http://2009.igem.org/wiki/index.php?title=Special:Contributions/Naw3&feed=atom&limit=50&target=Naw3&year=&month=2009.igem.org - User contributions [en]2024-03-29T15:41:40ZFrom 2009.igem.orgMediaWiki 1.16.5http://2009.igem.org/Team:Newcastle/Promoter_LibraryTeam:Newcastle/Promoter Library2009-10-22T01:05:47Z<p>Naw3: /* Introduction */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Promoter Library=<br />
<br />
==Introduction==<br />
<br />
In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement ''in vivo''. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions. <br />
<br />
Several efforts to produce parts libraries are currently underway. As part of our contribution to synthetic biology, we decided to create a promoter library for ''B. subtilis''.<br />
<br />
==Novelty in this sub-project==<br />
The novelty in this sub-project lies in the generation of a large number of ''B. subtilis'' promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in ''B. subtilis''. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences.<br />
<br />
==Design==<br />
<br />
Template used to create the promoter sequences:<br />
<br />
'''Prefix...UpSpacer...-35...PromSpacer...-10...DownSpacer..Suffix'''<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library1.png|500px]]<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library2.png|500px]]<br />
<br />
<br />
* '''BBPrefix''' - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag<br />
* '''UpSpacer''' - attta - consensus sigA 5 bases 5'<br />
* '''-35''' - TTGACA<br />
* '''PromSpacer''' - length 17 - consensus ttttatttaaattatga<br />
* '''-10''' - TATAAT<br />
* '''DownSpacer''' (from ackA)- ggaaaag<br />
* '''BBSuffix''' - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag<br />
<br />
===Variants===<br />
We designed three degenerate sequences to create a library of promoters which we hope will have different strengths.<br />
<br />
====Variant 1 ====<br />
In this variant we only modified the -35 and -10 consensus sequences.<br />
<br />
BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library3.png]]<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library4.png|500px]]<br />
<br />
<br />
====Variant 2 ====<br />
In the second variant we modified the promoter sequence between the -35 and -10 regions.<br />
<br />
BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library5.png|500px]]<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library7.png|500px]]<br />
<br />
<br />
====Variant 3 ====<br />
In the third variant we changed the last two bases of the minus 35 region and the first two bases of the -10 region.<br />
<br />
BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix<br />
<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library6.png|500px]]<br />
<br />
==Lab Work Strategies==<br />
*Synthesis other strand using polymerase and a primer<br />
<br />
[[Image:Team_Newcastle_iGEM_Promoter_Library8.png|500px]]<br />
<br />
* Cut promoter fragments using EcoR1 and Pst1<br />
* Cut pSB1AT3 vector using EcoR1 and Pst1<br />
* Ligate the insert and the plasmid backbone, and transform ''E. coli'' DH5alpha<br />
* Subclone into ''Bacillus'' integration vector with gfp and insert at ''amyE''<br />
<br />
==Progress==<br />
The consensus and variant sequences were designed and ordered from GeneArt. Once received they were PCRd, but we ran out of time, and the library has not been characterised.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/MetalsTeam:Newcastle/Metals2009-10-22T00:57:39Z<p>Naw3: /* Cloning and Integration */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Metal Sequester=<br />
<br />
==Introduction==<br />
<br />
In order to take up and keep the cadmium from the soil efficiently, we needed to think about a way to cross-link the metal ions to intra-cellular proteins which would end up for the most of it in the spore. If the heavy metal ions were not cross linked to a "sponge protein", it could be lethal to the cell at lower concentration and the cell could end up sporulating too early, or even bursting in the soil, releasing all the heavy metal it has taken up.<br />
<br><br />
From our meeting with Prof. Nigel Robinson on the 18th of March 2009, it was evident that the best way of getting cadmium into the spore is to express a metallothionein, which would 'soak up' the cadmium, which in turn would be trapped within the protein in the spore.<br />
<br />
==Novelty in this sub-project==<br />
To increase the efficiency of our system in sequestering the heavy metal cadmium from the soil, we divised a plan to make sure that most of the metal ions that have been taken in our ''B.subtilis'' cell is then rendered bio-unavailable by incorporating it into ''smtA'' metallothionein. <br />
<br><br />
<br><br />
SmtA metallothionein protein from ''E. coli'' can bind to heavy metals [1,2,3]. They have a tendency to bind to cationic metal ions such as cadmium, copper, arsenic, mercury, silver.<br />
<br><br />
<br><br />
It has been shown that in ''B. subtilis'', in order to express a specific protein in the spore coat, it is possible to make a fusion protein with a spore coat protein called ''CotC'', and a group have successfully expressed antigen proteins which are about the same size as our ''smtA'' metallothionein in order to make a vaccine[4]. By fusing CotC spore coat protein from ''Bacillus subtilis'', our ''smtA'' metallothionein can be localized to the spore coat, hence we hoped to successfully trap most of the metals ions into the bacterial spores. <br />
<br><br />
<br>CotC was also fused with GFP reporter gene in order to detect the expression of the fusion protein into the spores using a fluorescence microscopy. <br />
<br><br />
<br><br />
Because we want most of the metals to go into the spore rather than the vegetative cell, we designed our fusion protein so that it is controlled by the native ''cotC'' promoter sigK which is activated in sporulation conditions. Therefore, our ''smtA'' metal sequester would only be expressed once the cell have made the decision to become a metal container and sporulate, and only be expressed in the spore.<br />
<br><br />
<br><br />
Finally, our construct integrated the ''B. subtilis'' genome through homologous recombination at the native ''CotC'' gene. However, as we will be using pMutin4 integration vector, there will be two different copies of the ''cotC'' gene in our engineered ''B.subtilis'' genome: a native copy of ''cotC'' and our engineered ''CotC-GFP-smtA'' fusion copy. We chose not to knock-out the native ''CotC'' gene because the lack of native CotC might lead to defects in spore coat formation.<br />
<br />
==BioBrick constructs==<br />
[[Image:Newcastle SmtA-construct.png|center|500px]]<br />
<br />
In the parts registry, BBa_K174008:<br />
<br />
[[Image:Newcastle Metal sequester7.JPG|center|500px]]<br />
<br />
==Lab Work Strategies==<br />
<br><br />
===Construction===<br />
<br><br />
<br />
Synthesised by GeneArt, fragment: 1385 bp DNA<br />
<br />
Clone Manager construct and cut map:<br />
[[Image:Newcastle Metal sequester1.JPG|center|500px]]<br />
<br />
Sequencher construct:<br />
<br />
[[Image:Newcastle Metal sequester21.JPG|center|500px]]<br />
<br />
<br />
===Cloning and Integration===<br />
GeneArt cloned the vector into a standard biobrick vector. We sent them Plasmid pSB1AT3 with part BBa_J04450 (mCherry).<br />
<br />
BBa_J04450 in pSB1AT3 Clone Manager plamid map:<br />
<br />
[[Image:Newcastle Metal sequester3.JPG|center|500px]]<br />
<br />
Once we received this fragment cloned in pSBAT3 we amplified the part by PCR. Primer 1 will incorporate a HinDIII site and primer 2 will incorporate a BamHI. Checked that these enzymes don’t cut the fragment:<br />
<br />
[[Image:Newcastle Metal sequester4.JPG|center|500px]]<br />
<br />
We cut the PCR fragment and clone into pMutin4 cut with the same enzymes (diagram below is pMutin2 but this is essentially the same)<br />
<br />
[[Image:Newcastle Metal sequester5.JPG|center|500px]]<br />
<br />
We then integrate into the 168 chromosome using homology between our cotC fusion and the native copy of cotC.<br />
<br />
===Testing and Characterisation===<br />
Once transformed the spores of the mutant will need to be tested for fluorescence.<br />
Two obvious methods:<br />
<br />
1) Fluorescence microscopy: grow the cells in sporulation medium and look under the microscope for fluorescent spores. <br />
<br><br />
2) Purify spores and measure their fluorescence in a fluorescence plate reader.<br />
<br><br />
3) We would also test whether the strain is able to absorb cadmium in the spores when compared to the wild-type.<br />
<br><br />
==Lab Work Done==<br />
{| class=wikitable border="1"<br />
|-<br />
! colspan="2" | Summary of Lab Sessions for Metal Sequestering<br />
|-<br />
| <center>'''Date'''</center><br />
| <center>'''Description'''</center> <br />
|-<br />
| '''[https://2009.igem.org/Team:Newcastle/Labwork/9_September_2009#Metal_Sensor_Team 9th September 2009]'''<br />
| Arrival of ''cotC-GFP-smtA'' BioBrick - transformed this into ''DH5-alpha E. coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/10_September_2009#Metal_Sensor_Team 10th September 2009]'''<br />
| Used colonies of ''cotC-GFP-smtA'' transformants to inoculate LB media in preparation for mini and midi-preps<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/11_September_2009#Metal_Sensor_Team 11th September 2009]'''<br />
| Mini and midi-prepped ''cotC'' BioBrick and PCR amplified ''cotC'' BioBrick, giving it restriction ends; <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/14_September_2009#Metal_Sensor_Team 14th September 2009]'''<br />
| Ligated ''cotC'' into ''pMUTIN4'' plasmid and attempted ''E. coli'' transformation<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/15_September_2009#Metal_Sensor_Team 15th September 2009]'''<br />
| Transformations seemed to have work; picked 12 colonies from 200ul plate and inoculated 12 tubes of 5ml LB + ampicillin<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/16_September_2009#Metal_Sensor_Team 16th September 2009]'''<br />
|Mini-preps of 12 picked colonies and restriction enzyme digest analysis - gel showed consistent bands so prepared midi-prep cultures<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/17_September_2009#Metal_Sensor_Team 17th September 2009]'''<br />
| Midi-prepped potential ''cotC-GFP-smtA'' transformant ''E. coli'' culture and digested with ''BamHI'' and ''HindIII''<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/18_September_2009#Metal_Sensor_Team 18th September 2009]'''<br />
|Analysed digested midi-prep sample through DNA gel electrophoresis - negative results<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/28_September_2009 28th September 2009]'''<br />
|Picked 10 colonies of potential ''cotC'' in ''pMUTIN4'' ''E. coli'' transformants and inoculated 10 tubes of LB + amp with them<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/29_September_2009 29th September 2009]'''<br />
|Conducted mini-preps of 10 cultures of potential transformants and analysed them through restriction digests and gel electrophoresis - did not work<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/1_October_2009#Ligations 1st October 2009]'''<br />
|Checked ''pMUTIN4'' and ''cotC'' on gel; carried out another ligation <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/2_October_2009 2nd October 2009]'''<br />
|Used ligation products to transform more ''E. coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/5_October_2009 5th October 2009]'''<br />
|Attempted transformations failed<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/6_October_2009#Formal_Lab_Session_-_6th_October_2009 6th October 2009]'''<br />
|Conducted ''pMUTIN4'' midi-prep again and transformed ''E. coli'' with ''cotC'' in ''pSB1AT3'' (newly arrived from GeneArt)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/7_October_2009 7th October 2009]'''<br />
| Transformations of ''E. coli'' with ''cotC'' in ''pSB1AT3'' worked - inoculated LB with these colonies for mini and midi-preps. Also PCR amplified the ''cotC'' BioBrick with restriction sites.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/8_October_2009 8th October 2009]'''<br />
|Digested newly midi-prepped ''pMUTIN4'' and also midi-prepped ''cotC'' in ''pSB1AT3'' (from GeneArt)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/9_October_2009 9th October 2009]'''<br />
|Ran digested ''cotC'' PCR product (made on 07/10/09) on gel and excised band.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/12_October_2009 12th October 2009]'''<br />
|Because the ''cotC-GFP-smtA'' + ''pMUTIN4'' digests haven't been working, the team plated out some new ''E. coli'' + ''pMUTIN4'' cells.<br />
|-<br />
|}<br />
<br />
===References===<br />
<br />
<font color="gray"><br />
1- Cretì, P., F. Trinchella, et al. "Heavy metal bioaccumulation and metallothionein content in tissues of the sea bream Sparus aurata from three different fish farming systems." Environmental Monitoring and Assessment. <br />
<br><br />
<br><br />
2- Morby, A. P., J. S. Turner, et al. (1993). SmtB is a metal-dependent repressor of the cyanobacterial metallothionein gene smtA: identification of a Zn inhibited DNA-protein complex. 21: 921-925. <br />
<br><br />
<br><br />
3- Waldron, K. J. and N. J. Robinson (2009). "How do bacterial cells ensure that metalloproteins get the correct metal?" Nat Rev Micro 7(1): 25-35. <br><br />
<br><br />
4- Mauriello, E. M. F., L. H. Duc, et al. (2004). "Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner." Vaccine 22(9-10): 1177-1187.<br />
</font><br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/MetalsTeam:Newcastle/Metals2009-10-22T00:56:17Z<p>Naw3: /* Novelty in this sub-project */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Metal Sequester=<br />
<br />
==Introduction==<br />
<br />
In order to take up and keep the cadmium from the soil efficiently, we needed to think about a way to cross-link the metal ions to intra-cellular proteins which would end up for the most of it in the spore. If the heavy metal ions were not cross linked to a "sponge protein", it could be lethal to the cell at lower concentration and the cell could end up sporulating too early, or even bursting in the soil, releasing all the heavy metal it has taken up.<br />
<br><br />
From our meeting with Prof. Nigel Robinson on the 18th of March 2009, it was evident that the best way of getting cadmium into the spore is to express a metallothionein, which would 'soak up' the cadmium, which in turn would be trapped within the protein in the spore.<br />
<br />
==Novelty in this sub-project==<br />
To increase the efficiency of our system in sequestering the heavy metal cadmium from the soil, we divised a plan to make sure that most of the metal ions that have been taken in our ''B.subtilis'' cell is then rendered bio-unavailable by incorporating it into ''smtA'' metallothionein. <br />
<br><br />
<br><br />
SmtA metallothionein protein from ''E. coli'' can bind to heavy metals [1,2,3]. They have a tendency to bind to cationic metal ions such as cadmium, copper, arsenic, mercury, silver.<br />
<br><br />
<br><br />
It has been shown that in ''B. subtilis'', in order to express a specific protein in the spore coat, it is possible to make a fusion protein with a spore coat protein called ''CotC'', and a group have successfully expressed antigen proteins which are about the same size as our ''smtA'' metallothionein in order to make a vaccine[4]. By fusing CotC spore coat protein from ''Bacillus subtilis'', our ''smtA'' metallothionein can be localized to the spore coat, hence we hoped to successfully trap most of the metals ions into the bacterial spores. <br />
<br><br />
<br>CotC was also fused with GFP reporter gene in order to detect the expression of the fusion protein into the spores using a fluorescence microscopy. <br />
<br><br />
<br><br />
Because we want most of the metals to go into the spore rather than the vegetative cell, we designed our fusion protein so that it is controlled by the native ''cotC'' promoter sigK which is activated in sporulation conditions. Therefore, our ''smtA'' metal sequester would only be expressed once the cell have made the decision to become a metal container and sporulate, and only be expressed in the spore.<br />
<br><br />
<br><br />
Finally, our construct integrated the ''B. subtilis'' genome through homologous recombination at the native ''CotC'' gene. However, as we will be using pMutin4 integration vector, there will be two different copies of the ''cotC'' gene in our engineered ''B.subtilis'' genome: a native copy of ''cotC'' and our engineered ''CotC-GFP-smtA'' fusion copy. We chose not to knock-out the native ''CotC'' gene because the lack of native CotC might lead to defects in spore coat formation.<br />
<br />
==BioBrick constructs==<br />
[[Image:Newcastle SmtA-construct.png|center|500px]]<br />
<br />
In the parts registry, BBa_K174008:<br />
<br />
[[Image:Newcastle Metal sequester7.JPG|center|500px]]<br />
<br />
==Lab Work Strategies==<br />
<br><br />
===Construction===<br />
<br><br />
<br />
Synthesised by GeneArt, fragment: 1385 bp DNA<br />
<br />
Clone Manager construct and cut map:<br />
[[Image:Newcastle Metal sequester1.JPG|center|500px]]<br />
<br />
Sequencher construct:<br />
<br />
[[Image:Newcastle Metal sequester21.JPG|center|500px]]<br />
<br />
<br />
===Cloning and Integration===<br />
GeneArt will clone the vector into a standard biobrick vector. We will send them Plasmid pSB1AT3 with part BBa_J04450 (mCherry).<br />
<br />
BBa_J04450 in pSB1AT3 Clone Manager plamid map:<br />
<br />
[[Image:Newcastle Metal sequester3.JPG|center|500px]]<br />
<br />
Once we receive this fragment cloned in pSBAT3 we will amplify the part by PCR. Primer 1 will incorporate a HinDIII site and primer 2 will incorporate a BamHI. Checked that these enzymes don’t cut the fragment:<br />
<br />
[[Image:Newcastle Metal sequester4.JPG|center|500px]]<br />
<br />
We cut the PCR fragment and clone into pMutin4 cut with the same enzymes (diagram below is pMutin2 but this is essentially the same)<br />
<br />
[[Image:Newcastle Metal sequester5.JPG|center|500px]]<br />
<br />
We then integrate into the 168 chromosome using homology between our cotC fusion and the native copy of cotC.<br />
<br />
===Testing and Characterisation===<br />
Once transformed the spores of the mutant will need to be tested for fluorescence.<br />
Two obvious methods:<br />
<br />
1) Fluorescence microscopy: grow the cells in sporulation medium and look under the microscope for fluorescent spores. <br />
<br><br />
2) Purify spores and measure their fluorescence in a fluorescence plate reader.<br />
<br><br />
3) We would also test whether the strain is able to absorb cadmium in the spores when compared to the wild-type.<br />
<br><br />
==Lab Work Done==<br />
{| class=wikitable border="1"<br />
|-<br />
! colspan="2" | Summary of Lab Sessions for Metal Sequestering<br />
|-<br />
| <center>'''Date'''</center><br />
| <center>'''Description'''</center> <br />
|-<br />
| '''[https://2009.igem.org/Team:Newcastle/Labwork/9_September_2009#Metal_Sensor_Team 9th September 2009]'''<br />
| Arrival of ''cotC-GFP-smtA'' BioBrick - transformed this into ''DH5-alpha E. coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/10_September_2009#Metal_Sensor_Team 10th September 2009]'''<br />
| Used colonies of ''cotC-GFP-smtA'' transformants to inoculate LB media in preparation for mini and midi-preps<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/11_September_2009#Metal_Sensor_Team 11th September 2009]'''<br />
| Mini and midi-prepped ''cotC'' BioBrick and PCR amplified ''cotC'' BioBrick, giving it restriction ends; <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/14_September_2009#Metal_Sensor_Team 14th September 2009]'''<br />
| Ligated ''cotC'' into ''pMUTIN4'' plasmid and attempted ''E. coli'' transformation<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/15_September_2009#Metal_Sensor_Team 15th September 2009]'''<br />
| Transformations seemed to have work; picked 12 colonies from 200ul plate and inoculated 12 tubes of 5ml LB + ampicillin<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/16_September_2009#Metal_Sensor_Team 16th September 2009]'''<br />
|Mini-preps of 12 picked colonies and restriction enzyme digest analysis - gel showed consistent bands so prepared midi-prep cultures<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/17_September_2009#Metal_Sensor_Team 17th September 2009]'''<br />
| Midi-prepped potential ''cotC-GFP-smtA'' transformant ''E. coli'' culture and digested with ''BamHI'' and ''HindIII''<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/18_September_2009#Metal_Sensor_Team 18th September 2009]'''<br />
|Analysed digested midi-prep sample through DNA gel electrophoresis - negative results<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/28_September_2009 28th September 2009]'''<br />
|Picked 10 colonies of potential ''cotC'' in ''pMUTIN4'' ''E. coli'' transformants and inoculated 10 tubes of LB + amp with them<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/29_September_2009 29th September 2009]'''<br />
|Conducted mini-preps of 10 cultures of potential transformants and analysed them through restriction digests and gel electrophoresis - did not work<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/1_October_2009#Ligations 1st October 2009]'''<br />
|Checked ''pMUTIN4'' and ''cotC'' on gel; carried out another ligation <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/2_October_2009 2nd October 2009]'''<br />
|Used ligation products to transform more ''E. coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/5_October_2009 5th October 2009]'''<br />
|Attempted transformations failed<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/6_October_2009#Formal_Lab_Session_-_6th_October_2009 6th October 2009]'''<br />
|Conducted ''pMUTIN4'' midi-prep again and transformed ''E. coli'' with ''cotC'' in ''pSB1AT3'' (newly arrived from GeneArt)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/7_October_2009 7th October 2009]'''<br />
| Transformations of ''E. coli'' with ''cotC'' in ''pSB1AT3'' worked - inoculated LB with these colonies for mini and midi-preps. Also PCR amplified the ''cotC'' BioBrick with restriction sites.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/8_October_2009 8th October 2009]'''<br />
|Digested newly midi-prepped ''pMUTIN4'' and also midi-prepped ''cotC'' in ''pSB1AT3'' (from GeneArt)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/9_October_2009 9th October 2009]'''<br />
|Ran digested ''cotC'' PCR product (made on 07/10/09) on gel and excised band.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/12_October_2009 12th October 2009]'''<br />
|Because the ''cotC-GFP-smtA'' + ''pMUTIN4'' digests haven't been working, the team plated out some new ''E. coli'' + ''pMUTIN4'' cells.<br />
|-<br />
|}<br />
<br />
===References===<br />
<br />
<font color="gray"><br />
1- Cretì, P., F. Trinchella, et al. "Heavy metal bioaccumulation and metallothionein content in tissues of the sea bream Sparus aurata from three different fish farming systems." Environmental Monitoring and Assessment. <br />
<br><br />
<br><br />
2- Morby, A. P., J. S. Turner, et al. (1993). SmtB is a metal-dependent repressor of the cyanobacterial metallothionein gene smtA: identification of a Zn inhibited DNA-protein complex. 21: 921-925. <br />
<br><br />
<br><br />
3- Waldron, K. J. and N. J. Robinson (2009). "How do bacterial cells ensure that metalloproteins get the correct metal?" Nat Rev Micro 7(1): 25-35. <br><br />
<br><br />
4- Mauriello, E. M. F., L. H. Duc, et al. (2004). "Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner." Vaccine 22(9-10): 1177-1187.<br />
</font><br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/MetalsTeam:Newcastle/Metals2009-10-22T00:54:50Z<p>Naw3: /* Novelty in this sub-project */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Metal Sequester=<br />
<br />
==Introduction==<br />
<br />
In order to take up and keep the cadmium from the soil efficiently, we needed to think about a way to cross-link the metal ions to intra-cellular proteins which would end up for the most of it in the spore. If the heavy metal ions were not cross linked to a "sponge protein", it could be lethal to the cell at lower concentration and the cell could end up sporulating too early, or even bursting in the soil, releasing all the heavy metal it has taken up.<br />
<br><br />
From our meeting with Prof. Nigel Robinson on the 18th of March 2009, it was evident that the best way of getting cadmium into the spore is to express a metallothionein, which would 'soak up' the cadmium, which in turn would be trapped within the protein in the spore.<br />
<br />
==Novelty in this sub-project==<br />
To increase the efficiency of our system in sequestering the heavy metal cadmium from the soil, we divised a plan to make sure that most of the metal ions that have been taken in our ''B.subtilis'' cell is then rendered bio-unavailable by incorporating it into ''smtA'' metallothionein. <br />
<br><br />
<br><br />
SmtA metallothionein protein from ''E. coli'' can bind to heavy metals [1,2,3]. They have a tendency to bind to cationic metal ions such as cadmium, copper, arsenic, mercury, silver.<br />
<br><br />
<br><br />
It has been shown that in ''B.subtilis'', in order to express a specific protein in the spore coat, it is possible to make a fusion protein with a spore coat protein called ''CotC'', and a group have successfully expressed antigen proteins which are about the same size as our ''smtA'' metallothionein in order to make a vaccine[4]. By fusing CotC spore coat protein from ''Bacillus subtilis'', our ''smtA'' metallothionein can be localized to the spore coat, hence we can successfully trap most of the metals ions into the bacterial spores. <br />
