Team:Alberta/Project/Promoters & Terminators

From 2009.igem.org

(Difference between revisions)
Line 110: Line 110:
<p>Alterations were made to the Anderson collection promoters to allow for use with the BioBytes assembly system.  Two restriction sites were removed, and two nucleotides were added to slightly alter the start site of transcription.  Both the promoters and terminators had a PstI and XbaI site added allowing for insertion into pAB or pBA.  Please see the attached document <a href="https://2009.igem.org/Image:UofA_Promoter_Terminator.zip"> here </a> for sequence information regarding the modified promoters and terminators.
<p>Alterations were made to the Anderson collection promoters to allow for use with the BioBytes assembly system.  Two restriction sites were removed, and two nucleotides were added to slightly alter the start site of transcription.  Both the promoters and terminators had a PstI and XbaI site added allowing for insertion into pAB or pBA.  Please see the attached document <a href="https://2009.igem.org/Image:UofA_Promoter_Terminator.zip"> here </a> for sequence information regarding the modified promoters and terminators.
 +
 +
</font></div>
 +
 +
      </div></div>
 +
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b>
 +
    </td>
 +
  </tr>
 +
</table>
</table>
</div>
</div>
</HTML>
</HTML>

Revision as of 00:12, 19 October 2009

University of Alberta - BioBytes










































































































Promoter and Terminator Design

Our project tests the limits to which biology can be standardized. Towards this goal, the endogenous promoter of every essential gene will be replaced with one of seven standard promoters producing different expression levels. The terminator of every essential gene will also be replaced with a standard biobrick terminator. The promoters and terminators are biobrick parts and are currently being functionally tested. To determine which promoter to pair with which gene, microarray expression data from the literature was used.

Advantages of standardized promoters include:
  • streamlined amplification of genes from genomic DNA, as amplicons can all start precisely at the start codon. No data about where the endogenous promoter begins is required.
  • < potential for easy manipulation of gene expression levels: the same gene part can easily be assembled with different promoters to test the effect of different expression levels.
  • we need not be concerned about including all the transcription factors need to express the essential genes.
  • as the location and properties of many promoters are unknown, using all standardized promoters results in a much better characterized system that is more amenable to manipulation.

Promoters

The standardized promoters were based from a series of promoters produced by the 2006 Berkeley iGEM team. These are a series of promoters which have been mutated from the consensus sigma 70 promoter allowing for varying levels of promoter activity to be produced. The promoters can be found here . The following promoters were selected:

  • J23119 - Sigma 70 Consensus Sequence
  • J23102 - Sigma 70 75% Strength Promoter
  • J23118 - Sigma 70 50% Strength Promoter
  • J23105 - Sigma 70 25% Strength Promoter
  • J23114 - Sigma 70 10% Strength Promoter
  • J23113 - Sigma 70 1% Strength Promoter
These promoters were tested by the Anderson group by construction of J61002. This plasmid consists of the promoter of interest, the RFP gene, and a double terminator. By measuring the amount of fluorescence produced by each promoter, it is possible to determine the promoter's strength. Unfortunately, the strength of the consensus promoter was not measured. Therefore it was assigned a fluorescence of 2900 based on the rate of decrease in fluorescence per base pair mutation. In order to confirm the strength of each promoter, we are presently in the process of testing our new BioByte promoters (see below for more details on other alterations made to each promoter) using the same experimental procedure as the Anderson Group.

Terminator

The part which was used as the universal terminator in our standardized parts list was Bba b1006. This is a bidirectional terminator with 6 nucleotide loop and 8 bp stem which has been shown to terminate transcription 99% of the time (Please see here for terminator characterization information). The sequence of the terminator is:

AAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTT

Modifications To Promoters and Terminators

Alterations were made to the Anderson collection promoters to allow for use with the BioBytes assembly system. Two restriction sites were removed, and two nucleotides were added to slightly alter the start site of transcription. Both the promoters and terminators had a PstI and XbaI site added allowing for insertion into pAB or pBA. Please see the attached document here for sequence information regarding the modified promoters and terminators.