect on the perception that different groups of people, from a variety of educational levels and professional areas, have of Synthetic Biology. For this reason, <b>we have made a survey that has already finished</b> that we are sure will be of interest.<br />
<br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana"><b>Is important to note that iLCD will be a major advance in Synthetic Biology, opening the field of ''BioElectronics'', integrating electrical signals with cell behaviours</b>. Furthermore, this will reduce the response time of the cells to the activation signal by up to two orders of magnitude, as well as foster the combination of Electronics and Biology.<br />
<br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana">In resume, we have two objectives: control cell behaviour whith electrical stimulous and reduce the time of response respect a previous projects.<br />
<br />
</span> <br />
<br />
<html><br />
<br />
<div style="position:relative; margin-left:620px; top:110px"><br />
<object type="application/x-shockwave-flash" height="110" width="220" data="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf"><br />
<param name="movie" value="http://www.usflashmap.com/component/cdt_new/cdt2_1.swf" /><br />
<param name="base" value="http://www.usflashmap.com/component/cdt_new/" /><br />
<param name="flashvars" value="<br />
&timer=1&<br />
&time_template=3:ss;2:mm;1:hh;0:dd&<br />
&time_color=0x000000&<br />
&label_color=0x000000&<br />
&background_color=0xFFFFFF&<br />
&flare_view=true&<br />
&time_label=d:DAY;h:HOUR;m:MIN;s:SEC&<br />
&time_zone=(GMT +01:00) Brussels, Copenhagen, Madrid, Paris&<br />
&event_time=year:2009;month:10;day:30;hour:0;minute:0;seconds:0&<br />
&event_duration=year:0;month:0;day:0;hour:0;minute:0;seconds:0&<br />
&event_recursion=hourly&<br />
&onpress_url=-&<br />
&event_onpress_url=-&<br />
&title=TIME LEFT&<br />
&event_title=IGEM STARTS &<br />
&sound_file=-&<br />
&event_sound_file=-&<br />
&transparent=true&<br />
" /><br />
<param name="quality" value="high" /><br />
<param name="wmode" value="transparent" /><br />
<param name="scale" value="noscale" /><br />
<param name="salign" value="lt" /><br />
</object><br />
</div><br />
<br />
</html><br />
<br />
<br />
<html><br />
<head><br />
</head><br />
<body><br />
<div style="position:relative; top:-35px; left:-70px;"><br />
<div id = "clustrback" style="margin: 200 auto; width:298px; height:219px; overflow:hidden; background:#ffffff url(http://clustrmaps.com/admin/3d/images/scpt_style1_gradient_black.png) center no-repeat; text-align:center;"><br />
<a href="http://www3.clustrmaps.com/counter/maps.php?url=https://2009.igem.org/Team:Valencia" style="width:160px; display:block; margin: 0 auto;" id="clustrMapsLink"><br />
<img src="http://www3.clustrmaps.com/counter/index2.php?url=https://2009.igem.org/Team:Valencia" style="border:1px; margin: 0 auto; alt="Locations of visitors to iGEM09 Valencia" title="Locations of visitors to iGEM09 Valencia" id="clustrMapsImg" class="reflect rheight60 ropacity60"/><br />
</a><br />
</div><br />
</div><br />
</body><br />
</html><br />
<br />
<br />
<div style="position:absolute; top:50px; left:600px; overflow:hidden"><br />
<table cellpadding="10" cellspacing="10"><br />
<tr><br />
<td>[https://2009.igem.org/Team:Valencia/TeamVal https://static.igem.org/mediawiki/2009/2/20/PolaroidTeam.png]</td><br />
</tr><br />
<br />
<tr><br />
<td><html><a href="http://igemvalencia.questionpro.com" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/3/34/V_GoldMedal.jpg" width="250" height="280"></a></html></td><br />
</tr> <br />
<br />
<tr><br />
<td><html><a href="https://2009.igem.org/Team:Valencia/Human" target="_top"> <img src="https://static.igem.org/mediawiki/2009/7/7c/V_TopRanking.jpg" width="260" height="150"></a></html></td><br />
</tr><br />
<br />
<br />
</table><br />
</div><br />
<br />
<br />
<br />
<!--[[Image:Logo_banner.jpg|400px|center]]--><br />
<!--<br />
<html><center><a href="http://igemvalencia.questionpro.com" target="_top"> <img src="https://static.igem.org/mediawiki/2009/7/7d/V_MedalRanking.jpg" width="250" height="310"></a></center></html><br />
--><br />
<!-- <div style="position:absolute;top:250px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --><br />
<!-- </div> --><br />
<!-- <script type="text/javascript" src="http://clustrmaps.com/admin/3d/js/clustrmaps.js"></script> --><br />