<br><br />
<br>It is also fused with GFP reporter gene in order to detect the expression of the fusion protein into the spores using a fluorescence microscopy. <br />
<br><br />
<br><br />
Because we want most of the metals to go into the spore rather than the vegetative cell, we designed our fusion protein so that it is controlled by the native ''cotC'' promoter sigK which is activated in sporulation conditions. Therefore, our ''smtA'' metal sequester will only be expressed once the cell have made the decision to become a metal container and sporulate, and it will only be expressed in the spore.<br />
<br><br />
<br><br />
Finally, our construct integrated the ''B. subtilis'' genome through homologous recombination at the native ''CotC'' gene. However, as we will be using pMutin4 integration vector, there will be two different copies of the ''cotC'' gene in our engineered ''B.subtilis'' genome: a native copy of ''cotC'' and our engineered ''CotC-GFP-smtA'' fusion copy. We chose not to knock-out the native ''CotC'' gene because the lack of native CotC might lead to defects in spore coat formation.<br />
<br />
==BioBrick constructs==<br />
[[Image:Newcastle SmtA-construct.png|center|500px]]<br />
<br />
In the parts registry, BBa_K174008:<br />
<br />
[[Image:Newcastle Metal sequester7.JPG|center|500px]]<br />
<br />
==Lab Work Strategies==<br />
<br><br />
===Construction===<br />
<br><br />
<br />
Synthesised by GeneArt, fragment: 1385 bp DNA<br />
<br />
Clone Manager construct and cut map:<br />
[[Image:Newcastle Metal sequester1.JPG|center|500px]]<br />
<br />
Sequencher construct:<br />
<br />
[[Image:Newcastle Metal sequester21.JPG|center|500px]]<br />
<br />
<br />
===Cloning and Integration===<br />
GeneArt will clone the vector into a standard biobrick vector. We will send them Plasmid pSB1AT3 with part BBa_J04450 (mCherry).<br />
<br />
BBa_J04450 in pSB1AT3 Clone Manager plamid map:<br />
<br />
[[Image:Newcastle Metal sequester3.JPG|center|500px]]<br />
<br />
Once we receive this fragment cloned in pSBAT3 we will amplify the part by PCR. Primer 1 will incorporate a HinDIII site and primer 2 will incorporate a BamHI. Checked that these enzymes don’t cut the fragment:<br />
<br />
[[Image:Newcastle Metal sequester4.JPG|center|500px]]<br />
<br />
We cut the PCR fragment and clone into pMutin4 cut with the same enzymes (diagram below is pMutin2 but this is essentially the same)<br />
<br />
[[Image:Newcastle Metal sequester5.JPG|center|500px]]<br />
<br />
We then integrate into the 168 chromosome using homology between our cotC fusion and the native copy of cotC.<br />
<br />
===Testing and Characterisation===<br />
Once transformed the spores of the mutant will need to be tested for fluorescence.<br />
Two obvious methods:<br />
<br />
1) Fluorescence microscopy: grow the cells in sporulation medium and look under the microscope for fluorescent spores. <br />
<br><br />
2) Purify spores and measure their fluorescence in a fluorescence plate reader.<br />
<br><br />
3) We would also test whether the strain is able to absorb cadmium in the spores when compared to the wild-type.<br />
<br><br />
==Lab Work Done==<br />
{| class=wikitable border="1"<br />
|-<br />
! colspan="2" | Summary of Lab Sessions for Metal Sequestering<br />
|-<br />
| <center>'''Date'''</center><br />
| <center>'''Description'''</center> <br />
|-<br />
| '''[https://2009.igem.org/Team:Newcastle/Labwork/9_September_2009#Metal_Sensor_Team 9th September 2009]'''<br />
| Arrival of ''cotC-GFP-smtA'' BioBrick - transformed this into ''DH5-alpha E. coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/10_September_2009#Metal_Sensor_Team 10th September 2009]'''<br />
| Used colonies of ''cotC-GFP-smtA'' transformants to inoculate LB media in preparation for mini and midi-preps<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/11_September_2009#Metal_Sensor_Team 11th September 2009]'''<br />
| Mini and midi-prepped ''cotC'' BioBrick and PCR amplified ''cotC'' BioBrick, giving it restriction ends; <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/14_September_2009#Metal_Sensor_Team 14th September 2009]'''<br />
| Ligated ''cotC'' into ''pMUTIN4'' plasmid and attempted ''E. coli'' transformation<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/15_September_2009#Metal_Sensor_Team 15th September 2009]'''<br />
| Transformations seemed to have work; picked 12 colonies from 200ul plate and inoculated 12 tubes of 5ml LB + ampicillin<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/16_September_2009#Metal_Sensor_Team 16th September 2009]'''<br />
|Mini-preps of 12 picked colonies and restriction enzyme digest analysis - gel showed consistent bands so prepared midi-prep cultures<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/17_September_2009#Metal_Sensor_Team 17th September 2009]'''<br />
| Midi-prepped potential ''cotC-GFP-smtA'' transformant ''E. coli'' culture and digested with ''BamHI'' and ''HindIII''<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/18_September_2009#Metal_Sensor_Team 18th September 2009]'''<br />
|Analysed digested midi-prep sample through DNA gel electrophoresis - negative results<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/28_September_2009 28th September 2009]'''<br />
|Picked 10 colonies of potential ''cotC'' in ''pMUTIN4'' ''E. coli'' transformants and inoculated 10 tubes of LB + amp with them<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/29_September_2009 29th September 2009]'''<br />
|Conducted mini-preps of 10 cultures of potential transformants and analysed them through restriction digests and gel electrophoresis - did not work<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/1_October_2009#Ligations 1st October 2009]'''<br />
|Checked ''pMUTIN4'' and ''cotC'' on gel; carried out another ligation <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/2_October_2009 2nd October 2009]'''<br />
|Used ligation products to transform more ''E. coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/5_October_2009 5th October 2009]'''<br />
|Attempted transformations failed<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/6_October_2009#Formal_Lab_Session_-_6th_October_2009 6th October 2009]'''<br />
|Conducted ''pMUTIN4'' midi-prep again and transformed ''E. coli'' with ''cotC'' in ''pSB1AT3'' (newly arrived from GeneArt)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/7_October_2009 7th October 2009]'''<br />
| Transformations of ''E. coli'' with ''cotC'' in ''pSB1AT3'' worked - inoculated LB with these colonies for mini and midi-preps. Also PCR amplified the ''cotC'' BioBrick with restriction sites.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/8_October_2009 8th October 2009]'''<br />
|Digested newly midi-prepped ''pMUTIN4'' and also midi-prepped ''cotC'' in ''pSB1AT3'' (from GeneArt)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/9_October_2009 9th October 2009]'''<br />
|Ran digested ''cotC'' PCR product (made on 07/10/09) on gel and excised band.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/12_October_2009 12th October 2009]'''<br />
|Because the ''cotC-GFP-smtA'' + ''pMUTIN4'' digests haven't been working, the team plated out some new ''E. coli'' + ''pMUTIN4'' cells.<br />
|-<br />
|}<br />
<br />
===References===<br />
<br />
<font color="gray"><br />
1- Cretì, P., F. Trinchella, et al. "Heavy metal bioaccumulation and metallothionein content in tissues of the sea bream Sparus aurata from three different fish farming systems." Environmental Monitoring and Assessment. <br />
<br><br />
<br><br />
2- Morby, A. P., J. S. Turner, et al. (1993). SmtB is a metal-dependent repressor of the cyanobacterial metallothionein gene smtA: identification of a Zn inhibited DNA-protein complex. 21: 921-925. <br />
<br><br />
<br><br />
3- Waldron, K. J. and N. J. Robinson (2009). "How do bacterial cells ensure that metalloproteins get the correct metal?" Nat Rev Micro 7(1): 25-35. <br><br />
<br><br />
4- Mauriello, E. M. F., L. H. Duc, et al. (2004). "Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner." Vaccine 22(9-10): 1177-1187.<br />
</font><br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-22T00:53:07Z<p>Naw3: /* BioBrick constructs */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most exciting aspects of our project is our synthetic stochastic switch. The switch regulates the decision to become a non-germinating metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
By differentially controlling the expression of the Hin invertase, we designed our switch to be tunable to achieve a biased heads or tails response, allowing a range of probabilities of orientation of the invertable segment to be achieved.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We designed a synthetic stochastic switch by using an invertible segment of DNA flanked by a pair of promoters. Depending on the orientation of the invertible sequence, coding sequences will be expressed which reflect the decision to be a metal container or not. We also tuned the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate of ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|thumb|center|350px|Gfp concentrations. IPTG:[0-9000nM], Xylose=[0-9000nM], Arabinose=1000nM]]<br />
<br />
==BioBrick constructs==<br />
<br />
There are a number of bricks involved within the stochastic switch construct.<br />
<br />
The stochastic brick construct uses the Hin invertase system in order to flip a region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control:<br />
<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
<br />
Importantly, Hin is '''differentially expressed''' depending on the levels of the two inducible promoters that flank the invertable segment on which it lies. This means the segment can be '''biased''' in a predictable and controllable fashion to favour one orientation or the other. <br />
<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| 200px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. When the sequence faces right, a FimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''cwlD'' <br />
and ''sleB'' genes. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore.<br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing KinA expression. ''kinA'' codes a kinase protein that phosphorylates the Spo0A protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Our stochastic switch determines whether the spores can germinate, or whether they are commited to be metal containers that cannot germinate again. We need this switch as we cannot totally interrupt the natural life cycle of the bacteria, since a proportion of cells have to go on to seed the next generation. <br />
Expression of the metallothionein fusion protein (''cotC-gfp-smtA''), cadmium import channel (''mntH'') and the cadmium efflux channel (''cadA'') is also governed by the direction of the stochastic promoter. When the direction of promoter faces right, the metallothionein fusion protein's expression will be triggered, ant will soak up the cadmium. While the import channel is upregulated, the efflux system's activity will be slowed down to increase the amountof cadmium inside the cell.<br />
<br />
===Stochastic Brick===<br />
We decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time consuming. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|600px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we had to redesign using inducible promoters governing Hin invertase expression. We used the promoters ''pSpac'' and ''pxylA'' (Induced by IPTG and Xylose) to test our system. We include cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we added a degradation tag to the Hin invertase protein. The following paper describes how proteins including modified ''ssrA'' tags can be located to the ClpXP protease by an Sspb protein. This means that inducible Sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We decided to put the Sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates. We also included a region of the ''sac'' gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than ''amyE''. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of the Hin protein. Expressed proteins are therefore degraded by ClpXP. However mutations on the ''ssrA'' tag weaken the recognition by ClpX, and the modified tags require the SspB adaptor protein to be recognized. When the SspB protein is expressed the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation. Otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no ''sspB'' orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of SspB by arabinose, we implemented an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|thumb|center|400px|Hin vs SspB according to the speed of degradation by ClpXP]]<br />
<br />
<br />
The wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis''. However, degradation tags can affect the activity of proteins. Different degradation tags may effect the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. The Glasgow team used Matlab to implement the Gillespie algorithm for incorporating noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
<br />
We used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===FimE switch===<br />
The FimE switch is a similar switch to the Hix system. However, it acts as a latch, meaning that once flipped the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We decided to use FimE to switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
===Lab strategies===<br />
To carry out our labwork we needed cloning strategies for all of our bricks and devices. Please see our [[Team:Newcastle/ Stochastic Switch cloning strategy| cloning strategies]] page for details on how we cloned our devices. <br />
<br />
{|style="color:DarkBlue;background-color:#ffffcc;" cellpadding="20" cellspacing="0" border="1"<br />
! colspan="2" |<font size=3> <center>'''Summary of lab work success:'''</center></font><br />
|-<br />
|'''Date:'''<br />
|'''Achievement:'''<br />
|-<br />
|11/09/09<br />
|Successfully cloned the ''sspB'' degradation controller fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/11_September_2009 | Lab book]]<br />
|-<br />
|18/09/09<br />
|Sucessfully cloned the ''ara'' promoter/ operator fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/18_September_2009 | Lab book]] <br />
|-<br />
|24/09/09<br />
|Successfully cloned the ''sspB'' fragment into the ''ara'' + pSB1AT3 prepared backbone. We now have an arabinose inducible degradation controller! <br />
[[Team:Newcastle/Labwork/24_September_2009| Lab book]]<br />
|}<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-22T00:52:40Z<p>Naw3: /* BioBrick constructs */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most exciting aspects of our project is our synthetic stochastic switch. The switch regulates the decision to become a non-germinating metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
By differentially controlling the expression of the Hin invertase, we designed our switch to be tunable to achieve a biased heads or tails response, allowing a range of probabilities of orientation of the invertable segment to be achieved.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We designed a synthetic stochastic switch by using an invertible segment of DNA flanked by a pair of promoters. Depending on the orientation of the invertible sequence, coding sequences will be expressed which reflect the decision to be a metal container or not. We also tuned the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate of ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|thumb|center|350px|Gfp concentrations. IPTG:[0-9000nM], Xylose=[0-9000nM], Arabinose=1000nM]]<br />
<br />
==BioBrick constructs==<br />
<br />
There are a number of bricks involved within the stochastic switch construct.<br />
<br />
The stochastic brick construct uses the Hin invertase system in order to flip a region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control<br />
<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
<br />
Importantly, Hin is '''differentially expressed''' depending on the levels of the two inducible promoters that flank the invertable segment on which it lies. This means the segment can be '''biased''' in a predictable and controllable fashion to favour one orientation or the other. <br />
<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| 200px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. When the sequence faces right, a FimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''cwlD'' <br />
and ''sleB'' genes. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore.<br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing KinA expression. ''kinA'' codes a kinase protein that phosphorylates the Spo0A protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Our stochastic switch determines whether the spores can germinate, or whether they are commited to be metal containers that cannot germinate again. We need this switch as we cannot totally interrupt the natural life cycle of the bacteria, since a proportion of cells have to go on to seed the next generation. <br />
Expression of the metallothionein fusion protein (''cotC-gfp-smtA''), cadmium import channel (''mntH'') and the cadmium efflux channel (''cadA'') is also governed by the direction of the stochastic promoter. When the direction of promoter faces right, the metallothionein fusion protein's expression will be triggered, ant will soak up the cadmium. While the import channel is upregulated, the efflux system's activity will be slowed down to increase the amountof cadmium inside the cell.<br />
<br />
===Stochastic Brick===<br />
We decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time consuming. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|600px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we had to redesign using inducible promoters governing Hin invertase expression. We used the promoters ''pSpac'' and ''pxylA'' (Induced by IPTG and Xylose) to test our system. We include cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we added a degradation tag to the Hin invertase protein. The following paper describes how proteins including modified ''ssrA'' tags can be located to the ClpXP protease by an Sspb protein. This means that inducible Sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We decided to put the Sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates. We also included a region of the ''sac'' gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than ''amyE''. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of the Hin protein. Expressed proteins are therefore degraded by ClpXP. However mutations on the ''ssrA'' tag weaken the recognition by ClpX, and the modified tags require the SspB adaptor protein to be recognized. When the SspB protein is expressed the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation. Otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no ''sspB'' orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of SspB by arabinose, we implemented an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|thumb|center|400px|Hin vs SspB according to the speed of degradation by ClpXP]]<br />
<br />
<br />
The wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis''. However, degradation tags can affect the activity of proteins. Different degradation tags may effect the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. The Glasgow team used Matlab to implement the Gillespie algorithm for incorporating noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
<br />
We used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===FimE switch===<br />
The FimE switch is a similar switch to the Hix system. However, it acts as a latch, meaning that once flipped the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We decided to use FimE to switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
===Lab strategies===<br />
To carry out our labwork we needed cloning strategies for all of our bricks and devices. Please see our [[Team:Newcastle/ Stochastic Switch cloning strategy| cloning strategies]] page for details on how we cloned our devices. <br />
<br />
{|style="color:DarkBlue;background-color:#ffffcc;" cellpadding="20" cellspacing="0" border="1"<br />
! colspan="2" |<font size=3> <center>'''Summary of lab work success:'''</center></font><br />
|-<br />
|'''Date:'''<br />
|'''Achievement:'''<br />
|-<br />
|11/09/09<br />
|Successfully cloned the ''sspB'' degradation controller fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/11_September_2009 | Lab book]]<br />
|-<br />
|18/09/09<br />
|Sucessfully cloned the ''ara'' promoter/ operator fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/18_September_2009 | Lab book]] <br />
|-<br />
|24/09/09<br />
|Successfully cloned the ''sspB'' fragment into the ''ara'' + pSB1AT3 prepared backbone. We now have an arabinose inducible degradation controller! <br />
[[Team:Newcastle/Labwork/24_September_2009| Lab book]]<br />
|}<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-22T00:51:40Z<p>Naw3: /* BioBrick constructs */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most exciting aspects of our project is our synthetic stochastic switch. The switch regulates the decision to become a non-germinating metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
By differentially controlling the expression of the Hin invertase, we designed our switch to be tunable to achieve a biased heads or tails response, allowing a range of probabilities of orientation of the invertable segment to be achieved.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We designed a synthetic stochastic switch by using an invertible segment of DNA flanked by a pair of promoters. Depending on the orientation of the invertible sequence, coding sequences will be expressed which reflect the decision to be a metal container or not. We also tuned the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate of ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|thumb|center|350px|Gfp concentrations. IPTG:[0-9000nM], Xylose=[0-9000nM], Arabinose=1000nM]]<br />
<br />
==BioBrick constructs==<br />
<br />
There are a number of bricks involved within the stochastic switch construct.<br />
<br />
The stochastic brick construct uses the Hin invertase system in order to flip a region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control:<br />
<br />
<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
<br />
Importantly, Hin is '''differentially expressed''' depending on the levels of the two inducible promoters that flank the invertable segment on which it lies. This means the segment can be '''biased''' in a predictable and controllable fashion to favour one orientation or the other. <br />
<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| 200px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. When the sequence faces right, a FimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''cwlD'' <br />
and ''sleB'' genes. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore.<br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing KinA expression. ''kinA'' codes a kinase protein that phosphorylates the Spo0A protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Our stochastic switch determines whether the spores can germinate, or whether they are commited to be metal containers that cannot germinate again. We need this switch as we cannot totally interrupt the natural life cycle of the bacteria, since a proportion of cells have to go on to seed the next generation. <br />
Expression of the metallothionein fusion protein (''cotC-gfp-smtA''), cadmium import channel (''mntH'') and the cadmium efflux channel (''cadA'') is also governed by the direction of the stochastic promoter. When the direction of promoter faces right, the metallothionein fusion protein's expression will be triggered, ant will soak up the cadmium. While the import channel is upregulated, the efflux system's activity will be slowed down to increase the amountof cadmium inside the cell.<br />
<br />
===Stochastic Brick===<br />
We decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time consuming. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|600px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we had to redesign using inducible promoters governing Hin invertase expression. We used the promoters ''pSpac'' and ''pxylA'' (Induced by IPTG and Xylose) to test our system. We include cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we added a degradation tag to the Hin invertase protein. The following paper describes how proteins including modified ''ssrA'' tags can be located to the ClpXP protease by an Sspb protein. This means that inducible Sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We decided to put the Sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates. We also included a region of the ''sac'' gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than ''amyE''. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of the Hin protein. Expressed proteins are therefore degraded by ClpXP. However mutations on the ''ssrA'' tag weaken the recognition by ClpX, and the modified tags require the SspB adaptor protein to be recognized. When the SspB protein is expressed the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation. Otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no ''sspB'' orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of SspB by arabinose, we implemented an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|thumb|center|400px|Hin vs SspB according to the speed of degradation by ClpXP]]<br />
<br />
<br />
The wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis''. However, degradation tags can affect the activity of proteins. Different degradation tags may effect the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. The Glasgow team used Matlab to implement the Gillespie algorithm for incorporating noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
<br />
We used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===FimE switch===<br />
The FimE switch is a similar switch to the Hix system. However, it acts as a latch, meaning that once flipped the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We decided to use FimE to switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
===Lab strategies===<br />
To carry out our labwork we needed cloning strategies for all of our bricks and devices. Please see our [[Team:Newcastle/ Stochastic Switch cloning strategy| cloning strategies]] page for details on how we cloned our devices. <br />
<br />
{|style="color:DarkBlue;background-color:#ffffcc;" cellpadding="20" cellspacing="0" border="1"<br />
! colspan="2" |<font size=3> <center>'''Summary of lab work success:'''</center></font><br />
|-<br />
|'''Date:'''<br />
|'''Achievement:'''<br />
|-<br />
|11/09/09<br />
|Successfully cloned the ''sspB'' degradation controller fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/11_September_2009 | Lab book]]<br />
|-<br />
|18/09/09<br />
|Sucessfully cloned the ''ara'' promoter/ operator fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/18_September_2009 | Lab book]] <br />
|-<br />
|24/09/09<br />
|Successfully cloned the ''sspB'' fragment into the ''ara'' + pSB1AT3 prepared backbone. We now have an arabinose inducible degradation controller! <br />
[[Team:Newcastle/Labwork/24_September_2009| Lab book]]<br />
|}<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-22T00:51:12Z<p>Naw3: /* BioBrick constructs */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most exciting aspects of our project is our synthetic stochastic switch. The switch regulates the decision to become a non-germinating metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
By differentially controlling the expression of the Hin invertase, we designed our switch to be tunable to achieve a biased heads or tails response, allowing a range of probabilities of orientation of the invertable segment to be achieved.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We designed a synthetic stochastic switch by using an invertible segment of DNA flanked by a pair of promoters. Depending on the orientation of the invertible sequence, coding sequences will be expressed which reflect the decision to be a metal container or not. We also tuned the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate of ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|thumb|center|350px|Gfp concentrations. IPTG:[0-9000nM], Xylose=[0-9000nM], Arabinose=1000nM]]<br />
<br />
==BioBrick constructs==<br />
<br />
There are a number of bricks involved within the stochastic switch construct.<br />
<br />
The stochastic brick construct uses the Hin invertase system in order to flip a region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control:<br />
<br />
<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
<br />
Importantly, Hin is '''differentially expressed''' depending on the levels of the two inducible promoters that flank the invertable segment on which it lies. This means the segment can be '''baised''' in a predictable and controllable fashion to favour one orientation or the other. <br />
<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| 200px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. When the sequence faces right, a FimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''cwlD'' <br />
and ''sleB'' genes. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore.<br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing KinA expression. ''kinA'' codes a kinase protein that phosphorylates the Spo0A protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Our stochastic switch determines whether the spores can germinate, or whether they are commited to be metal containers that cannot germinate again. We need this switch as we cannot totally interrupt the natural life cycle of the bacteria, since a proportion of cells have to go on to seed the next generation. <br />
Expression of the metallothionein fusion protein (''cotC-gfp-smtA''), cadmium import channel (''mntH'') and the cadmium efflux channel (''cadA'') is also governed by the direction of the stochastic promoter. When the direction of promoter faces right, the metallothionein fusion protein's expression will be triggered, ant will soak up the cadmium. While the import channel is upregulated, the efflux system's activity will be slowed down to increase the amountof cadmium inside the cell.<br />
<br />
===Stochastic Brick===<br />
We decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time consuming. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|600px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we had to redesign using inducible promoters governing Hin invertase expression. We used the promoters ''pSpac'' and ''pxylA'' (Induced by IPTG and Xylose) to test our system. We include cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we added a degradation tag to the Hin invertase protein. The following paper describes how proteins including modified ''ssrA'' tags can be located to the ClpXP protease by an Sspb protein. This means that inducible Sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We decided to put the Sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates. We also included a region of the ''sac'' gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than ''amyE''. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of the Hin protein. Expressed proteins are therefore degraded by ClpXP. However mutations on the ''ssrA'' tag weaken the recognition by ClpX, and the modified tags require the SspB adaptor protein to be recognized. When the SspB protein is expressed the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation. Otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no ''sspB'' orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of SspB by arabinose, we implemented an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|thumb|center|400px|Hin vs SspB according to the speed of degradation by ClpXP]]<br />
<br />
<br />
The wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis''. However, degradation tags can affect the activity of proteins. Different degradation tags may effect the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. The Glasgow team used Matlab to implement the Gillespie algorithm for incorporating noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
<br />
We used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===FimE switch===<br />
The FimE switch is a similar switch to the Hix system. However, it acts as a latch, meaning that once flipped the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We decided to use FimE to switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
===Lab strategies===<br />
To carry out our labwork we needed cloning strategies for all of our bricks and devices. Please see our [[Team:Newcastle/ Stochastic Switch cloning strategy| cloning strategies]] page for details on how we cloned our devices. <br />
<br />
{|style="color:DarkBlue;background-color:#ffffcc;" cellpadding="20" cellspacing="0" border="1"<br />
! colspan="2" |<font size=3> <center>'''Summary of lab work success:'''</center></font><br />
|-<br />
|'''Date:'''<br />
|'''Achievement:'''<br />
|-<br />
|11/09/09<br />
|Successfully cloned the ''sspB'' degradation controller fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/11_September_2009 | Lab book]]<br />
|-<br />
|18/09/09<br />
|Sucessfully cloned the ''ara'' promoter/ operator fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/18_September_2009 | Lab book]] <br />
|-<br />
|24/09/09<br />
|Successfully cloned the ''sspB'' fragment into the ''ara'' + pSB1AT3 prepared backbone. We now have an arabinose inducible degradation controller! <br />
[[Team:Newcastle/Labwork/24_September_2009| Lab book]]<br />
|}<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-22T00:46:03Z<p>Naw3: /* Introduction */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most exciting aspects of our project is our synthetic stochastic switch. The switch regulates the decision to become a non-germinating metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
By differentially controlling the expression of the Hin invertase, we designed our switch to be tunable to achieve a biased heads or tails response, allowing a range of probabilities of orientation of the invertable segment to be achieved.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We designed a synthetic stochastic switch by using an invertible segment of DNA flanked by a pair of promoters. Depending on the orientation of the invertible sequence, coding sequences will be expressed which reflect the decision to be a metal container or not. We also tuned the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate of ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|thumb|center|350px|Gfp concentrations. IPTG:[0-9000nM], Xylose=[0-9000nM], Arabinose=1000nM]]<br />
<br />
==BioBrick constructs==<br />
<br />
There are a number of bricks involved within the stochastic switch construct.<br />
<br />
The stochastic brick construct uses the Hin invertase system in order to flip a region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control:<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| 200px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. When the sequence faces right, a FimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''cwlD'' <br />
and ''sleB'' genes. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore.<br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing KinA expression. ''kinA'' codes a kinase protein that phosphorylates the Spo0A protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Our stochastic switch determines whether the spores can germinate, or whether they are commited to be metal containers that cannot germinate again. We need this switch as we cannot totally interrupt the natural life cycle of the bacteria, since a proportion of cells have to go on to seed the next generation. <br />
Expression of the metallothionein fusion protein (''cotC-gfp-smtA''), cadmium import channel (''mntH'') and the cadmium efflux channel (''cadA'') is also governed by the direction of the stochastic promoter. When the direction of promoter faces right, the metallothionein fusion protein's expression will be triggered, ant will soak up the cadmium. While the import channel is upregulated, the efflux system's activity will be slowed down to increase the amountof cadmium inside the cell.<br />
<br />
===Stochastic Brick===<br />
We decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time consuming. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|600px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we had to redesign using inducible promoters governing Hin invertase expression. We used the promoters ''pSpac'' and ''pxylA'' (Induced by IPTG and Xylose) to test our system. We include cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we added a degradation tag to the Hin invertase protein. The following paper describes how proteins including modified ''ssrA'' tags can be located to the ClpXP protease by an Sspb protein. This means that inducible Sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We decided to put the Sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates. We also included a region of the ''sac'' gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than ''amyE''. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of the Hin protein. Expressed proteins are therefore degraded by ClpXP. However mutations on the ''ssrA'' tag weaken the recognition by ClpX, and the modified tags require the SspB adaptor protein to be recognized. When the SspB protein is expressed the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation. Otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no ''sspB'' orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of SspB by arabinose, we implemented an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|thumb|center|400px|Hin vs SspB according to the speed of degradation by ClpXP]]<br />
<br />
<br />
The wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis''. However, degradation tags can affect the activity of proteins. Different degradation tags may effect the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. The Glasgow team used Matlab to implement the Gillespie algorithm for incorporating noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
<br />
We used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===FimE switch===<br />
The FimE switch is a similar switch to the Hix system. However, it acts as a latch, meaning that once flipped the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We decided to use FimE to switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
===Lab strategies===<br />
To carry out our labwork we needed cloning strategies for all of our bricks and devices. Please see our [[Team:Newcastle/ Stochastic Switch cloning strategy| cloning strategies]] page for details on how we cloned our devices. <br />
<br />
{|style="color:DarkBlue;background-color:#ffffcc;" cellpadding="20" cellspacing="0" border="1"<br />
! colspan="2" |<font size=3> <center>'''Summary of lab work success:'''</center></font><br />
|-<br />
|'''Date:'''<br />
|'''Achievement:'''<br />
|-<br />
|11/09/09<br />
|Successfully cloned the ''sspB'' degradation controller fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/11_September_2009 | Lab book]]<br />
|-<br />
|18/09/09<br />
|Sucessfully cloned the ''ara'' promoter/ operator fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/18_September_2009 | Lab book]] <br />
|-<br />
|24/09/09<br />
|Successfully cloned the ''sspB'' fragment into the ''ara'' + pSB1AT3 prepared backbone. We now have an arabinose inducible degradation controller! <br />
[[Team:Newcastle/Labwork/24_September_2009| Lab book]]<br />
|}<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-22T00:42:37Z<p>Naw3: /* Introduction */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most exciting aspects of our project is our synthetic stochastic switch. The switch regulates the decision to become a non-germinating metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We designed a synthetic stochastic switch by using an invertible segment of DNA flanked by a pair of promoters. Depending on the orientation of the invertible sequence, coding sequences will be expressed which reflect the decision to be a metal container or not. We also tuned the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate of ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|thumb|center|350px|Gfp concentrations. IPTG:[0-9000nM], Xylose=[0-9000nM], Arabinose=1000nM]]<br />
<br />
==BioBrick constructs==<br />
<br />
There are a number of bricks involved within the stochastic switch construct.<br />
<br />
The stochastic brick construct uses the Hin invertase system in order to flip a region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control:<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| 200px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. When the sequence faces right, a FimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''cwlD'' <br />
and ''sleB'' genes. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore.<br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing KinA expression. ''kinA'' codes a kinase protein that phosphorylates the Spo0A protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Our stochastic switch determines whether the spores can germinate, or whether they are commited to be metal containers that cannot germinate again. We need this switch as we cannot totally interrupt the natural life cycle of the bacteria, since a proportion of cells have to go on to seed the next generation. <br />
Expression of the metallothionein fusion protein (''cotC-gfp-smtA''), cadmium import channel (''mntH'') and the cadmium efflux channel (''cadA'') is also governed by the direction of the stochastic promoter. When the direction of promoter faces right, the metallothionein fusion protein's expression will be triggered, ant will soak up the cadmium. While the import channel is upregulated, the efflux system's activity will be slowed down to increase the amountof cadmium inside the cell.<br />
<br />
===Stochastic Brick===<br />
We decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time consuming. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|600px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we had to redesign using inducible promoters governing Hin invertase expression. We used the promoters ''pSpac'' and ''pxylA'' (Induced by IPTG and Xylose) to test our system. We include cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we added a degradation tag to the Hin invertase protein. The following paper describes how proteins including modified ''ssrA'' tags can be located to the ClpXP protease by an Sspb protein. This means that inducible Sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We decided to put the Sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates. We also included a region of the ''sac'' gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than ''amyE''. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of the Hin protein. Expressed proteins are therefore degraded by ClpXP. However mutations on the ''ssrA'' tag weaken the recognition by ClpX, and the modified tags require the SspB adaptor protein to be recognized. When the SspB protein is expressed the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation. Otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no ''sspB'' orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of SspB by arabinose, we implemented an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|thumb|center|400px|Hin vs SspB according to the speed of degradation by ClpXP]]<br />
<br />
<br />
The wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis''. However, degradation tags can affect the activity of proteins. Different degradation tags may effect the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in ''Bacillus subtilis'' using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. The Glasgow team used Matlab to implement the Gillespie algorithm for incorporating noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
<br />
We used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===FimE switch===<br />
The FimE switch is a similar switch to the Hix system. However, it acts as a latch, meaning that once flipped the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We decided to use FimE to switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
===Lab strategies===<br />
To carry out our labwork we needed cloning strategies for all of our bricks and devices. Please see our [[Team:Newcastle/ Stochastic Switch cloning strategy| cloning strategies]] page for details on how we cloned our devices. <br />
<br />
{|style="color:DarkBlue;background-color:#ffffcc;" cellpadding="20" cellspacing="0" border="1"<br />
! colspan="2" |<font size=3> <center>'''Summary of lab work success:'''</center></font><br />
|-<br />
|'''Date:'''<br />
|'''Achievement:'''<br />
|-<br />
|11/09/09<br />
|Successfully cloned the ''sspB'' degradation controller fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/11_September_2009 | Lab book]]<br />
|-<br />
|18/09/09<br />
|Sucessfully cloned the ''ara'' promoter/ operator fragment into pSB1AT3 <br />
[[Team:Newcastle/Labwork/18_September_2009 | Lab book]] <br />
|-<br />
|24/09/09<br />
|Successfully cloned the ''sspB'' fragment into the ''ara'' + pSB1AT3 prepared backbone. We now have an arabinose inducible degradation controller! <br />
[[Team:Newcastle/Labwork/24_September_2009| Lab book]]<br />
|}<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/PopulationDynamicsTeam:Newcastle/PopulationDynamics2009-10-22T00:41:34Z<p>Naw3: /* Introduction */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
= Population Dynamics =<br />
<br />
== Introduction ==<br />
<br />
The fact that in our project we are removing members of the bacterial population, making them sporulate, but not germinate again, will clearly effect the population dynamics of the growth of B. subtilis in a competitive environment such as the soil<br />
<br />
We needed to make sure that we do not kill off our entire population. <br />
<br />
Thus we required a method to be able to tune our system, so that we can have a large enough percentage of metal sequestering spores to make a positive environmental impact, but also a small enough percentage, so that the population will continue to live and grow.<br />
<br />
To achieve his aim, we needed to tinker with the delicate balance that ''Bacillus'' normal maintains between its differentiation states of spores and vegetative cells.<br />
<br />
== Novelty in this sub-project ==<br />
The novel part of this sub-project is to model the dynamics of a bacterial population, on the cellular level, as well as integrating this agent based model with biochemical models. Furthermore our simulation is able to run on distributed systems, making use of a large number of computers at once.<br />
<br />
== Modelling ==<br />
: ''See [[Team:Newcastle/Modeling/Population|Population Modelling]]''<br />
This section of the project is a model simulation, which describes a high level working of our complete system. It also includes detail from other models, as it uses these in its decision making processes. The model has been developed in the Java programming language, but also uses other technologies including running CellML models.<br />
<br />
== Other Presentations and Diagrams ==<br />
For the population simulation we will be looking at a simplified model of a bacteria's life cycle.<br />
<br />
A simplified normal life cycle may be:<br />
[[Image:Newcastle Population Life Cycle 1.png|center|512px]]<br />
<br />
Whereas our modified life cycle would have an additional state, where some spores cannot germinate. Notice that cells can enter the Metal Spore stage, but not exit it:<br />
[[Image:Newcastle Population Life Cycle 2.png|center|512px]]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Judging_CommentsTeam:Newcastle/Judging Comments2009-10-22T00:37:06Z<p>Naw3: /* Judging Comments */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
<br />
= Judging Comments =<br />
This year, despite our relatively ambitious project, our team achieved goals in several different areas. <br />
<br><br><br />
We successfully modelled, designed, characterised and entered our sporulation tuning ''kinA'' BioBrick ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K174011 BBa_K174011]) in the parts registry.<br />
<br><br><br />
We also improved an existing BioBrick part ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K174004 BBa_K174004]) rendering it tightly regulated. <br />
<br><br><br />
Futhermore, we helped the UQ-Australia iGEM2009 team by building a template model for their system and sending it to them. <br />
<br><br><br />
We also modelled all the components of our project's system, and we designed and entered 16 other BioBrick parts and devices, ranking from a degradation controller system to a tightly regulated metal sensing promoter. We believe that several of the BioBrick parts we designed, in addition to our three favourite parts, are novel and can be used not only in the context of our project but in a variety of different systems.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174002 degradation controller device] is arabinose inducible and should be useful beyond our own project, to tightly regulate the levels of protein in a range of synthetic systems. Our device allows us to exert a third form of control over the expression level of a protein of interest, in addition to the transcriptional and translational regulation already widely used in Synthetic Biology.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174015 cadmium sensitive promoter] BioBrick is novel since there is no previously available cadmium specific promoter. Our combinatorial approach, using two different transcriptional repressors is a tightly regulated promoter which can be used by any cadmium-sensitive system.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174003 heritable, tunable, stochastic switch] is novel since the device can be tuned to be biased by altering the amount of invertase protein.<br />
<br><br><br />
Finally we believe that our aim of controlling stochasticity in the differentiation process to alter the behaviour of soil bacterium is a worthy aim and the idea of packaging cadmium in spores is unique. <br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Judging_CommentsTeam:Newcastle/Judging Comments2009-10-22T00:36:00Z<p>Naw3: /* Judging Comments */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
<br />
= Judging Comments =<br />
This year, despite our relatively ambitious project, our team achieved goals in several different areas. <br />
<br><br><br />
We successfully modelled, designed, characterising and entering our sporulation tuning ''kinA'' BioBrick ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K174011 BBa_K174011]) in the parts registry.<br />
<br><br><br />
We also improved an existing BioBrick part ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K174004 BBa_K174004]) rendering it tightly regulated. <br />
<br><br><br />
Futhermore, we helped the UQ-Australia iGEM2009 team by building a template model for their system and sending it to them. <br />