<!-- <script type="text/javascript" src="http://clustrmaps.com/admin/3d/js/clustrmaps.js"></script> --><br />
<!-- <body><br />
<div style="position:relative; top:-35px; "><br />
<div id = "clustrback" style="margin: 200 auto; width:350px; height:219px; overflow:hidden; center no-repeat; text-align:center;"><br />
<a href="https://2009.igem.org/Team:Valencia/logos" style="width:160px; display:block; margin: 0 auto;" id="clustrMapsLink"><br />
<img src="https://static.igem.org/mediawiki/2009/8/8c/Manel_Logo4.JPG" style="border:1px; margin: 0 auto; alt="Logos that have been proposed" title="Logos that have been proposed"id="clustrMapsImg" class="reflect rheight60 ropacity60"/><br />
</a><br />
</div><br />
</div><br />
</body> --><br />
<!-- <tr><td><html><a href="http://igemvalencia.questionpro.com" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/f/fc/Survey_iGEM09.jpg" width="201" height="201"></a></html></td></tr> --></div>Guimar3http://2009.igem.org/Team:Valencia/SimulationsTeam:Valencia/Simulations2009-10-20T08:08:39Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-5px; left:80px; width:800px"><br />
<span style="color:black; align:justify; font-size:10pt; font-family:Verdana"><br />
<br />
<b>Try Your Own Simulations</b><br />
<br><br><br />
Here you have a "demo" where you can see our system's response with differents parameters (a further explanation is available below):<br />
<div align="justify" style="position:relative; top:-822px; left:80px; width:780px"><br />
<div align="right"><br />
<embed src="https://static.igem.org/mediawiki/2009/b/bd/Carrousel_modelling_valencia.swf" type="application/x-shockwave-flash" width="750" height="550"></embed><br />
<br><br><br />
<center><br />
Click on the following image to download the application and try your own simulations! <br />
</center><br />
</div><br />
<div align="center" style="position:relative; top:15px;"><br />
<html><a href="https://static.igem.org/mediawiki/2009/0/05/Matlab_modelling_interface.zip" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/4/4f/InterfaceGuide.gif" width="600" height="400"></a></html><br />
<br />
<br />
== '''Our Simulations''' ==<br />
<br />
Before simulating how intracellular calcium concentration changes in time, we have approximated the '''excitatory post-synaptic potential''' function (our "input" in neurons) as follows: <br />
<br />
[[Image:Voltage_neurons.jpg|480px|center]]<br />
<br />
Then, taking into account all the factors listed in [https://2009.igem.org/Team:Valencia/OurModel '''Our Model'''] (Calcium current through VDCCs, Calcium Buffering and Calcium pumps), the result of simulating '''free intracellular calcium concentration''' after the electrical stimulation in '''neurons''' is this: <br />
<br />
<br />
[[Image:Calcium_neurons.jpg|520px|center]]<br />
<br />
<br />
On the other hand, '''cardiomyocytes''' have a '''different response''' to an electrical stimulus, as now our “input” '''voltage function''' is different: unlike neurons, its plasma membrane is held at a high voltage for a few hundred milliseconds.<br />
<br />
[[Image:Voltage_muscle.jpg|540px|center]]<br />
[[Image:Calcium_muscle.jpg|560px|center]]<br />
<br />
<br />
The numeric values for the '''simulation parameters''' are shown in the following table:<br />
<br />
[[Image:Tabla.jpg|center|300px]]</div>Guimar3http://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-20T08:03:58Z<p>Guimar3: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<div align="justify" style="position:relative; top:-5px; left:10px; width:800px; color:black; font-size:10pt; font-family: Verdana"><br />
<br><br />
[[Image:10V 2s.jpg|600px]]<br />
<br />
[[Image:24V 0,5s.jpg|600px]]<br />
<br />
[[Image:Wt cont.jpg|600px]]<br />
<br />
[[Image:Wt-coe cont.jpg|600px]]<br />
<br />
[[Image:SD+coe cont.jpg|600px]]<br />
<br />
[[Image:Cch1 cont.jpg|700px]]<br />
<br />
[[Image:Combinació.jpg|700px]]<br />
<br />
[[Image:1,5V 5st.jpg|600px]]<br />
<br />
[[Image:1,5V 10s.jpg|600px]]<br />
<br />
[[Image:4,5V 5s.jpg|600px]]<br />
<br />
[[Image:10V 1s disc.jpg|600px]]<br />
<br />
[[Image:6V variats disc.jpg|600px]]<br />
<br />
[[Image:Comparació disc.jpg|600px]]<br />
<br />
[[Image:Exp Arinyo.jpg|600px]]<br />
<br />
[[Image:Comparació koh.jpg|600px]]</div>Guimar3http://2009.igem.org/File:Combinaci%C3%B3.jpgFile:Combinació.jpg2009-10-20T07:58:33Z<p>Guimar3: uploaded a new version of "Image:Combinació.jpg"</p>
<hr />
<div></div>Guimar3