<br><br><br />
We also modelled all the components of our project's system, and we designed and entered 16 other BioBrick parts and devices, ranking from a degradation controller system to a tightly regulated metal sensing promoter. We believe that several of the BioBrick parts we designed, in addition to our three favourite parts, are novel and can be used not only in the context of our project but in a variety of different systems.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174002 degradation controller device] is arabinose inducible and should be useful beyond our own project, to tightly regulate the levels of protein in a range of synthetic systems. Our device allows us to exert a third form of control over the expression level of a protein of interest, in addition to the transcriptional and translational regulation already widely used in Synthetic Biology.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174015 cadmium sensitive promoter] BioBrick is novel since there is no previously available cadmium specific promoter. Our combinatorial approach, using two different transcriptional repressors is a tightly regulated promoter which can be used by any cadmium-sensitive system.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174003 heritable, tunable, stochastic switch] is novel since the device can be tuned to be biased by altering the amount of invertase protein.<br />
<br><br><br />
Finally we believe that our aim of controlling stochasticity in the differentiation process to alter the behaviour of soil bacterium is a worthy aim and the idea of packaging cadmium in spores is unique. <br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Judging_CommentsTeam:Newcastle/Judging Comments2009-10-22T00:34:54Z<p>Naw3: /* Judging Comments */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
<br />
= Judging Comments =<br />
This year, despite our relatively ambitious project, our team achieved goals in several different areas. <br />
<br><br><br />
We successfully modelled, designed, characterising and entering our sporulation tuning ''kinA'' BioBrick ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K174011 BBa_K174011]) in the parts registry.<br />
<br><br><br />
We also improved an existing BioBrick part ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K174004 BBa_K174004]) rendering it tightly regulated. <br />
<br><br><br />
Futhermore, we helped the UQ-Australia iGEM2009 team by building a template model for their system and sending it to them. <br />
<br><br><br />
We also modelled all the components of our project's system, and we designed and entered 16 other BioBrick parts and devices, ranking from a degradation controller system to a tightly regulated metal sensing promoter. We believe that several of the BioBrick parts we designed, in addition to our three favourite parts, are novel and can be used not only in the context of our project but in a variety of different systems.<br />
<br><br><br />
Our [[http://partsregistry.org/wiki/index.php?title=Part:BBa_K174002 degradation controller device]] is arabinose inducible and should be useful beyond our own project, to tightly regulate the levels of protein in a range of synthetic systems. Our device allows us to exert a third form of control over the expression level of a protein of interest, in addition to the transcriptional and translational regulation already widely used in Synthetic Biology.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174015 cadmium sensitive promoter] BioBrick is novel since there is no previously available cadmium specific promoter. Our combinatorial approach, using two different transcriptional repressors is a tightly regulated promoter which can be used by any cadmium-sensitive system.<br />
<br><br><br />
Our [http://partsregistry.org/wiki/index.php?title=Part:BBa_K174003] heritable, tunable, stochastic switch] is novel since the device can be tuned to be biased by altering the amount of invertase protein.<br />
<br><br><br />
Finally we believe that our aim of controlling stochasticity in the differentiation process to alter the behaviour of soil bacterium is a worthy aim and the idea of packaging cadmium in spores is unique. <br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T23:44:16Z<p>Naw3: /* Microscopy results */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011]. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb (vector only) as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
The growth curves below show that growth of the strain with [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] integrated grows more slowly that the wild type, presumably because of increased sporulation rates. The addition of IPTG slows the growth rate still further. <br />
<br />
OD's above 1.0 need to be discounted since the spectrophotometer we used is not accurate above this OD. <br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb vector only, and BFS867 mutant transformed with pGFP-rrnb + BBa_K174011. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (see figure below). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (see figure below). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistance of spores as a selective measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_1Brightfield-modif.png|thumb|250px|Bright Field image of WT ''B.subtilis'' at time point 1, No IPTG]]<br />
|[[Image:Team Newcastle iGEM 2009 1GFP-modif.png|thumb|250px|Gfp expression shown for WT ''B.subtilis'' at time point 1, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Modeling/Population/PseudoTeam:Newcastle/Modeling/Population/Pseudo2009-10-21T23:22:49Z<p>Naw3: /* Population modelling overview */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
== Population modelling overview==<br />
This page provides an overview of the code which the Newcastle team has developed for their population simulation model.<br />
<br />
=== Bacterial simulation overview ===<br />
[[Image:Newcastle Java Coding Example.png|thumb|An example of the Java programming in this project, showing the Subtilis.java class file.]]<br />
For the actual simulation of the bacterial life cycles, we decided to allow each bacterial cell to run as a separate thread. The phenotype of a bacterial cell changes depending on what state they are in, so we decided to have a number of different classes to represent these states. These classes have some common attributes, which can be represented as a superclass in object orientated computing.<br />
<br />
Superclass:<br />
* Cell - contains the common attributes, such as levels of cadmium and nutrients. The Cell class also provides access to the database.<br />
Subclasses:<br />
* Subtilis - represents vegetative cells. From here cells can make various life choices and enter other states accordingly.<br />
* Spore - represents the spore stage of the life cycle. Note that in our project the cells have to choose whether they are going to become a "metal sequestering" spore which cannot germinate.<br />
* Biofilm - represents the biofilm phenotype of the cells.<br />
* Motile - represents motility of the cells<br />
<br />
== Appendix ==<br />
;Computing Definitions<br />
<br />
Throughout this article some programming knowledge is assumed, but here are some selected definitions of terminology:<br />
* ''Class'' - In object orientated programming, such as Java, it is a collection of computer code which is dedicated to one idea or entity. For example a student class may contain information about a student such as their name, date of birth, etc.<br />
* ''A Thread of Execution'' - Inside a computer program or process there may be two or more concurrently running tasks, these tasks, called threads. These threads each compete for time on the computer processor and can communicate with shared objects.<br />
* ''Java'' - One of many object orientated programming languages. Java allows the same code to be run on lots of different types of machines (eg. Windows, Mac or Linux).<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/MetalsensingTeam:Newcastle/Metalsensing2009-10-21T23:06:20Z<p>Naw3: /* Introduction */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
<br />
=Metal Sensing=<br />
<br />
==Introduction==<br />
If our project is to process cadmium and not other metals, we need to genetically engineer ''Bacillus subtilis'' to carry out a set of cellular processes based on the action of metal sensors. These metal sensors will detect cadmium through a system known as AND Gating. <br />
<br />
There are two metal sensing repressors, which are known to respond to cadmium: ArsR and CzrA. However, their specifity for cadmium is not unique. ArsR also detects arsenic and CzrA also detects zinc and copper.<br />
<br />
By positioning the operator binding sites for these two metal sensing repressors next to each other in a promoter region, the gene regulated by that promoter will be transcribed only when a metal that binds to both sensors is present; in this case Cadmium.<br />
<br />
This is a combinatorial approach for gene expression regulation.<br />
<br />
==Modelling==<br />
<br />
* [[Team:Newcastle/Modelling/MetalIntake | Metal Intake/Efflux Model]]<br />
<br />
==BioBrick constructs==<br />
<br />
==Lab Work Strategies==<br />
*[[Team:Newcastle/Metal_Sensor_planA | Metal Sensor: czrA+arsR - plan A]]<br />
<br />
*[[Team:Newcastle/Metal_Sensor_planB | Metal Sensor: czrA+arsR - plan B]]<br />
<br />
==Other Presentations and Diagrams==<br />
<br />
[[Image:Newcastle Metalsensor2100.gif]]<br />
<br />
==Lab Work done==<br />
{| class=wikitable border="1"<br />
|-<br />
! colspan="2" | Summary of Lab Sessions for Cadmium Sensing<br />
|-<br />
| <center>'''Date'''</center><br />
| <center>'''Description'''</center> <br />
|-<br />
| '''[https://2009.igem.org/Team:Newcastle/Labwork/18_August_2009#Metal_Sensor_Team 18th August 2009]'''<br />
| Transformed ''DH5-alpha E. coli'' cells with ''BBa_J33206'' from the Spring Distribution<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/19_August_2009#Metal_Sensor_Team 19th August 2009]'''<br />
| Inoculated 3 tubes of LB with 3 colonies of potential transformant ''E.coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/20_August_2009#Metal_Sensor_Team 20th August 2009]'''<br />
| Conduct mini-preps on the three overnight-grown cultures of potential ''BBa_J33206'' transformants and digested them with restriction enzymes.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/21_August_2009#Metal_Sensor_Team 21st August 2009]'''<br />
|Analysed digested ''BBa_J33206'' mini-prep DNA by DNA gel electrophoresis and prepared midi-preps also.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/25_August_2009#Metal_Sensor_Team 25th August 2009]'''<br />
|Concentrated (and ethanol precipitated) the ''BBa_J33206'' Midi-prep sample.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/26_August_2009#Metal_Sensor_Team 26th August 2009]'''<br />
|Digested ''BBa_J33206'' midi-prep DNA with ''EcoRI'' and ''PstI'' and analysed through DNA gel electrophoresis - digest reaction not successful (a second attempt at digests needed)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/27_August_2009#Metal_Sensor_Team 27th August 2009]'''<br />
|Digested ''pSB1A2'' (containing ''BBa_J33206'' BioBrick), ran DNA though gel and excised band. Also analysed digested ''pSB1A2'' (''BBa_J33206'' BioBrick) in gel - '''bands erroneous'''<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/28_August_2009#Metal_Sensor_Team 28th August 2009]'''<br />
|Cleaned gel band using Gel extraction kit<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/1_September_2009#Metal_Sensor_Team 1st September 2009]'''<br />
|Attempted to PCR amplify the needed ''czrA'' gene from the genome of ''Bacillus subtilis''<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/2_September_2009#Metal_Sensor_Team 2nd September 2009]'''<br />
|PCR amplification of ''czrA'' gene failed - conducted ''B. subtilis'' genome prep and carried out PCR reaction on this DNA<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/3_September_2009#Metal_Sensor_Team 3rd September 2009]'''<br />
|Second attempt at ''czrA'' PCR amplification analysed on gel - also unsuccessful. Reattempted PCR amplification of ''czrA'' on ''B. subtilis'' genomic DNA at different annealing temperatures.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/4_September_2009#Metal_Sensing_Team 4th September 2009]'''<br />
|In light of 27/08/09 lab session (i.e. anomalous bands with digested ''BBa_J33206'' BioBrick), we have sent away the BioBrick for sequencing and are now using ''BBa_J33206'' sent to us by Chris French. Used Chris's ''BBa_J33206'' to transform ''E. coli'' cells. Also carried out PCR reactions<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/7_September_2009#Metal_Sensor_Team 7th September 2009]'''<br />
|Inoculated LB media with colonies of ''BBa_J33206'' (sent from Chris French) ''E. coli'' transformants for mini preps. By afternoon, cultures had grown sufficiently to further inoculate flasks of 50ml LB + amp for midi-preps. Mini-prep attempted but abandoned <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/8_September_2009#Metal_Sensor_Team 8th September 2009]'''<br />
|Skipped mini-prep re-attempt and immediately carried out midi-prep of ''BBa_J33206'' BioBrick sent by Chris French. Digested sample with EcoRI and PstI and analysed through gel. Successful!<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/10_September_2009#Metal_Sensor_Team 10th September 2009]'''<br />
|PCR amplification of the ''cadA'' promoter and ''BBa_J33206'' BioBrick (missing promoter)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/11_September_2009#Metal_Sensor_Team 11th September 2009]'''<br />
|Gel analysis shows PCR reactions worked. Tried to proceed with running the cleaned-up PCR products through gel to excise band but ethanol presence stopped us. Will have to reattempt PCR reactions and other subsequent steps.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/14_September_2009#1.29_Cadmium-sensing_logic_AND_gate 14th September 2009]'''<br />
|Both ''cadA'' promoter and ''BBa_J33206'' (with promoter missing) PCR reactions worked! Subsequently excised from gel and cleaned up. Both fragments cut with ''BamHI'' and ''NheI'' and ligated together. Attempted to transform ''E. coli'' with ligated cadmium-sensor.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/15_September_2009#Metal_Sensor_Team 15th September 2009]'''<br />
|No transformant colonies spotted on plates - either ligations or transformations didn't work. Reattempted ligation and transformation in ''E. coli'' cells.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/16_September_2009#Metal_Sensor_Team 16th September 2009]'''<br />
|Transformations failed! Reattempted digesting the ''BBa_J33206'' (with no promoter) and ''cadA'' promoter with ''BamHI'' and ''NheI'' and also reattempted ligations <br />
|-<br />
|'''17th September 2009'''<br />
|Subsequent work on cadmium sensor put on hold<br />
|-<br />
|}<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/MetalsensingTeam:Newcastle/Metalsensing2009-10-21T23:05:00Z<p>Naw3: /* Introduction */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
<br />
=Metal Sensing=<br />
<br />
==Introduction==<br />
If our project is to process cadmium and not other metals, we need to genetically engineer ''Bacillus subtilis'' to carry out a set of cellular processes based on the action of metal sensors. These metal sensors will detect cadmium through a system known as AND Gating. <br />
<br />
There are two metal sensing repressors, which are known to respond to cadmium: ArsR and CzrA.<br />
<br />
By positioning the operator binding sites for these two metal sensing repressors next to each other in a promoter region, the gene regulated by that promoter will be transcribed only when a metal that binds to both sensors is present; in this case Cadmium.<br />
<br />
This is a combinatorial approach for gene expression regulation.<br />
<br />
==Modelling==<br />
<br />
* [[Team:Newcastle/Modelling/MetalIntake | Metal Intake/Efflux Model]]<br />
<br />
==BioBrick constructs==<br />
<br />
==Lab Work Strategies==<br />
*[[Team:Newcastle/Metal_Sensor_planA | Metal Sensor: czrA+arsR - plan A]]<br />
<br />
*[[Team:Newcastle/Metal_Sensor_planB | Metal Sensor: czrA+arsR - plan B]]<br />
<br />
==Other Presentations and Diagrams==<br />
<br />
[[Image:Newcastle Metalsensor2100.gif]]<br />
<br />
==Lab Work done==<br />
{| class=wikitable border="1"<br />
|-<br />
! colspan="2" | Summary of Lab Sessions for Cadmium Sensing<br />
|-<br />
| <center>'''Date'''</center><br />
| <center>'''Description'''</center> <br />
|-<br />
| '''[https://2009.igem.org/Team:Newcastle/Labwork/18_August_2009#Metal_Sensor_Team 18th August 2009]'''<br />
| Transformed ''DH5-alpha E. coli'' cells with ''BBa_J33206'' from the Spring Distribution<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/19_August_2009#Metal_Sensor_Team 19th August 2009]'''<br />
| Inoculated 3 tubes of LB with 3 colonies of potential transformant ''E.coli'' cells<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/20_August_2009#Metal_Sensor_Team 20th August 2009]'''<br />
| Conduct mini-preps on the three overnight-grown cultures of potential ''BBa_J33206'' transformants and digested them with restriction enzymes.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/21_August_2009#Metal_Sensor_Team 21st August 2009]'''<br />
|Analysed digested ''BBa_J33206'' mini-prep DNA by DNA gel electrophoresis and prepared midi-preps also.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/25_August_2009#Metal_Sensor_Team 25th August 2009]'''<br />
|Concentrated (and ethanol precipitated) the ''BBa_J33206'' Midi-prep sample.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/26_August_2009#Metal_Sensor_Team 26th August 2009]'''<br />
|Digested ''BBa_J33206'' midi-prep DNA with ''EcoRI'' and ''PstI'' and analysed through DNA gel electrophoresis - digest reaction not successful (a second attempt at digests needed)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/27_August_2009#Metal_Sensor_Team 27th August 2009]'''<br />
|Digested ''pSB1A2'' (containing ''BBa_J33206'' BioBrick), ran DNA though gel and excised band. Also analysed digested ''pSB1A2'' (''BBa_J33206'' BioBrick) in gel - '''bands erroneous'''<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/28_August_2009#Metal_Sensor_Team 28th August 2009]'''<br />
|Cleaned gel band using Gel extraction kit<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/1_September_2009#Metal_Sensor_Team 1st September 2009]'''<br />
|Attempted to PCR amplify the needed ''czrA'' gene from the genome of ''Bacillus subtilis''<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/2_September_2009#Metal_Sensor_Team 2nd September 2009]'''<br />
|PCR amplification of ''czrA'' gene failed - conducted ''B. subtilis'' genome prep and carried out PCR reaction on this DNA<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/3_September_2009#Metal_Sensor_Team 3rd September 2009]'''<br />
|Second attempt at ''czrA'' PCR amplification analysed on gel - also unsuccessful. Reattempted PCR amplification of ''czrA'' on ''B. subtilis'' genomic DNA at different annealing temperatures.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/4_September_2009#Metal_Sensing_Team 4th September 2009]'''<br />
|In light of 27/08/09 lab session (i.e. anomalous bands with digested ''BBa_J33206'' BioBrick), we have sent away the BioBrick for sequencing and are now using ''BBa_J33206'' sent to us by Chris French. Used Chris's ''BBa_J33206'' to transform ''E. coli'' cells. Also carried out PCR reactions<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/7_September_2009#Metal_Sensor_Team 7th September 2009]'''<br />
|Inoculated LB media with colonies of ''BBa_J33206'' (sent from Chris French) ''E. coli'' transformants for mini preps. By afternoon, cultures had grown sufficiently to further inoculate flasks of 50ml LB + amp for midi-preps. Mini-prep attempted but abandoned <br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/8_September_2009#Metal_Sensor_Team 8th September 2009]'''<br />
|Skipped mini-prep re-attempt and immediately carried out midi-prep of ''BBa_J33206'' BioBrick sent by Chris French. Digested sample with EcoRI and PstI and analysed through gel. Successful!<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/10_September_2009#Metal_Sensor_Team 10th September 2009]'''<br />
|PCR amplification of the ''cadA'' promoter and ''BBa_J33206'' BioBrick (missing promoter)<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/11_September_2009#Metal_Sensor_Team 11th September 2009]'''<br />
|Gel analysis shows PCR reactions worked. Tried to proceed with running the cleaned-up PCR products through gel to excise band but ethanol presence stopped us. Will have to reattempt PCR reactions and other subsequent steps.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/14_September_2009#1.29_Cadmium-sensing_logic_AND_gate 14th September 2009]'''<br />
|Both ''cadA'' promoter and ''BBa_J33206'' (with promoter missing) PCR reactions worked! Subsequently excised from gel and cleaned up. Both fragments cut with ''BamHI'' and ''NheI'' and ligated together. Attempted to transform ''E. coli'' with ligated cadmium-sensor.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/15_September_2009#Metal_Sensor_Team 15th September 2009]'''<br />
|No transformant colonies spotted on plates - either ligations or transformations didn't work. Reattempted ligation and transformation in ''E. coli'' cells.<br />
|-<br />
|'''[https://2009.igem.org/Team:Newcastle/Labwork/16_September_2009#Metal_Sensor_Team 16th September 2009]'''<br />
|Transformations failed! Reattempted digesting the ''BBa_J33206'' (with no promoter) and ''cadA'' promoter with ''BamHI'' and ''NheI'' and also reattempted ligations <br />
|-<br />
|'''17th September 2009'''<br />
|Subsequent work on cadmium sensor put on hold<br />
|-<br />
|}<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:42:23Z<p>Naw3: /* Growth Curves */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011]. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb (vector only) as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
The growth curves below show that growth of the strain with [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] integrated grows more slowly that the wild type, presumably because of increased sporulation rates. The addition of IPTG slows the growth rate still further. <br />
<br />
OD's above 1.0 need to be discounted since the spectrophotometer we used is not accurate above this OD. <br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb vector only, and BFS867 mutant transformed with pGFP-rrnb + BBa_K174011. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistance of spores as a selective measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:41:21Z<p>Naw3: /* Growth Curves */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011]. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb (vector only) as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
The growth curves below show that growth of the strain with [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] integrated grows more slowly that the wild type, presumably because of increased sporulation rates. The addition of IPTG slows the growth rate still further. <br />
<br />
OD's above 1.0 need to be discounted since the spectrophotometer we used is not accurate above this OD. <br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb vector only, and BFS867 mutant transformed with pGFP-rrnb + BBa_K174011. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistance of spores as a selective measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:29:47Z<p>Naw3: /* Experiment Overview */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011]. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb (vector only) as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb vector only, and BFS867 mutant transformed with pGFP-rrnb + BBa_K174011. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistance of spores as a selective measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:28:17Z<p>Naw3: /* Growth Curves */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011]. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb vector only, and BFS867 mutant transformed with pGFP-rrnb + BBa_K174011. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistance of spores as a selective measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:09:55Z<p>Naw3: /* Characterization of IPTG inducable KinA sporulation trigger device - part BBa_K174011 */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011] =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device [https://2009.igem.org/Team:Newcastle/Parts BBa_K174011]. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistance of spores as a selective measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:09:04Z<p>Naw3: /* Microscopy results */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part BBa_K174011 =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device BBa_K174011. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistance of spores as a selective measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:08:33Z<p>Naw3: /* Microscopy results */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part BBa_K174011 =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device BBa_K174011. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
'''We therefore believe that the sporulation rate tuning device works as expected.''' <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistant of spores as a measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:06:33Z<p>Naw3: /* Microscopy results */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part BBa_K174011 =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device BBa_K174011. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). Examination of the sample taken at time point 5 (see figure below) revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation (results not shown). <br />
<br />
As can be seen, at time point 5 (shown below) with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
We therefore believe that the sporulation rate tuning device works as expected. <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistant of spores as a measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:03:34Z<p>Naw3: /* Characterization of IPTG inducable KinA sporulation trigger device - part BBa_K174011 */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part BBa_K174011 =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device BBa_K174011. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. Examination of the sample taken at time point 5 revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. <br />
<br />
As can be seen, at time point 5 with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
We therefore believe that the sporulation rate tuning device works as expected. <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistant of spores as a measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:03:16Z<p>Naw3: /* Characterization of IPTG inducable KinA sporulation trigger device */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device - part BBa_K174011 =<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. Examination of the sample taken at time point 5 revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. <br />
<br />
As can be seen, at time point 5 with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
We therefore believe that the sporulation rate tuning device works as expected. <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistant of spores as a measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T21:02:40Z<p>Naw3: /* Microscopy results */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device=<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. Examination of the sample taken at time point 5 revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. <br />
<br />
As can be seen, at time point 5 with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
We therefore believe that the sporulation rate tuning device works as expected. <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistant of spores as a measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 + BBa_K174011 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|Gfp expression shown for BFS 867 + BBa_K174011 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T20:54:26Z<p>Naw3: /* Characterization of IPTG inducable KinA sporulation trigger device */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device=<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). ''kinA '' is a kinase that will phosphorylate Spo0A. Thus, we achieved the increase in sporulation rate by artificially inducing the gene, ''kinA'', with the pSpac promoter controlled by IPTG. We used growth curves and fluorescence microscopy to verify our results by assaying the expression of the gfp gene that is transcriptionally fused to kinA and by counting the spores visible by brightfield microscopy.<br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and so adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has the ''lacI'' gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into ''amyE'' in the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pGFP-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we measured the optical density of the cells to plot the growth curve of the cells. We also stored samples on ice at each time point. We added 1mM IPTG after one hour to one set of the cultures but not the other. We also used wild type ''B. subtilis'' and wild type cells transformed with pGFP-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium and absorbing them on to agarose slabs on microscope slides.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pGFP-rrnb, and BFS867 mutant transformed with pGFP-rrnb. (+ sign denotes IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
<br />
'''Without IPTG'''<br />
<br />
At time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. Examination of the sample taken at time point 5 revealed the presence of a few spores inside the mother cells and only minimal ''gfp'' expression. Some spores would be expected since natural sporulation was not disabled and the cultures were approaching stationary phase.<br />
<br />
'''With 1mM IPTG'''<br />
<br />
Again, at time point 1, the cells did not express ''gfp'' and there was little evidence of sporulation. <br />
<br />
As can be seen, at time point 5 with the addition of 1mM IPTG there are many spores due to the increased expression levels of KinA. In addition, many of the cells are showing high levels of gfp expression and many of the gfp expressing cells can be seen to contain spores. <br />
<br />
Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
We therefore believe that the sporulation rate tuning device works as expected. <br />
<br />
If we had time we would like to characterise this brick even further by carrying our sporulation assays (using the heat resistant of spores as a measure) and by flow cytometry to accurately measure the sporulation rate.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T20:38:08Z<p>Naw3: /* Characterization of IPTG inducable KinA sporulation trigger device */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device=<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). We achieved the increase in sporulation rate by artificially inducing ''kinA'' by IPTG to participate in a multicomponent phosphorelay. We used microscopy to verify our results. <br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has LacI gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pgf-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we meaured the optical density of the cells to get the growth curve of the cells. We also stored samples at each time point. We added IPTG after an hour we started to our experiments. We also used wild type ''B. subtilis'' and wild type cells transformed with pgfp-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pgfp-rrnb, and BFS867 mutant transformed with pgfp-rrnb. (+ sign represents IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
At time point 1, the cells did not express gfp and there was little evidence of sporulation. Examination of the sample taken at time point 5 revealed the presence of spores inside the mother cells. <br />
<br />
As it can be seen there are many spores. Original copy of KinA also works and make the cells sporulate. However as it can be seen, there are lots of cells with Gfp about to sporulate. Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T20:36:38Z<p>Naw3: /* Microscopy results */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device=<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). We achieved this scenario by artificially inducing ''kinA'' by IPTG to participate in a multicomponent phosphorelay. We used microscopy to verify our results. <br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has LacI gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pgf-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we meaured the optical density of the cells to get the growth curve of the cells. We also stored samples at each time point. We added IPTG after an hour we started to our experiments. We also used wild type ''B. subtilis'' and wild type cells transformed with pgfp-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pgfp-rrnb, and BFS867 mutant transformed with pgfp-rrnb. (+ sign represents IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
At time point 1, the cells did not express gfp and there was little evidence of sporulation. Examination of the sample taken at time point 5 revealed the presence of spores inside the mother cells. <br />
<br />
As it can be seen there are many spores. Original copy of KinA also works and make the cells sporulate. However as it can be seen, there are lots of cells with Gfp about to sporulate. Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/CharacterisationTeam:Newcastle/Characterisation2009-10-21T20:29:54Z<p>Naw3: /* Characterization of IPTG inducable KinA sporulation trigger device */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Characterization of IPTG inducable KinA sporulation trigger device=<br />
<br />
We successfully characterized our IPTG inducible ''kinA'' sporulation tuning device. Although Spo0A is the master regulator of sporulation in ''B. subtilis'', only an increase in phosphorylated Spo0A can trigger the sporulation(1). We achieved this scenario by artificially inducing ''kinA'' by IPTG to participate in a multicomponent phosphorelay. We used microscopy to verify our results. <br />
<br />
For more information about the design of this device go to our [https://2009.igem.org/Team:Newcastle/SporulationTuning sporulation tuning] page.<br />
<br />
Our synthesised device was cloned into the integration vector pGFP-rrnb constructed by Dr. JW Veening. By placing our device just before the ''gfp'' CDS in the integration vector, we hoped to see GFP when we induce the device with IPTG. However for IPTG to work, we needed LacI expressed in the cells. <br />
<br />
When we first did our transformation for ''B. subtilis'' we forgot this link and we got similar results with cells induced with IPTG and not induced with IPTG. Obviously LacI was not present in the cells and adding IPTG did not make any difference.<br />
<br />
We then used a ''Bacillus subtilis'' mutant, BFS687, which has pMutin4 integrated into the chromosomal DNA (2). We selected this mutant especially since it does not have any phenotype under a wide range of conditions as described in the [http://locus.jouy.inra.fr/cgi-bin/genmic/madbase/progs/madbase.operl Micado] database. Since pMutin4 has LacI gene, we were able to get LacI expressed in the cells. We successfully transformed the mutant with pGFP-rrnb carrying out kinA based sporulation rate tuning brick . ''amyE'' homologous regions in the integration vector mediated a double crossover into the chromosome. As a result of this crossover, cells lose the ''amyE'' gene and cannot break down starch. When transformed colonies are plated into starch plates, the transformed colonies that have successfully inetgrated the plasmid can be seen without any halos around them when we expose the plates to iodine. <br />
<br />
We then selected two transformed colonies from the starch plate and used them to induce sporulation by adding IPTG.<br />
<br />
To select the transformed colonies we prepared our plates with LB + Erythromycin + Chloramphenicol. Chloramphenicol was used to select pgf-rrnb based transformations and Erythromycin was used to select the colonies with pMutin4 intgrated. Hence, by adding these two antibiotics we made sure that we were using BFS867 mutants transformed with pgfp-rrnb integration vector containing our biobrick as an insert.<br />
<br />
Concentrations used to characterize our device:<br />
<br />
IPTG : 1mM<br />
Erythromycin :0.3ug/ml<br />
Chloramphenicol: 5ug/ml<br />
<br />
===Experiment Overview===<br />
Each 10ml of overnight cultures was split into two flasks with 60ml of LB+Em+CHL. Every half an hour we meaured the optical density of the cells to get the growth curve of the cells. We also stored samples at each time point. We added IPTG after an hour we started to our experiments. We also used wild type ''B. subtilis'' and wild type cells transformed with pgfp-rrnb as the negative and positive controls respectively.<br />
<br />
After time point 5, before the cells reached stationary phase, we used the samples from time point 1 and time point 5 and prepared them for microscopy by resuspending the cells in SMM medium.<br />
<br />
===Growth Curves===<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_1.png|350px]]<br />
| Shows Wild type ''B. subtilis'', WT. ''B. Subtilis'' transformed with pgfp-rrnb, and BFS867 mutant transformed with pgfp-rrnb. (+ sign represents IPTG added)<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_2.png|350px]]<br />
|<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_GrowthCurve_3.png|350px]]<br />
| Growth curve of the mutant with and without IPTG<br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
===Microscopy results===<br />
At time point 1, colonies did not have much Gfp and spores. When it is looked to the sample taken at time point 5, spores inside the mother cells can be noticed. As it can be seen there are many spores. Original copy of KinA also works and make the cells sporulate. However as it can be seen, there are lots of cells with Gfp about to sporulate. Hence we can conclude that the sporulation was mainly triggered by our device.<br />
<br />
{|<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, No IPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_5-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, No IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|-<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2Brightfield.png|thumb|250px|Bright Field image of BFS 867 at time point 5, WithIPTG]]<br />
|[[Image:Team_Newcastle_iGEM_2009_Microscopy_6-2GFP.png|thumb|250px|GFPs shown for BFS 867 at time point 5, With IPTG]] <br />
|-<br />
! <br />
!<br />
|-<br />
! <br />
!<br />
|}<br />
<br />
<br />
<br />
#Fujita, M. and R. Losick (2005). "Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A." Genes & Development 19(18): 2236-2244. <br />
# Retrieved 20/10/2009, from http://bacillus.genome.jp/bsorf_mutant_list/Page12.htm<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/ChoicesTeam:Newcastle/Choices2009-10-21T20:19:53Z<p>Naw3: /* Bacillus subtilis */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
<br />
=Choices Rationale=<br />
<br />
==Why deal with cadmium?==<br />
The BacMan project is focused mainly on sequestering the heavy metal cadmium from contaminated soils, however with the many other heavy metals known to contaminate agricultural land, such as Mercury or Arsenic, it is necessary for us to justify our decision.<br />
<br />
====Cadmium Exposure====<br />
Cadmium is one of the most toxic heavy metals to which the environment can be exposed. <br />
Smoking is a major source of cadmium exposure to humans, however the main source of contamination to food is the usage of cadmium containing fertilisers and sewage sludge on agricultural land used for crops and vegetables <font color="gray">(Jarup and Akesson. 2009)</font>. <br />
<br />
The level of human exposure is dependent on factors such as dietary habits, and contamination of agricultural land. Exposure is significantly higher in China and Japan than in Europe and the US due to the high intake of rice grown on soil contaminated by local polluting industries <font color="gray">(Nordberg et al. 2007)</font>. As well as food, water from rivers and wells can also be seriously contaminated.<br />
Cadmium is present in most foods however is particularly concentrated in molluscs, crabs and other shellfish, as well as tubular plants and root vegetables; cadmium is also concentrated in offal products such as kidney and liver.<br />
<br />
As well as humans, cadmium exposure has implications for other species, with recent studies revealing cadmium exposure has serious effects on embryonic development of grazing animals <font color="gray">(Nandi et al. 2009)</font>.<br />
<br />
====Cadmium is Nephrotoxic====<br />
In humans cadmium is nephrotoxic leading to damage to the proximal kidney tubules, which are the main site of accumulation. <br />
<br />
Heavy metals such as cadmium have been shown to be involved in reactions that produce reactive oxygen species which leads to amplified lipid peroxidation, damage to DNA and an upset in calcium homeostasis (Manca et al., 1991; Kumar et al., 1996; El-Maraghy et al., 2001; Mendez-Armenta et al., 2003; Lopez et al., 2006). <br />
<br />
There is evidence that cadmium serves as a competitive ion to calcium as it blocks all known calcium influx routes and also interferes with any neurotransmission initiated by calcium (Viarengo and Nicotera, 1991; Guan et al., 1988; Usai et al., 1999).<br />
However there is also evidence that cadmium ions increase the concentration of calcium in a cell – this concentration is usually cytotoxic leading to cell death (possibly the mechanism by which cadmium kills) (Orrenius and Nicotera, 1994).<br />
<br />
====Cadmium causes bone demineralisation====<br />
Exposure has also been linked to bone demineralisation.<br />
Cadmium was also responsible for causing a condition termed Itai-Itai Disease initially reported in a population in Toyama, Japan (Nordberg, 2004). The condition is characterised by the weakening of the bones, resulting in pain especially in the spine and leg bone areas. Progression of disease starts off as a gradually debilitating condition whereby the patient may find walking almost impossible. From that point onwards, the additional symptoms onset rapidly – these include kidney disorders, extreme pain, and bone breakage from the slightest of disturbances (an example is coughing). The end result is death (J.W. Hamilton, 2009).<br />
<br />
====Cancer?====<br />
It has also been recently suggested that low level exposure to cadmium can increase cancer risks, and cadmium has since been classified as a human carcinogen (Jarup and Akesson. 2009). <br />
<br />
====Neurotoxicity====<br />
Cadmium also has the ability to cross the blood-brain barrier, even though the amounts reaching the brain are small (Pal et al., 1993). The significance of the blood-brain barrier and cadmium neurotoxicity are confirmed in rat experiments, where infant rats suffer a larger degree of cadmium toxicity than do adult rats. The adult rats would have had more time for their blood-brain barriers to become established in comparison to newborn rats (Wong and Klaassen., 1982).<br />
<br />
It has been reported that cadmium can provoke neuronal cells in the brain to undergo oxidative stress – the mechanism behind this is cadmium’s ability to encourage the production of reactive oxygen species when it interacts with the mitochondria (L´opez et al., 2006). <br />
<br />
Cadmium can also affect the action of neurotransmitters. In studies, it has been shown to create an increase in concentration of inhibitory neurotransmitters (in particular GABA and Glycine) and create a decrease in the concentrations of excitatory neurotransmitters (in particular glutamate and aspartate) (Minami et al., 2001).<br />
<br />
=''Bacillus subtilis''=<br />
''Bacillus subtilis'' strain 168 is the bacterial species of choice for the 2009 Newcastle team. It is a Gram-positive, catalase-positive bacterium commonly found in soil. We chose ''B. subtilis'' for its ability to live in a soil enviroments and for its ability to sporulate.<br />
<br />
Some of our instructors and advisers know a great deal about ''B. subtilis'' and there is an active bacterial cell biology institute studying the molecular biology and physiology of this bacterium at Newcastle.<br />
<br />
The 2008 iGEM Newcastle team and a number of other 2008 also used ''B. subtilis'' and provide a nice overview of its advantages in their [https://2008.igem.org/Team:Newcastle_University/Bacillus_subtilis wiki]. Thanks to the efforts of these teams the number of ''B. subtilis'' parts in the registry is increasing. This year we have added many more.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/ChoicesTeam:Newcastle/Choices2009-10-21T20:19:30Z<p>Naw3: /* Why use Bacillus subtilis for our project? */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
<br />
=Choices Rationale=<br />
<br />
==Why deal with cadmium?==<br />
The BacMan project is focused mainly on sequestering the heavy metal cadmium from contaminated soils, however with the many other heavy metals known to contaminate agricultural land, such as Mercury or Arsenic, it is necessary for us to justify our decision.<br />
<br />
====Cadmium Exposure====<br />
Cadmium is one of the most toxic heavy metals to which the environment can be exposed. <br />
Smoking is a major source of cadmium exposure to humans, however the main source of contamination to food is the usage of cadmium containing fertilisers and sewage sludge on agricultural land used for crops and vegetables <font color="gray">(Jarup and Akesson. 2009)</font>. <br />
<br />
The level of human exposure is dependent on factors such as dietary habits, and contamination of agricultural land. Exposure is significantly higher in China and Japan than in Europe and the US due to the high intake of rice grown on soil contaminated by local polluting industries <font color="gray">(Nordberg et al. 2007)</font>. As well as food, water from rivers and wells can also be seriously contaminated.<br />
Cadmium is present in most foods however is particularly concentrated in molluscs, crabs and other shellfish, as well as tubular plants and root vegetables; cadmium is also concentrated in offal products such as kidney and liver.<br />
<br />
As well as humans, cadmium exposure has implications for other species, with recent studies revealing cadmium exposure has serious effects on embryonic development of grazing animals <font color="gray">(Nandi et al. 2009)</font>.<br />
<br />
====Nephrotoxicity====<br />
In humans cadmium is nephrotoxic leading to damage to the proximal kidney tubules, which are the main site of accumulation. <br />
<br />
Heavy metals such as cadmium have been shown to be involved in reactions that produce reactive oxygen species which leads to amplified lipid peroxidation, damage to DNA and an upset in calcium homeostasis (Manca et al., 1991; Kumar et al., 1996; El-Maraghy et al., 2001; Mendez-Armenta et al., 2003; Lopez et al., 2006). <br />
<br />
There is evidence that cadmium serves as a competitive ion to calcium as it blocks all known calcium influx routes and also interferes with any neurotransmission initiated by calcium (Viarengo and Nicotera, 1991; Guan et al., 1988; Usai et al., 1999).<br />
However there is also evidence that cadmium ions increase the concentration of calcium in a cell – this concentration is usually cytotoxic leading to cell death (possibly the mechanism by which cadmium kills) (Orrenius and Nicotera, 1994).<br />
<br />
====Bone demineralisation====<br />
Exposure has also been linked to bone demineralisation.<br />
Cadmium was also responsible for causing a condition termed Itai-Itai Disease initially reported in a population in Toyama, Japan (Nordberg, 2004). The condition is characterised by the weakening of the bones, resulting in pain especially in the spine and leg bone areas. Progression of disease starts off as a gradually debilitating condition whereby the patient may find walking almost impossible. From that point onwards, the additional symptoms onset rapidly – these include kidney disorders, extreme pain, and bone breakage from the slightest of disturbances (an example is coughing). The end result is death (J.W. Hamilton, 2009).<br />
<br />
====Cancer?====<br />
It has also been recently suggested that low level exposure to cadmium can increase cancer risks, and cadmium has since been classified as a human carcinogen (Jarup and Akesson. 2009). <br />
<br />
====Neurotoxicity====<br />
Cadmium also has the ability to cross the blood-brain barrier, even though the amounts reaching the brain are small (Pal et al., 1993). The significance of the blood-brain barrier and cadmium neurotoxicity are confirmed in rat experiments, where infant rats suffer a larger degree of cadmium toxicity than do adult rats. The adult rats would have had more time for their blood-brain barriers to become established in comparison to newborn rats (Wong and Klaassen., 1982).<br />
<br />
It has been reported that cadmium can provoke neuronal cells in the brain to undergo oxidative stress – the mechanism behind this is cadmium’s ability to encourage the production of reactive oxygen species when it interacts with the mitochondria (L´opez et al., 2006). <br />
<br />
Cadmium can also affect the action of neurotransmitters. In studies, it has been shown to create an increase in concentration of inhibitory neurotransmitters (in particular GABA and Glycine) and create a decrease in the concentrations of excitatory neurotransmitters (in particular glutamate and aspartate) (Minami et al., 2001).<br />
<br />
=''Bacillus subtilis''=<br />
''Bacillus subtilis'' strain 168 is the bacterial species of choice for the 2009 Newcastle team. It is a Gram-positive, catalase-positive bacterium commonly found in soil. We chose ''B. subtilis'' for its ability to live in a soil enviroments and for its ability to sporulate.<br />
<br />
Some of our instructors and advisers know a great deal about ''B. subtilis'' and there is an active bacterial cell biology institute studying the molecular biology and physiology of this bacterium at Newcastle.<br />
<br />
The 2008 iGEM Newcastle team and a number of other 2008 also used ''B. subtilis'' and provide a nice overview of its advantages in their [https://2008.igem.org/Team:Newcastle_University/Bacillus_subtilis wiki]. Thanks to the efforts of these teams the number of ''B. subtilis'' parts in the registry is increasing. This year we have added many more.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Project/BacillusTeam:Newcastle/Project/Bacillus2009-10-21T20:11:48Z<p>Naw3: /* Bacillus subtilis */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
=''Bacillus subtilis''=<br />
''Bacillus subtilis'' strain 168 is the bacterial species of choice for the 2009 Newcastle team. It is a Gram-positive, catalase-positive bacterium commonly found in soil. Some of our instructors and advisers, including Anil Wipat, know a great deal about ''B. subtilis'' and have worked with it in the past.<br />
<br />
The 2008 iGEM Newcastle team and a number of other 2008 also used ''B. subtilis'' and provide a nice overview of its advantages in their [https://2008.igem.org/Team:Newcastle_University/Bacillus_subtilis wiki]. Thanks to the efforts of these teams the number of ''B. subtilis'' parts in the registry is increasing. This year we have added many more.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Project/BacillusTeam:Newcastle/Project/Bacillus2009-10-21T20:11:31Z<p>Naw3: /* Bacillus subtilis */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
=''Bacillus subtilis''=<br />
''Bacillus subtilis'' is the bacterial species of choice for the 2009 Newcastle team. It is a Gram-positive, catalase-positive bacterium commonly found in soil. Some of our instructors and advisers, including Anil Wipat, know a great deal about ''B. subtilis'' and have worked with it in the past.<br />
<br />
The 2008 iGEM Newcastle team and a number of other 2008 also used ''B. subtilis'' and provide a nice overview of its advantages in their [https://2008.igem.org/Team:Newcastle_University/Bacillus_subtilis wiki]. Thanks to the efforts of these teams the number of ''B. subtilis'' parts in the registry is increasing. This year we have added many more.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Project/BacillusTeam:Newcastle/Project/Bacillus2009-10-21T20:09:42Z<p>Naw3: /* Bacillus subtilis */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
=''Bacillus subtilis''=<br />
''Bacillus subtilis'' is the bacterial species of choice for the 2009 Newcastle team. It is a Gram-positive, catalase-positive bacterium commonly found in soil. Some of our instructors and advisers, including Anil Wipat, know a great deal about ''B. subtilis'' and have worked with it in the past.<br />
<br />
The 2008 iGEM Newcastle team and a number of other 2008 also used ''B. subtilis'' and provide a nice overview of its advantages in their [wiki] https://2008.igem.org/Team:Newcastle_University/Bacillus_subtilis. Thanks to their efforts the number of B. subtilis parts in the registry is increasing. This year we have added many more.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/ChoicesTeam:Newcastle/Choices2009-10-21T20:04:17Z<p>Naw3: /* Bone demineralisation */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
<br />
=Choices Rationale=<br />
<br />
This page provides an explanation of rational choices made for different aspects of our project.<br />
<br />
==Why this project?==<br />
*[[Team:Newcastle/ProjectReasons|Project Justification]]<br />
<br />
==Why ''Bacillus subtilis''?==<br />
<br />
*[[Team:Newcastle/Project/Bacillus|''Bacillus subtilis'']]<br />
<br />
<br />
<br />
==Why in the soil?==<br />
<br />
*[[Team:Newcastle/Soil|Soil]]<br />
<br />
=Why cadmium?=<br />
The BacMan project is focused mainly on sequestering the heavy metal cadmium from contaminated soils, however with the many other heavy metals known to contaminate agricultural land, such as Mercury or Arsenic, it is necessary for us to justify our decision.<br />
<br />
===Exposure===<br />
Cadmium is one of the most toxic heavy metals to which the environment can be exposed. <br />
Smoking is a major source of cadmium exposure to humans, however the main source of contamination to food is the usage of cadmium containing fertilisers and sewage sludge on agricultural land used for crops and vegetables (Jarup and Akesson. 2009). <br />
<br />
The level of human exposure is dependent on factors such as dietary habits, and contamination of agricultural land. Exposure is significantly higher in China and Japan than in Europe and the US due to the high intake of rice grown on soil contaminated by local polluting industries (Nordberg et al. 2007) As well as food, water from rivers and wells can also be seriously contaminated.<br />
Cadmium is present in most foods however is particularly concentrated in molluscs, crabs and other shellfish, as well as tubular plants and root vegetables; cadmium is also concentrated in offal products such as kidney and liver.<br />
<br />
As well as humans, cadmium exposure has implications for other species, with recent studies revealing cadmium exposure has serious effects on embryonic development of grazing animals (Nandi et al. 2009). <br />
<br />
===Nephrotoxicity===<br />
In humans cadmium is nephrotoxic leading to damage to the proximal kidney tubules, which are the main site of accumulation. <br />
<br />
Heavy metals such as cadmium have been shown to be involved in reactions that produce reactive oxygen species which leads to amplified lipid peroxidation, damage to DNA and an upset in calcium homeostasis (Manca et al., 1991; Kumar et al., 1996; El-Maraghy et al., 2001; M´endez-Armenta et al., 2003; L´opez et al., 2006). <br />
<br />
There is evidence that cadmium serves as a competitive ion to calcium as it blocks all known calcium influx routes and also interferes with any neurotransmission initiated by calcium (Viarengo and Nicotera, 1991; Guan et al., 1988; Usai et al., 1999).<br />
However there is also evidence that cadmium ions increase the concentrations of calcium in a cell – this concentration is usually cytotoxic leading to cell death (possibly the mechanism by which cadmium kills) (Orrenius and Nicotera, 1994).<br />
<br />
===Bone demineralisation===<br />
Exposure has also been linked to bone demineralisation.<br />
Cadmium was also responsible for causing a condition termed Itai-Itai Disease initially reported in a population in Toyama, Japan (Nordberg, 2004). The condition is characterised by the weakening of the bones, resulting in pain especially in the spine and leg bone areas. Progression of disease starts off as a gradually debilitating condition whereby the patient may find walking almost impossible. From that point onwards, the additional symptoms onset rapidly – these include kidney disorders, extreme pain, and bone breakage from the slightest of disturbances (an example is coughing). The end result is death (J.W. Hamilton, 2009).<br />
<br />
===Cancer?===<br />
It has also been recently suggested that low level exposure to cadmium can increase cancer risks, and cadmium has since been classified as a human carcinogen (Jarup and Akesson. 2009). <br />
<br />
===Neurotoxicity===<br />
Cadmium also has the ability to cross the blood-brain barrier, even though the amounts reaching the brain are small (Pal et al., 1993). The significance of the blood-brain barrier and cadmium neurotoxicity are confirmed in rat experiments, where infant rats suffer a larger degree of cadmium toxicity than do adult rats. The adult rats would have had more time for their blood-brain barriers to become established in comparison to newborn rats (Wong and Klaassen., 1982).<br />
<br />
It has been reported that cadmium can provoke neuronal cells in the brain to undergo oxidative stress – the mechanism behind this is cadmium’s ability to encourage the production of reactive oxygen species when it interacts with the mitochondria (L´opez et al., 2006). <br />
<br />
Cadmium can also affect the action of neurotransmitters. In studies, it has been shown to create an increase in concentration of inhibitory neurotransmitters (in particular GABA and Glycine) and create a decrease in the concentrations of excitatory neurotransmitters (in particular glutamate and aspartate) (Minami et al., 2001).<br />
<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/ChoicesTeam:Newcastle/Choices2009-10-21T20:03:42Z<p>Naw3: /* Choices Rationale */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
<br />
=Choices Rationale=<br />
<br />
This page provides an explanation of rational choices made for different aspects of our project.<br />
<br />
==Why this project?==<br />
*[[Team:Newcastle/ProjectReasons|Project Justification]]<br />
<br />
==Why ''Bacillus subtilis''?==<br />
<br />
*[[Team:Newcastle/Project/Bacillus|''Bacillus subtilis'']]<br />
<br />
==Why Cadmium?==<br />
*The aim of our project is centred around the sequestration of cadmium; but what is cadmium and why is it important that we isolate it from the environment? Read the article to find out more<br />
*[[Team:Newcastle/Cadmium|Cadmium]]<br />
<br />
==Why in the soil?==<br />
<br />
*[[Team:Newcastle/Soil|Soil]]<br />
<br />
=Why cadmium?=<br />
The BacMan project is focused mainly on sequestering the heavy metal cadmium from contaminated soils, however with the many other heavy metals known to contaminate agricultural land, such as Mercury or Arsenic, it is necessary for us to justify our decision.<br />
<br />
===Exposure===<br />
Cadmium is one of the most toxic heavy metals to which the environment can be exposed. <br />
Smoking is a major source of cadmium exposure to humans, however the main source of contamination to food is the usage of cadmium containing fertilisers and sewage sludge on agricultural land used for crops and vegetables (Jarup and Akesson. 2009). <br />
<br />
The level of human exposure is dependent on factors such as dietary habits, and contamination of agricultural land. Exposure is significantly higher in China and Japan than in Europe and the US due to the high intake of rice grown on soil contaminated by local polluting industries (Nordberg et al. 2007) As well as food, water from rivers and wells can also be seriously contaminated.<br />
Cadmium is present in most foods however is particularly concentrated in molluscs, crabs and other shellfish, as well as tubular plants and root vegetables; cadmium is also concentrated in offal products such as kidney and liver.<br />
<br />
As well as humans, cadmium exposure has implications for other species, with recent studies revealing cadmium exposure has serious effects on embryonic development of grazing animals (Nandi et al. 2009). <br />
<br />
===Nephrotoxicity===<br />
In humans cadmium is nephrotoxic leading to damage to the proximal kidney tubules, which are the main site of accumulation. <br />
<br />
Heavy metals such as cadmium have been shown to be involved in reactions that produce reactive oxygen species which leads to amplified lipid peroxidation, damage to DNA and an upset in calcium homeostasis (Manca et al., 1991; Kumar et al., 1996; El-Maraghy et al., 2001; M´endez-Armenta et al., 2003; L´opez et al., 2006). <br />
<br />
There is evidence that cadmium serves as a competitive ion to calcium as it blocks all known calcium influx routes and also interferes with any neurotransmission initiated by calcium (Viarengo and Nicotera, 1991; Guan et al., 1988; Usai et al., 1999).<br />
However there is also evidence that cadmium ions increase the concentrations of calcium in a cell – this concentration is usually cytotoxic leading to cell death (possibly the mechanism by which cadmium kills) (Orrenius and Nicotera, 1994).<br />
<br />
===Bone demineralisation===<br />
Exposure has also been linked to bone demineralisation.<br />
Cadmium was also responsible for causing a condition termed Itai-Itai Disease initially reported in a population in Toyama, Japan (Nordberg, 2004). The condition is characterised by the weakening of the bones, resulting in pain especially in the spine and leg bone areas. Progression of disease starts off as a gradually debilitating condition whereby the patient may find walking almost impossible. From that point onwards, the additional symptoms onset rapidly – these include kidney disorders, extreme pain, and bone breakage from the slightest of disturbances (an example is coughing). The end result is death (J.W. Hamilton, 2009)<br />
<br />
===Cancer?===<br />
It has also been recently suggested that low level exposure to cadmium can increase cancer risks, and cadmium has since been classified as a human carcinogen (Jarup and Akesson. 2009). <br />
<br />
===Neurotoxicity===<br />
Cadmium also has the ability to cross the blood-brain barrier, even though the amounts reaching the brain are small (Pal et al., 1993). The significance of the blood-brain barrier and cadmium neurotoxicity are confirmed in rat experiments, where infant rats suffer a larger degree of cadmium toxicity than do adult rats. The adult rats would have had more time for their blood-brain barriers to become established in comparison to newborn rats (Wong and Klaassen., 1982).<br />
<br />
It has been reported that cadmium can provoke neuronal cells in the brain to undergo oxidative stress – the mechanism behind this is cadmium’s ability to encourage the production of reactive oxygen species when it interacts with the mitochondria (L´opez et al., 2006). <br />
<br />
Cadmium can also affect the action of neurotransmitters. In studies, it has been shown to create an increase in concentration of inhibitory neurotransmitters (in particular GABA and Glycine) and create a decrease in the concentrations of excitatory neurotransmitters (in particular glutamate and aspartate) (Minami et al., 2001).<br />
<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:NewcastleTeam:Newcastle2009-10-21T20:02:05Z<p>Naw3: /* Stochastic switch */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
[[Image:NewcastleBac-Man bacs.png|center|350px]]<br />
<br/><br />
<br />
;<center>In 2009 the Newcastle team are tackling environmental issues using ''Bacillus subtilis''. We are a team of eight with wide ranging backgrounds in the fields of Bioinformatics, Computing Science, Chemical Engineering, Genetics and Medical Sciences. This is Newcastle's second year in the iGEM competition; last year our team designed [https://2008.igem.org/Team:Newcastle_University BugBuster], which achieved a Gold Medal.</center><br />
<br />
=<center>Project Description</center>=<br />
<div align="justify"><br />
'''Cadmium contamination''' can be a serious problem in countries where polluting industries are located close to agricultural sites. Our team developed a design to address this problem using the resiliant spore-forming bacterium '''''Bacillus subtilis'''''.<br />
We engineered ''B. subtilis'' to sense and sequester cadmium from the environment into '''metallothionein containing spores''', rendering it '''bio-unavailable'''. Germination of the spores can be disabled, making retrieval of the cadmium unnecessary since they can persist intact for thousands of years.<br />
We '''computationally simulated the life cycles of individual cells''' and entire cell populations, to estimate the parameter values necessary to '''maintain sustainable populations''' of sporulating, germinating and vegetative cells. Our design required us to engineer stochastic differentiation processes at a single cell level. A '''sporulation rate tuner''' was developed and we also engineered a tuneable stochastic invertase switch to '''stochastically control cell differention and fate'''. <br />
</div><br />
<br />
<!-- I'll re-add the hover over links, when we know that this is final! --><br />
The following diagram gives an overview of our design... <br />
[[Image:NewcastleOverview pic 1.png|590px]]<br />
[[Image:NewcastleOverview pic 2.png|550px]]<br />
<br />
<br />
== Cadmium Sensing ==<br />
Our design allows bacteria to intake cadmium through the manganese channel MntH, as cadmium also leaks through these channels in addition to other metals [1]. The metal sensing proteins we intend to use are CzrA and ArsR which both bind cadmium as well as zinc cobalt and nickel, and arsenic, silver and copper respectively [2]. These proteins are repressor proteins which also bind DNA preventing transcription of downstream CDS. The repressor proteins however release the DNA to preferentially bind cadmium [2] allowing transcription to occur allowing selective sensing of cadmium in the form of a logic AND gate.<br />
<br />
== Population Dynamics ==<br />
As well as sensing cadmium we plan to engineer our bacteria’s normal population dynamics, by nudging the natural stochastic sporulation decision in favour of higher sporulation rates, to account for the spores that will be lost as metal containers. Our population model simulates whole cell populations using inputs from single cellular models and will be used to determine the required increase in sporulation rate.<br />
<br />
=Stochastic switch=<br />
We will also design our own stochastic switch, which will be used to make the cell's decision to become a metal container or not. This switch will be regulated by an invertible segment of DNA using the hin/hix system [3]. We favoured the use of an invertable DNA segment since the choice will be heritable and maintain its expression inside a spore. Our artificial stochastic switch will be a ‘biased heads or tails’ which we can control. This stochastic switch will either induce the expression of the genes which switch on the ‘metal sponge’ phenotype or will direct the cell to a wild-type lifestyle.<br />
<br />
== Metal Containers ==<br />
To make our spores into metal containers we will be using the metallothionein protein SmtA which is a relatively small cysteine rich protein known to ‘soak up’ metals such as cadmium [4]. We will guide this protein to the spore by creating a fusion with the spore coat protein CotC, which will embed cadmium bound metallothionein throughout the spore [5]. <br />
Finally, to ensure that metal containing spores will not germinate again, releasing their bound cadmium, we will ‘knock-out’ essential germination genes and selectively re-complement the resulting mutation.<br />
<br />
== Novelty ==<br />
Our design has many components which we believe are novel, such as our control over the sporulation cycle, and our synthetic stochastic switch, both systems we believe are reusable concepts within synthetic biology.<br />
<br />
<br />
<br />
== References ==<br />
# Que, Q. and J.D. Helmann, Manganese homestasis in ''Bacillus subtilis'' is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular Microbiology, 2000. 35(6): p. 1454-1468.<br />
# Harvie, D.R., et al., Predicting metals sensed by ArsR-SmtB repressors: Allosteric interference by a non-effector metal. Molecular Microbiology, 2006. 59(4): p. 1341-1356.<br />
# Haynes, K.A., et al., Engineering bacteria to solve the Burnt Pancake Problem. Journal of Biological Engineering, 2008. 2.<br />
# Blindauer, C.A., et al., Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Molecular Microbiology, 2002. 45(5): p. 1421-1432.<br />
# Mauriello, E.M.F., et al., Display of heterologous antigens on the ''Bacillus subtilis'' spore coat using CotC as a fusion partner. Vaccine, 2004. 22(9-10): p. 1177-1187.<br />
<br />
== External links ==<br />
* [http://www.ncl.ac.uk Newcastle University]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:NewcastleTeam:Newcastle2009-10-21T20:00:53Z<p>Naw3: /* Metal Containers */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
[[Image:NewcastleBac-Man bacs.png|center|350px]]<br />
<br/><br />
<br />
;<center>In 2009 the Newcastle team are tackling environmental issues using ''Bacillus subtilis''. We are a team of eight with wide ranging backgrounds in the fields of Bioinformatics, Computing Science, Chemical Engineering, Genetics and Medical Sciences. This is Newcastle's second year in the iGEM competition; last year our team designed [https://2008.igem.org/Team:Newcastle_University BugBuster], which achieved a Gold Medal.</center><br />
<br />
=<center>Project Description</center>=<br />
<div align="justify"><br />
'''Cadmium contamination''' can be a serious problem in countries where polluting industries are located close to agricultural sites. Our team developed a design to address this problem using the resiliant spore-forming bacterium '''''Bacillus subtilis'''''.<br />
We engineered ''B. subtilis'' to sense and sequester cadmium from the environment into '''metallothionein containing spores''', rendering it '''bio-unavailable'''. Germination of the spores can be disabled, making retrieval of the cadmium unnecessary since they can persist intact for thousands of years.<br />
We '''computationally simulated the life cycles of individual cells''' and entire cell populations, to estimate the parameter values necessary to '''maintain sustainable populations''' of sporulating, germinating and vegetative cells. Our design required us to engineer stochastic differentiation processes at a single cell level. A '''sporulation rate tuner''' was developed and we also engineered a tuneable stochastic invertase switch to '''stochastically control cell differention and fate'''. <br />
</div><br />
<br />
<!-- I'll re-add the hover over links, when we know that this is final! --><br />
The following diagram gives an overview of our design... <br />
[[Image:NewcastleOverview pic 1.png|590px]]<br />
[[Image:NewcastleOverview pic 2.png|550px]]<br />
<br />
<br />
== Cadmium Sensing ==<br />
Our design allows bacteria to intake cadmium through the manganese channel MntH, as cadmium also leaks through these channels in addition to other metals [1]. The metal sensing proteins we intend to use are CzrA and ArsR which both bind cadmium as well as zinc cobalt and nickel, and arsenic, silver and copper respectively [2]. These proteins are repressor proteins which also bind DNA preventing transcription of downstream CDS. The repressor proteins however release the DNA to preferentially bind cadmium [2] allowing transcription to occur allowing selective sensing of cadmium in the form of a logic AND gate.<br />
<br />
== Population Dynamics ==<br />
As well as sensing cadmium we plan to engineer our bacteria’s normal population dynamics, by nudging the natural stochastic sporulation decision in favour of higher sporulation rates, to account for the spores that will be lost as metal containers. Our population model simulates whole cell populations using inputs from single cellular models and will be used to determine the required increase in sporulation rate.<br />
<br />
=Stochastic switch=<br />
We will also design our own stochastic switch, which will be used to make the cell's decision to become a metal container or not. This switch will be regulated by an invertible segment of DNA using the hin/hix system [3]. We favoured the use of an invertable DNA segment since the choice will be heritable and maintain its expression inside a spore. Our artificial stochastic switch will be a ‘biased heads or tails’ which we can control. This stochastic switch will control expression of the genes which switch on our ‘metal sponge’ or will direct the cell to a wild-type lifestyle.<br />
<br />
== Metal Containers ==<br />
To make our spores into metal containers we will be using the metallothionein protein SmtA which is a relatively small cysteine rich protein known to ‘soak up’ metals such as cadmium [4]. We will guide this protein to the spore by creating a fusion with the spore coat protein CotC, which will embed cadmium bound metallothionein throughout the spore [5]. <br />
Finally, to ensure that metal containing spores will not germinate again, releasing their bound cadmium, we will ‘knock-out’ essential germination genes and selectively re-complement the resulting mutation.<br />
<br />
== Novelty ==<br />
Our design has many components which we believe are novel, such as our control over the sporulation cycle, and our synthetic stochastic switch, both systems we believe are reusable concepts within synthetic biology.<br />
<br />
<br />
<br />
== References ==<br />
# Que, Q. and J.D. Helmann, Manganese homestasis in ''Bacillus subtilis'' is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular Microbiology, 2000. 35(6): p. 1454-1468.<br />
# Harvie, D.R., et al., Predicting metals sensed by ArsR-SmtB repressors: Allosteric interference by a non-effector metal. Molecular Microbiology, 2006. 59(4): p. 1341-1356.<br />
# Haynes, K.A., et al., Engineering bacteria to solve the Burnt Pancake Problem. Journal of Biological Engineering, 2008. 2.<br />
# Blindauer, C.A., et al., Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Molecular Microbiology, 2002. 45(5): p. 1421-1432.<br />
# Mauriello, E.M.F., et al., Display of heterologous antigens on the ''Bacillus subtilis'' spore coat using CotC as a fusion partner. Vaccine, 2004. 22(9-10): p. 1177-1187.<br />
<br />
== External links ==<br />
* [http://www.ncl.ac.uk Newcastle University]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:NewcastleTeam:Newcastle2009-10-21T19:55:28Z<p>Naw3: /* =Stochastic switch */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
[[Image:NewcastleBac-Man bacs.png|center|350px]]<br />
<br/><br />
<br />
;<center>In 2009 the Newcastle team are tackling environmental issues using ''Bacillus subtilis''. We are a team of eight with wide ranging backgrounds in the fields of Bioinformatics, Computing Science, Chemical Engineering, Genetics and Medical Sciences. This is Newcastle's second year in the iGEM competition; last year our team designed [https://2008.igem.org/Team:Newcastle_University BugBuster], which achieved a Gold Medal.</center><br />
<br />
=<center>Project Description</center>=<br />
<div align="justify"><br />
'''Cadmium contamination''' can be a serious problem in countries where polluting industries are located close to agricultural sites. Our team developed a design to address this problem using the resiliant spore-forming bacterium '''''Bacillus subtilis'''''.<br />
We engineered ''B. subtilis'' to sense and sequester cadmium from the environment into '''metallothionein containing spores''', rendering it '''bio-unavailable'''. Germination of the spores can be disabled, making retrieval of the cadmium unnecessary since they can persist intact for thousands of years.<br />
We '''computationally simulated the life cycles of individual cells''' and entire cell populations, to estimate the parameter values necessary to '''maintain sustainable populations''' of sporulating, germinating and vegetative cells. Our design required us to engineer stochastic differentiation processes at a single cell level. A '''sporulation rate tuner''' was developed and we also engineered a tuneable stochastic invertase switch to '''stochastically control cell differention and fate'''. <br />
</div><br />
<br />
<!-- I'll re-add the hover over links, when we know that this is final! --><br />
The following diagram gives an overview of our design... <br />
[[Image:NewcastleOverview pic 1.png|590px]]<br />
[[Image:NewcastleOverview pic 2.png|550px]]<br />
<br />
<br />
== Cadmium Sensing ==<br />
Our design allows bacteria to intake cadmium through the manganese channel MntH, as cadmium also leaks through these channels in addition to other metals [1]. The metal sensing proteins we intend to use are CzrA and ArsR which both bind cadmium as well as zinc cobalt and nickel, and arsenic, silver and copper respectively [2]. These proteins are repressor proteins which also bind DNA preventing transcription of downstream CDS. The repressor proteins however release the DNA to preferentially bind cadmium [2] allowing transcription to occur allowing selective sensing of cadmium in the form of a logic AND gate.<br />
<br />
== Population Dynamics ==<br />
As well as sensing cadmium we plan to engineer our bacteria’s normal population dynamics, by nudging the natural stochastic sporulation decision in favour of higher sporulation rates, to account for the spores that will be lost as metal containers. Our population model simulates whole cell populations using inputs from single cellular models and will be used to determine the required increase in sporulation rate.<br />
<br />
=Stochastic switch=<br />
We will also design our own stochastic switch, which will be used to make the cell's decision to become a metal container or not. This switch will be regulated by an invertible segment of DNA using the hin/hix system [3]. We favoured the use of an invertable DNA segment since the choice will be heritable and maintain its expression inside a spore. Our artificial stochastic switch will be a ‘biased heads or tails’ which we can control. This stochastic switch will control expression of the genes which switch on our ‘metal sponge’ or will direct the cell to a wild-type lifestyle.<br />
<br />
== Metal Containers ==<br />
To make our spores metal containers we will be using the metallothionein protein SmtA which is a relatively small cysteine rich protein known to ‘soak up’ metals such as cadmium [4]. We will guide this protein to the spore whilst sporulating by creating a fusion with the spore coat protein CotC, which will coat the spore in cadmium bound metallothionein [5]. <br />
Finally, to ensure that metal containing spores will not germinate again, releasing their bound cadmium, we will ‘knock-out’ important germination genes using our invertible sequence system.<br />
<br />
== Novelty ==<br />
Our design has many components which we believe are novel, such as our control over the sporulation cycle, and our synthetic stochastic switch, both systems we believe are reusable concepts within synthetic biology.<br />
<br />
<br />
<br />
== References ==<br />
# Que, Q. and J.D. Helmann, Manganese homestasis in ''Bacillus subtilis'' is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular Microbiology, 2000. 35(6): p. 1454-1468.<br />
# Harvie, D.R., et al., Predicting metals sensed by ArsR-SmtB repressors: Allosteric interference by a non-effector metal. Molecular Microbiology, 2006. 59(4): p. 1341-1356.<br />
# Haynes, K.A., et al., Engineering bacteria to solve the Burnt Pancake Problem. Journal of Biological Engineering, 2008. 2.<br />
# Blindauer, C.A., et al., Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Molecular Microbiology, 2002. 45(5): p. 1421-1432.<br />
# Mauriello, E.M.F., et al., Display of heterologous antigens on the ''Bacillus subtilis'' spore coat using CotC as a fusion partner. Vaccine, 2004. 22(9-10): p. 1177-1187.<br />
<br />
== External links ==<br />
* [http://www.ncl.ac.uk Newcastle University]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:NewcastleTeam:Newcastle2009-10-21T19:50:14Z<p>Naw3: /* Population Dynamics */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
[[Image:NewcastleBac-Man bacs.png|center|350px]]<br />
<br/><br />
<br />
;<center>In 2009 the Newcastle team are tackling environmental issues using ''Bacillus subtilis''. We are a team of eight with wide ranging backgrounds in the fields of Bioinformatics, Computing Science, Chemical Engineering, Genetics and Medical Sciences. This is Newcastle's second year in the iGEM competition; last year our team designed [https://2008.igem.org/Team:Newcastle_University BugBuster], which achieved a Gold Medal.</center><br />
<br />
=<center>Project Description</center>=<br />
<div align="justify"><br />
'''Cadmium contamination''' can be a serious problem in countries where polluting industries are located close to agricultural sites. Our team developed a design to address this problem using the resiliant spore-forming bacterium '''''Bacillus subtilis'''''.<br />
We engineered ''B. subtilis'' to sense and sequester cadmium from the environment into '''metallothionein containing spores''', rendering it '''bio-unavailable'''. Germination of the spores can be disabled, making retrieval of the cadmium unnecessary since they can persist intact for thousands of years.<br />
We '''computationally simulated the life cycles of individual cells''' and entire cell populations, to estimate the parameter values necessary to '''maintain sustainable populations''' of sporulating, germinating and vegetative cells. Our design required us to engineer stochastic differentiation processes at a single cell level. A '''sporulation rate tuner''' was developed and we also engineered a tuneable stochastic invertase switch to '''stochastically control cell differention and fate'''. <br />
</div><br />
<br />
<!-- I'll re-add the hover over links, when we know that this is final! --><br />
The following diagram gives an overview of our design... <br />
[[Image:NewcastleOverview pic 1.png|590px]]<br />
[[Image:NewcastleOverview pic 2.png|550px]]<br />
<br />
<br />
== Cadmium Sensing ==<br />
Our design allows bacteria to intake cadmium through the manganese channel MntH, as cadmium also leaks through these channels in addition to other metals [1]. The metal sensing proteins we intend to use are CzrA and ArsR which both bind cadmium as well as zinc cobalt and nickel, and arsenic, silver and copper respectively [2]. These proteins are repressor proteins which also bind DNA preventing transcription of downstream CDS. The repressor proteins however release the DNA to preferentially bind cadmium [2] allowing transcription to occur allowing selective sensing of cadmium in the form of a logic AND gate.<br />
<br />
== Population Dynamics ==<br />
As well as sensing cadmium we plan to engineer our bacteria’s normal population dynamics, by nudging the natural stochastic sporulation decision in favour of higher sporulation rates, to account for the spores that will be lost as metal containers. Our population model simulates whole cell populations using inputs from single cellular models and will be used to determine the required increase in sporulation rate.<br />
<br />
==Stochastic switch=<br />
We will also design our own stochastic switch, which will be based on the decision of being a metal container or not. This will be regulated by an invertible segment of DNA using the hin/hix system [3]. In this way our artificial stochastic switch will be a ‘biased heads or tails’ which we can control. This stochastic switch will control expression of our ‘metal sponge’.<br />
<br />
== Metal Containers ==<br />
To make our spores metal containers we will be using the metallothionein protein smtA which is a relatively small cysteine rich protein known to ‘soak up’ metals such as cadmium [4]. We will guide this protein to the spore whilst sporulating by creating a fusion with the spore coat protein cotC, which will coat the spore in cadmium bound metallothionein [5]. <br />
Finally, to ensure that metal containing spores will not germinate again, releasing their bound cadmium, we will ‘knock-out’ important germination genes using our invertible sequence system.<br />
<br />
== Novelty ==<br />
Our design has many components which we believe are novel, such as our control over the sporulation cycle, and our synthetic stochastic switch, both systems we believe are reusable concepts within synthetic biology.<br />
<br />
<br />
<br />
== References ==<br />
# Que, Q. and J.D. Helmann, Manganese homestasis in ''Bacillus subtilis'' is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular Microbiology, 2000. 35(6): p. 1454-1468.<br />
# Harvie, D.R., et al., Predicting metals sensed by ArsR-SmtB repressors: Allosteric interference by a non-effector metal. Molecular Microbiology, 2006. 59(4): p. 1341-1356.<br />
# Haynes, K.A., et al., Engineering bacteria to solve the Burnt Pancake Problem. Journal of Biological Engineering, 2008. 2.<br />
# Blindauer, C.A., et al., Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Molecular Microbiology, 2002. 45(5): p. 1421-1432.<br />
# Mauriello, E.M.F., et al., Display of heterologous antigens on the ''Bacillus subtilis'' spore coat using CotC as a fusion partner. Vaccine, 2004. 22(9-10): p. 1177-1187.<br />
<br />
== External links ==<br />
* [http://www.ncl.ac.uk Newcastle University]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:NewcastleTeam:Newcastle2009-10-21T19:48:53Z<p>Naw3: /* Cadmium Sensing */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
[[Image:NewcastleBac-Man bacs.png|center|350px]]<br />
<br/><br />
<br />
;<center>In 2009 the Newcastle team are tackling environmental issues using ''Bacillus subtilis''. We are a team of eight with wide ranging backgrounds in the fields of Bioinformatics, Computing Science, Chemical Engineering, Genetics and Medical Sciences. This is Newcastle's second year in the iGEM competition; last year our team designed [https://2008.igem.org/Team:Newcastle_University BugBuster], which achieved a Gold Medal.</center><br />
<br />
=<center>Project Description</center>=<br />
<div align="justify"><br />
'''Cadmium contamination''' can be a serious problem in countries where polluting industries are located close to agricultural sites. Our team developed a design to address this problem using the resiliant spore-forming bacterium '''''Bacillus subtilis'''''.<br />
We engineered ''B. subtilis'' to sense and sequester cadmium from the environment into '''metallothionein containing spores''', rendering it '''bio-unavailable'''. Germination of the spores can be disabled, making retrieval of the cadmium unnecessary since they can persist intact for thousands of years.<br />
We '''computationally simulated the life cycles of individual cells''' and entire cell populations, to estimate the parameter values necessary to '''maintain sustainable populations''' of sporulating, germinating and vegetative cells. Our design required us to engineer stochastic differentiation processes at a single cell level. A '''sporulation rate tuner''' was developed and we also engineered a tuneable stochastic invertase switch to '''stochastically control cell differention and fate'''. <br />
</div><br />
<br />
<!-- I'll re-add the hover over links, when we know that this is final! --><br />
The following diagram gives an overview of our design... <br />
[[Image:NewcastleOverview pic 1.png|590px]]<br />
[[Image:NewcastleOverview pic 2.png|550px]]<br />
<br />
<br />
== Cadmium Sensing ==<br />
Our design allows bacteria to intake cadmium through the manganese channel MntH, as cadmium also leaks through these channels in addition to other metals [1]. The metal sensing proteins we intend to use are CzrA and ArsR which both bind cadmium as well as zinc cobalt and nickel, and arsenic, silver and copper respectively [2]. These proteins are repressor proteins which also bind DNA preventing transcription of downstream CDS. The repressor proteins however release the DNA to preferentially bind cadmium [2] allowing transcription to occur allowing selective sensing of cadmium in the form of a logic AND gate.<br />
<br />
== Population Dynamics ==<br />
As well as sensing cadmium plan to engineer our bacteria’s normal population dynamics, by nudging the natural stochastic sporulation decision in favour of greater sporulation, to account for the spores that will be lost as metal containers. Our population model simulates whole cell populations using inputs from single cellular models <br />
<br />
<br />
==Stochastic switch=<br />
We will also design our own stochastic switch, which will be based on the decision of being a metal container or not. This will be regulated by an invertible segment of DNA using the hin/hix system [3]. In this way our artificial stochastic switch will be a ‘biased heads or tails’ which we can control. This stochastic switch will control expression of our ‘metal sponge’.<br />
<br />
== Metal Containers ==<br />
To make our spores metal containers we will be using the metallothionein protein smtA which is a relatively small cysteine rich protein known to ‘soak up’ metals such as cadmium [4]. We will guide this protein to the spore whilst sporulating by creating a fusion with the spore coat protein cotC, which will coat the spore in cadmium bound metallothionein [5]. <br />
Finally, to ensure that metal containing spores will not germinate again, releasing their bound cadmium, we will ‘knock-out’ important germination genes using our invertible sequence system.<br />
<br />
== Novelty ==<br />
Our design has many components which we believe are novel, such as our control over the sporulation cycle, and our synthetic stochastic switch, both systems we believe are reusable concepts within synthetic biology.<br />
<br />
<br />
<br />
== References ==<br />
# Que, Q. and J.D. Helmann, Manganese homestasis in ''Bacillus subtilis'' is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular Microbiology, 2000. 35(6): p. 1454-1468.<br />
# Harvie, D.R., et al., Predicting metals sensed by ArsR-SmtB repressors: Allosteric interference by a non-effector metal. Molecular Microbiology, 2006. 59(4): p. 1341-1356.<br />
# Haynes, K.A., et al., Engineering bacteria to solve the Burnt Pancake Problem. Journal of Biological Engineering, 2008. 2.<br />
# Blindauer, C.A., et al., Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Molecular Microbiology, 2002. 45(5): p. 1421-1432.<br />
# Mauriello, E.M.F., et al., Display of heterologous antigens on the ''Bacillus subtilis'' spore coat using CotC as a fusion partner. Vaccine, 2004. 22(9-10): p. 1177-1187.<br />
<br />
== External links ==<br />
* [http://www.ncl.ac.uk Newcastle University]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:NewcastleTeam:Newcastle2009-10-21T19:48:39Z<p>Naw3: /* Cadmium Sensing */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
[[Image:NewcastleBac-Man bacs.png|center|350px]]<br />
<br/><br />
<br />
;<center>In 2009 the Newcastle team are tackling environmental issues using ''Bacillus subtilis''. We are a team of eight with wide ranging backgrounds in the fields of Bioinformatics, Computing Science, Chemical Engineering, Genetics and Medical Sciences. This is Newcastle's second year in the iGEM competition; last year our team designed [https://2008.igem.org/Team:Newcastle_University BugBuster], which achieved a Gold Medal.</center><br />
<br />
=<center>Project Description</center>=<br />
<div align="justify"><br />
'''Cadmium contamination''' can be a serious problem in countries where polluting industries are located close to agricultural sites. Our team developed a design to address this problem using the resiliant spore-forming bacterium '''''Bacillus subtilis'''''.<br />
We engineered ''B. subtilis'' to sense and sequester cadmium from the environment into '''metallothionein containing spores''', rendering it '''bio-unavailable'''. Germination of the spores can be disabled, making retrieval of the cadmium unnecessary since they can persist intact for thousands of years.<br />
We '''computationally simulated the life cycles of individual cells''' and entire cell populations, to estimate the parameter values necessary to '''maintain sustainable populations''' of sporulating, germinating and vegetative cells. Our design required us to engineer stochastic differentiation processes at a single cell level. A '''sporulation rate tuner''' was developed and we also engineered a tuneable stochastic invertase switch to '''stochastically control cell differention and fate'''. <br />
</div><br />
<br />
<!-- I'll re-add the hover over links, when we know that this is final! --><br />
The following diagram gives an overview of our design... <br />
[[Image:NewcastleOverview pic 1.png|590px]]<br />
[[Image:NewcastleOverview pic 2.png|550px]]<br />
<br />
<br />
== Cadmium Sensing ==<br />
Our design allows bacteria to intake cadmium through the manganese channel MntH, as cadmium also leaks through these channels in addition to other metals[1]. The metal sensing proteins we intend to use are CzrA and ArsR which both bind cadmium as well as zinc cobalt and nickel, and arsenic, silver and copper respectively [2]. These proteins are repressor proteins which also bind DNA preventing transcription of downstream CDS. The repressor proteins however release the DNA to preferentially bind cadmium [2] allowing transcription to occur allowing selective sensing of cadmium in the form of a logic AND gate.<br />
<br />
== Population Dynamics ==<br />
As well as sensing cadmium plan to engineer our bacteria’s normal population dynamics, by nudging the natural stochastic sporulation decision in favour of greater sporulation, to account for the spores that will be lost as metal containers. Our population model simulates whole cell populations using inputs from single cellular models <br />
<br />
<br />
==Stochastic switch=<br />
We will also design our own stochastic switch, which will be based on the decision of being a metal container or not. This will be regulated by an invertible segment of DNA using the hin/hix system [3]. In this way our artificial stochastic switch will be a ‘biased heads or tails’ which we can control. This stochastic switch will control expression of our ‘metal sponge’.<br />
<br />
== Metal Containers ==<br />
To make our spores metal containers we will be using the metallothionein protein smtA which is a relatively small cysteine rich protein known to ‘soak up’ metals such as cadmium [4]. We will guide this protein to the spore whilst sporulating by creating a fusion with the spore coat protein cotC, which will coat the spore in cadmium bound metallothionein [5]. <br />
Finally, to ensure that metal containing spores will not germinate again, releasing their bound cadmium, we will ‘knock-out’ important germination genes using our invertible sequence system.<br />
<br />
== Novelty ==<br />
Our design has many components which we believe are novel, such as our control over the sporulation cycle, and our synthetic stochastic switch, both systems we believe are reusable concepts within synthetic biology.<br />
<br />
<br />
<br />
== References ==<br />
# Que, Q. and J.D. Helmann, Manganese homestasis in ''Bacillus subtilis'' is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular Microbiology, 2000. 35(6): p. 1454-1468.<br />
# Harvie, D.R., et al., Predicting metals sensed by ArsR-SmtB repressors: Allosteric interference by a non-effector metal. Molecular Microbiology, 2006. 59(4): p. 1341-1356.<br />
# Haynes, K.A., et al., Engineering bacteria to solve the Burnt Pancake Problem. Journal of Biological Engineering, 2008. 2.<br />
# Blindauer, C.A., et al., Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Molecular Microbiology, 2002. 45(5): p. 1421-1432.<br />
# Mauriello, E.M.F., et al., Display of heterologous antigens on the ''Bacillus subtilis'' spore coat using CotC as a fusion partner. Vaccine, 2004. 22(9-10): p. 1177-1187.<br />
<br />
== External links ==<br />
* [http://www.ncl.ac.uk Newcastle University]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:NewcastleTeam:Newcastle2009-10-21T19:48:22Z<p>Naw3: /* Cadmium Sensing */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
[[Image:NewcastleBac-Man bacs.png|center|350px]]<br />
<br/><br />
<br />
;<center>In 2009 the Newcastle team are tackling environmental issues using ''Bacillus subtilis''. We are a team of eight with wide ranging backgrounds in the fields of Bioinformatics, Computing Science, Chemical Engineering, Genetics and Medical Sciences. This is Newcastle's second year in the iGEM competition; last year our team designed [https://2008.igem.org/Team:Newcastle_University BugBuster], which achieved a Gold Medal.</center><br />
<br />
=<center>Project Description</center>=<br />
<div align="justify"><br />
'''Cadmium contamination''' can be a serious problem in countries where polluting industries are located close to agricultural sites. Our team developed a design to address this problem using the resiliant spore-forming bacterium '''''Bacillus subtilis'''''.<br />
We engineered ''B. subtilis'' to sense and sequester cadmium from the environment into '''metallothionein containing spores''', rendering it '''bio-unavailable'''. Germination of the spores can be disabled, making retrieval of the cadmium unnecessary since they can persist intact for thousands of years.<br />
We '''computationally simulated the life cycles of individual cells''' and entire cell populations, to estimate the parameter values necessary to '''maintain sustainable populations''' of sporulating, germinating and vegetative cells. Our design required us to engineer stochastic differentiation processes at a single cell level. A '''sporulation rate tuner''' was developed and we also engineered a tuneable stochastic invertase switch to '''stochastically control cell differention and fate'''. <br />
</div><br />
<br />
<!-- I'll re-add the hover over links, when we know that this is final! --><br />
The following diagram gives an overview of our design... <br />
[[Image:NewcastleOverview pic 1.png|590px]]<br />
[[Image:NewcastleOverview pic 2.png|550px]]<br />
<br />
<br />
== Cadmium Sensing ==<br />
Our design is allows bacteria to intake cadmium through the manganese channel MntH, as cadmium also leaks through these channels in addition to other metals[1]. The metal sensing proteins we intend to use are CzrA and ArsR which both bind cadmium as well as zinc cobalt and nickel, and arsenic, silver and copper respectively [2]. These proteins are repressor proteins which also bind DNA preventing transcription of downstream CDS. The repressor proteins however release the DNA to preferentially bind cadmium [2] allowing transcription to occur allowing selective sensing of cadmium in the form of a logic AND gate.<br />
<br />
== Population Dynamics ==<br />
As well as sensing cadmium plan to engineer our bacteria’s normal population dynamics, by nudging the natural stochastic sporulation decision in favour of greater sporulation, to account for the spores that will be lost as metal containers. Our population model simulates whole cell populations using inputs from single cellular models <br />
<br />
<br />
==Stochastic switch=<br />
We will also design our own stochastic switch, which will be based on the decision of being a metal container or not. This will be regulated by an invertible segment of DNA using the hin/hix system [3]. In this way our artificial stochastic switch will be a ‘biased heads or tails’ which we can control. This stochastic switch will control expression of our ‘metal sponge’.<br />
<br />
== Metal Containers ==<br />
To make our spores metal containers we will be using the metallothionein protein smtA which is a relatively small cysteine rich protein known to ‘soak up’ metals such as cadmium [4]. We will guide this protein to the spore whilst sporulating by creating a fusion with the spore coat protein cotC, which will coat the spore in cadmium bound metallothionein [5]. <br />
Finally, to ensure that metal containing spores will not germinate again, releasing their bound cadmium, we will ‘knock-out’ important germination genes using our invertible sequence system.<br />
<br />
== Novelty ==<br />
Our design has many components which we believe are novel, such as our control over the sporulation cycle, and our synthetic stochastic switch, both systems we believe are reusable concepts within synthetic biology.<br />
<br />
<br />
<br />
== References ==<br />
# Que, Q. and J.D. Helmann, Manganese homestasis in ''Bacillus subtilis'' is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Molecular Microbiology, 2000. 35(6): p. 1454-1468.<br />
# Harvie, D.R., et al., Predicting metals sensed by ArsR-SmtB repressors: Allosteric interference by a non-effector metal. Molecular Microbiology, 2006. 59(4): p. 1341-1356.<br />
# Haynes, K.A., et al., Engineering bacteria to solve the Burnt Pancake Problem. Journal of Biological Engineering, 2008. 2.<br />
# Blindauer, C.A., et al., Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Molecular Microbiology, 2002. 45(5): p. 1421-1432.<br />
# Mauriello, E.M.F., et al., Display of heterologous antigens on the ''Bacillus subtilis'' spore coat using CotC as a fusion partner. Vaccine, 2004. 22(9-10): p. 1177-1187.<br />
<br />
== External links ==<br />
* [http://www.ncl.ac.uk Newcastle University]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Modeling/PopulationTeam:Newcastle/Modeling/Population2009-10-21T12:29:45Z<p>Naw3: /* Distributed Computing */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
== Population modelling ==<br />
One of the models which we are producing is one concerning the population numbers of our bacteria. It looks at how our additions to the DNA may affect the growth of the bacterial population.<br />
<br />
This model is currently being implemented in the Java programming language, and connects to other models which we have written in CellML. Due to the design of the program, the team has enlisted the help of some very powerful computers. The next iteration of the program is to use distributed computing and the "Amazon Cloud" to extend the size of the bacterial population.<br />
<br />
== Visualisation ==<br />
Alongside the actual simulation we are developing an application to visualise the output of our simulation in a three dimensional environment.<br />
<br />
Below is a basic visualisation of one of the early versions of our simulation, where the different states of the bacterial cells are represented by differing colours:<br />
[[Image:Popmodelling.gif]]<br />
<br />
== Distributed Computing ==<br />
Distributed Computing (also known as Cloud or Grid computing) is the use of multiple computing processors, which can be spread around the world to accomplish a single given task. The processes on the machines may also communicate with each other, instead of simply acting independently.<br />
<br />
Due to early versions of our bacterial population simulation program using a lot of CPU time and RAM, we attempted to think of ways to be able to speed up the processing times and expand the simulation. These early simulations were fairly small scale, but as each bacterial cell runs as an independent Thread, every system that we ran it on began to slow down dramatically.<br />
<br />
Newcastle's School of Computing Science Integrative Bioinformatics Team had been working on a software system for grid computing applications in the scientific field, called microbase [http://www.example.com link title]. Funded by the BBSRC and the DTI, Microbase has been used in Microbial Genome Comparison and Analysis. Keith Flanagan, a Researcher at Newcastle University and member of the Microbase Project, suggested that Microbase could aid us in the development of a distributed version of our bacterial population simulation. Using Microbase meant that almost all of the programming concerned with the smooth running of our was simple to carry out, and we were easily able to convert our single machine program to a distributed one.<br />
<br />
Using Microbase we are running our simulation on the Amazon Elastic Compute Cloud, a service provided by the e-commerce company Amazon.com, which gives users access to a resizeable large number of powerful machines. Prior to running our simulations using Amazon's computers, we tested our program using some of the machines in some of the University's computer clusters.<br />
<br />
[[Image:Newcastle Amazon.png|center|512px]]<br />
<br />
== Code ==<br />
Due to the complexities of running the model, as it is designed for distributed systems, the code for our population simulation model is available on request. Please email one of our advisors, <html><a href="mailto: m.taschuk@ncl.ac.uk">Morgan Taschuk</a></html>, for more information.<br />
<br />
=== Pseudo code ===<br />
Please [[Team:Newcastle/Modeling/Population/Pseudo|click here]] to see some 'pseudo code' which explains the inner workings of our population simulation.<br />
<br />
== References ==<br />
<br />
== External links ==<br />
* [http://aws.amazon.com/ec2/ Amazon Elastic Compute Cloud]<br />
* [http://madras.ncl.ac.uk/microbase-drupal/ Microbase]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/Modeling/PopulationTeam:Newcastle/Modeling/Population2009-10-21T12:27:48Z<p>Naw3: /* Distributed Computing */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
== Population modelling ==<br />
One of the models which we are producing is one concerning the population numbers of our bacteria. It looks at how our additions to the DNA may affect the growth of the bacterial population.<br />
<br />
This model is currently being implemented in the Java programming language, and connects to other models which we have written in CellML. Due to the design of the program, the team has enlisted the help of some very powerful computers. The next iteration of the program is to use distributed computing and the "Amazon Cloud" to extend the size of the bacterial population.<br />
<br />
== Visualisation ==<br />
Alongside the actual simulation we are developing an application to visualise the output of our simulation in a three dimensional environment.<br />
<br />
Below is a basic visualisation of one of the early versions of our simulation, where the different states of the bacterial cells are represented by differing colours:<br />
[[Image:Popmodelling.gif]]<br />
<br />
== Distributed Computing ==<br />
Distributed Computing (also known as Cloud or Grid computing) is the use of multiple computing processors, which can be spread around the world to accomplish a single given task. The processes on the machines may also communicate with each other, instead of simply acting independently.<br />
<br />
Due to early versions of our bacterial population simulation program using a lot of CPU time and RAM, we attempted to think of ways to be able to speed up the processing times and expand the simulation. These early simulations were fairly small scale, but as each bacterial cell runs as an independent Thread, every system that we ran it on began to slow down dramatically.<br />
<br />
Newcastle's School of Computing Science Integrative Bioinformatics Team had been working on a software system for grid computing applications in the scientific field, called <a href="http://madras.ncl.ac.uk/microbase-drupal/"> microbase<\A>. Funded by the BBSRC and the DTI, Microbase has been used in Microbial Genome Comparison and Analysis. Keith Flanagan, a Researcher at Newcastle University and member of the Microbase Project, suggested that Microbase could aid us in the development of a distributed version of our bacterial population simulation. Using Microbase meant that almost all of the programming concerned with the smooth running of our was simple to carry out, and we were easily able to convert our single machine program to a distributed one.<br />
<br />
Using Microbase we are running our simulation on the Amazon Elastic Compute Cloud, a service provided by the e-commerce company Amazon.com, which gives users access to a resizeable large number of powerful machines. Prior to running our simulations using Amazon's computers, we tested our program using some of the machines in some of the University's computer clusters.<br />
<br />
[[Image:Newcastle Amazon.png|center|512px]]<br />
<br />
== Code ==<br />
Due to the complexities of running the model, as it is designed for distributed systems, the code for our population simulation model is available on request. Please email one of our advisors, <html><a href="mailto: m.taschuk@ncl.ac.uk">Morgan Taschuk</a></html>, for more information.<br />
<br />
=== Pseudo code ===<br />
Please [[Team:Newcastle/Modeling/Population/Pseudo|click here]] to see some 'pseudo code' which explains the inner workings of our population simulation.<br />
<br />
== References ==<br />
<br />
== External links ==<br />
* [http://aws.amazon.com/ec2/ Amazon Elastic Compute Cloud]<br />
* [http://madras.ncl.ac.uk/microbase-drupal/ Microbase]<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-21T11:56:32Z<p>Naw3: /* Testing construct */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most unique aspects of our project is our synthetic stochastic switch which regulates the decision to be a metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We intend to design a synthetic stochastic switch by using an invertible segment of our DNA that codes a promoter. Depending on the direction of the promoter, coding sequences will be expressed which reflect the decision to be a metal container or not. We also plan to tune the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|350px]]<br />
<br />
==BioBrick constructs==<br />
<br />
There will be various bricks involved within the stochastic switch construct, both those involved in the complete system as well as those designed for testing within the lab. <br />
The stochastic brick construct uses the Hin invertase system in order to flip a promoter region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control:<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| center 100px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. Once the stochastic promoter faces right, a fimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''CwlD'' <br />
and ''SleB'' genes knocked out within our chassis. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore. <br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing ''KinA'' expression. ''KinA'' codes a kinase protein that phosphorylates the ''Spo0A'' protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Expression of the metallothionein fusion protein (''CotC-GFP-SmtA''), cadmium import channel (''mntH'') and the canmium efflux channel (CadA) is also governed by the direction of the stochastic promoter. <br />
<br />
===Stochastic Brick===<br />
We have decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time costly. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|700px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we have had to redesign using inducible promoters governing Hin invertase expression. We have used promoters ''pSpac'' and ''pxylA'' (Induced by IPTG and Xylose) to test our system. We include cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we have added a degradation tag to the hin invertase protein. The following paper describes how proteins including modified ssrA tags can be located to the ClpXP protease by an sspb protein. This means that inducible sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in Bacillus subtilis using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We have decided to put the sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates, also we have included a region of the sac gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than amyE. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of Hin protein. Hence expressed proteins are degraded by ClpXP. However mutations on the ''ssrA'' tag weakens the recognition by ClpX and the modified tags require sspB adaptor protein to be recognized. Hence when sspB protein is expressed, the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation, otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no sspB orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of sspB by arabinose, we designed an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|400px]]<br />
<br />
<br />
Wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis'' however degradation tags can affect activity of proteins. Different degradation tags may have effect on the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in Bacillus subtilis using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
<br />
We have the following cloning strategies for testing our construct.<br />
<br />
==Lab Work Strategies==<br />
====Cloning strategies====<br />
Currently in the lab we are half way to acheiving a complete manual brick which is the degradation controller. In the lab so far, the stochastic switch team have:<br />
*Rehydrated, transformed, and miniprepped the biiobricks involved in promoter replacement, as well as frozen down these ''E.coli'' strains into the TPA collection.<br />
*Prepared the pSB1AT3 plasmid backbone (restriction digest, gel extraction) ready for ligation.<br />
*Have successful PCR products for the sac region (''bacillus'') and sspb (''E.coli''), and a possible success for the ara region. <br />
* Have done digests for sspb and sac, sspb has been extracted from the gel and is due for cloning. <br />
<br />
==Modelling==<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. Glasgow team used Matlab implementing Gillespie algorithm to incorporate noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
CellML model for the expression of Hin system<br />
<br />
[[Media:flipping.txt]]<br />
<br />
We have used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===Metal Container Decision===<br />
Our stochastic switch decides whether the spores can germinate, or whether they are commited to be a metal containing spore that cannot germinate again. We need this switch as we cannot interrupt the natural life cycle of the bacteria, as a proportion have to go on to seed the next generation.<br />
<br />
We looked at the following possibilities:<br />
<br />
===Hin/Hix system===<br />
In 2006, Davidson team tried to solve the burnt pancake problem by using DNA rearrangement using Hin/Hix system from ''Salmonella typhimurium''. (http://parts2.mit.edu/wiki/index.php/Davidson_2006.) Basically they tried to use the bacteria as a biomemory! They also have a paper published which is attached.<br />
<br />
Their animation explains the process quite well.<br />
(http://www.bio.davidson.edu/people/kahaynes/FAMU_talk/Living_computer.swf)<br />
<br />
The parts they submitted to the parts registry have "W" flag which means they are working.<br />
http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2006&group=iGEM2006_Davidson<br />
<br />
The Hin system will be the main DNA rearrangement system within our stochastic switch, <br />
Unlike the ''fim'' system the ''hin'' system allows the DNA segment to be flipped back and forth, therefore a pulse of hin expression is what we would need to ensure we can get the correct proportion to be metal containers. <br />
<br />
The switch as an overall diagram<br />
[[Media:MetalContainerDecisionSwitch.ppt]]<br />
<br />
Animation of how the switch works<br />
<br />
[[Media:switch animation.ppt]]<br />
<br />
==Other Presentations and Diagrams==<br />
<br />
===fimE switch===<br />
The FimE switch is a similar switch to the Hix system, however it acts as a latch, meaning once flipped, the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We could use it switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3http://2009.igem.org/Team:Newcastle/StochasticityTeam:Newcastle/Stochasticity2009-10-21T11:54:16Z<p>Naw3: /* Novelty in this sub-project */</p>
<hr />
<div>{{:Team:Newcastle/CSS}}<br />
{{:Team:Newcastle/Header}}<br />
{{:Team:Newcastle/Left}}<br />
__NOTOC__<br />
=Stochastic Switch=<br />
<br />
==Introduction==<br />
<br />
One of the most unique aspects of our project is our synthetic stochastic switch which regulates the decision to be a metal container spore, or a spore that can go on to germinate as part of the normal life cycle. Whilst stochastic oscillators have been implemented before using transcriptional regulators, our switch makes use of an invertable DNA segment to ensure that the decision is heritable.<br />
<br />
==Novelty in this sub-project==<br />
<br />
We intend to design a synthetic stochastic switch by using an invertible segment of our DNA that codes a promoter. Depending on the direction of the promoter, coding sequences will be expressed which reflect the decision to be a metal container or not. We also plan to tune the natural stochasticity of the sporulation system towards greater sporulation rates by altering the rate ''Spo0A'' phosphorylation.<br />
<br />
[[Image:Team_Newcastle_iGEM_2009_StochasticSwitch_GFP_2.png|350px]]<br />
<br />
==BioBrick constructs==<br />
<br />
There will be various bricks involved within the stochastic switch construct, both those involved in the complete system as well as those designed for testing within the lab. <br />
The stochastic brick construct uses the Hin invertase system in order to flip a promoter region between Hix sites. The directionality of the promoter determines whether the switch is 'on' or 'off'. When the promoter is facing right it allows transcription of genes that control:<br />
** Prevention of germination <br />
** Upregulation of sporulation rate<br />
** Expression of the metal sponge (SmtA)<br />
** Decreased cadmium efflux<br />
** Upregulation of cadmium import<br />
<br />
The following diagram shows our stochastic construct:<br />
<br />
[[Image:Team NewcastleStochastic switch.png| center|550px]]<br />
<br />
[[Image:Team newc Stoch key.png| center 100px]]<br />
<br />
===Prevention of germination===<br />
The prevention of germination is governed by another invertase switch. Once the stochastic promoter faces right, a fimE protein is expressed which inverts a further promoter region. This promoter controls expression of the ''CwlD'' <br />
and ''SleB'' genes knocked out within our chassis. If their promoter is in the correct orientation then the cell will be able to germinate and continue as a vegetative cell. However if their promoter has been flipped, the cell can not germinate following sporulation, and will be trapped as a metal containing spore. <br />
<br />
===Upregulation of sporulation rate===<br />
The upregulation of sporulation involves increasing ''KinA'' expression. ''KinA'' codes a kinase protein that phosphorylates the ''Spo0A'' protein to its active form. When the promoter region within our stochastic brick faces right, there will be increased KinA expression, and thus a greater sporulation rate.<br />
<br />
===Metal sponge and cadmium influx/efflux=== <br />
Expression of the metallothionein fusion protein (''CotC-GFP-SmtA''), cadmium import channel (''mntH'') and the canmium efflux channel (CadA) is also governed by the direction of the stochastic promoter. <br />
<br />
===Stochastic Brick===<br />
We have decided to get our stochastic construct synthesised, as trying to build the construct manually would be too time costly. The following sequencher diagram shows the components of the construct we had synthesised.<br />
[[Image:Team newc Sequencher synth stoch.png| center|700px]]<br />
<br />
===Testing construct===<br />
In order to test our construct we have had to redesign using inducible promoters governing Hin invertase expression. We have used promoters pSpac and XylA (Induced by IPTG and Xylose) to test our system, however we have designed cut sites around these promoters in order to replace them with SigmaA promoters once the construct has been characterised.(See sequencher diagram above)<br />
<br />
===Degradation controller===<br />
In order to have another level of control over the orientation of the promoter within the flipping region we have added a degradation tag to the hin invertase protein. The following paper describes how proteins including modified ssrA tags can be located to the ClpXP protease by an sspb protein. This means that inducible sspb expression can requlate degradation levels of the tagged protein. <br />
<br />
[http://www3.interscience.wiley.com/journal/121415079/abstract?CRETRY=1&SRETRY=0 Inducible protein degradation in Bacillus subtilis using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP ]<br />
<br />
We have decided to put the sspb protein under the control of an arabinose inducible promoter as the following diagram illustrates, also we have included a region of the sac gene in our construct, so that the region will integrate into the ''Bacillus'' genome at a region other than amyE. <br />
<br />
[[Image:Team NewcIntegration Deg control.png |center|500px]]<br />
<br />
<br />
We added a modified version of ''ssrA'' degradation tag onto the C-terminus of Hin protein. Hence expressed proteins are degraded by ClpXP. However mutations on the ''ssrA'' tag weakens the recognition by ClpX and the modified tags require sspB adaptor protein to be recognized. Hence when sspB protein is expressed, the proteins tagged with modified version of ''ssrA'' tag are targeted for degradation, otherwise they remain stable.<br />
<br />
In ''B. subtilis'' there is no sspB orthologue and SspB from ''E. coli'' works in ''B. subtilis''. By regulating the levels of sspB by arabinose, we designed an inducable protein degradation device. <br />
<br />
[[Image:Team_Newcastle_iGEM_2009_Degradation_Model_4.png|400px]]<br />
<br />
<br />
Wild type ''E. coli'' ''ssrA'' tag is '''AANDENY-ALAA''' (SspB recognition site – ClpX recognition site). As suggested in the paper, we took one of the modified ''ssrA'' tags to use in our system.<br />
<br />
'''AANDENY-SENY-ALGG''' (SspB recognition site – SENY +4 Linker - ClpX recognition site)<br />
<br />
This tag works well in ''B. subtilis'' however degradation tags can affect activity of proteins. Different degradation tags may have effect on the activity of different proteins. It has been shown that this tag effected the activity of ComA(1).<br />
<br />
#Griffith, K. L., and A. D. Grossman. 2008. Inducible protein degradation in Bacillus subtilis using heterologous peptide tags and adaptor proteins to target substrates to the protease ClpXP. Mol. Microbiol. 70:1012-1025. <br />
<br />
<br />
<br />
We have the following cloning strategies for testing our construct.<br />
<br />
==Lab Work Strategies==<br />
====Cloning strategies====<br />
Currently in the lab we are half way to acheiving a complete manual brick which is the degradation controller. In the lab so far, the stochastic switch team have:<br />
*Rehydrated, transformed, and miniprepped the biiobricks involved in promoter replacement, as well as frozen down these ''E.coli'' strains into the TPA collection.<br />
*Prepared the pSB1AT3 plasmid backbone (restriction digest, gel extraction) ready for ligation.<br />
*Have successful PCR products for the sac region (''bacillus'') and sspb (''E.coli''), and a possible success for the ara region. <br />
* Have done digests for sspb and sac, sspb has been extracted from the gel and is due for cloning. <br />
<br />
==Modelling==<br />
<br />
===Stochastic Modelling Tools===<br />
<br />
'''Matlab''' can be used for stochastic modelling. Glasgow team used Matlab implementing Gillespie algorithm to incorporate noise among cells. They also used deterministic modelling using ODEs and compared their results. When the number of cells increase two approaches become similar since the noise is cancelled out. <br />
<br />
'''Stocks 2''' is another stochastic simulation tool which also uses Gillespie’s direct method and supports SBML.<br />
CellML model for the expression of Hin system<br />
<br />
[[Media:flipping.txt]]<br />
<br />
We have used computational modelling in Matlab to try to determine how to make our system tuneable. <br />
<br />
Please see our [[Team:Newcastle/Modelling|modelling]] page for Matlab files on our stochastic switch model. <br />
<br />
===Metal Container Decision===<br />
Our stochastic switch decides whether the spores can germinate, or whether they are commited to be a metal containing spore that cannot germinate again. We need this switch as we cannot interrupt the natural life cycle of the bacteria, as a proportion have to go on to seed the next generation.<br />
<br />
We looked at the following possibilities:<br />
<br />
===Hin/Hix system===<br />
In 2006, Davidson team tried to solve the burnt pancake problem by using DNA rearrangement using Hin/Hix system from ''Salmonella typhimurium''. (http://parts2.mit.edu/wiki/index.php/Davidson_2006.) Basically they tried to use the bacteria as a biomemory! They also have a paper published which is attached.<br />
<br />
Their animation explains the process quite well.<br />
(http://www.bio.davidson.edu/people/kahaynes/FAMU_talk/Living_computer.swf)<br />
<br />
The parts they submitted to the parts registry have "W" flag which means they are working.<br />
http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2006&group=iGEM2006_Davidson<br />
<br />
The Hin system will be the main DNA rearrangement system within our stochastic switch, <br />
Unlike the ''fim'' system the ''hin'' system allows the DNA segment to be flipped back and forth, therefore a pulse of hin expression is what we would need to ensure we can get the correct proportion to be metal containers. <br />
<br />
The switch as an overall diagram<br />
[[Media:MetalContainerDecisionSwitch.ppt]]<br />
<br />
Animation of how the switch works<br />
<br />
[[Media:switch animation.ppt]]<br />
<br />
==Other Presentations and Diagrams==<br />
<br />
===fimE switch===<br />
The FimE switch is a similar switch to the Hix system, however it acts as a latch, meaning once flipped, the segmant will not flip back.<br />
# [http://genomics.lbl.gov/Stuff/TimHam-BandB-online%20version.pdf fimE switch for DNA re-arrangement]<br />
A Tightly Regulated Inducible Expression System Utilising the fim Inversion Recombination Switch.(''E. Coli'') Timothy S. Ham, Sung Kuk Lee, Jay D. Keasling,Adam P. Arkin,Received 21 December 2005; accepted 2 March 2006 Published online 13 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20916<br />
<br />
We could use it switch off or on the production of a protein of our choice, such as the genes involved in germination.<br />
<br />
# [http://jb.asm.org/cgi/reprint/183/14/4190?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=subtilis&searchid=1&FIRSTINDEX=880&resourcetype=HWFIG Control of the Arabinose Regulon in Bacillus subtilis by AraR In Vivo: Crucial Roles of Operators, Cooperativity, and DNA Looping]<br />
# [http://ukpmc.ac.uk/articlerender.cgi?artid=310841 Binding of the ''Bacillus subtilis'' spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene] =>...DNA rearrangement that depends on the spoIVCA gene product...<br />
<br />
===Bistability in ''Bacillus subtilis''===<br />
<br />
Read this page to find more options for natural stochastic switches in ''Bacillus subtilis''.<br />
[[Team:Newcastle/ Bistability in B.Subtilis|Natural stochastic switches:Bistability in ''Bacillus subtilis'']]<br />
<br />
And to find out how we are tuning sporulation using our stochastic switch choice see the sporulation tuning page.<br />
<br />
<br />
{{:Team:Newcastle/Footer}}<br />
{{:Team:Newcastle/Right}}</div>Naw3