Team:NYMU-Taipei/Project/Lab Note

From 2009.igem.org

(Difference between revisions)
(→References)
Line 1: Line 1:
-
[[image:NYMU Wt--rev.png]]
+
== Experiment of oscillator biobrick parts ==
-
{{:Team:NYMU-Taipei/Header}}
+
-
== Motivation ==
+
{| border="1"
 +
|  1  ||  BBa_C0051 '''cI repressor from E. coli phage lambda (+LVA)'''
 +
|-
 +
|  2  ||  BBa_K116602 '''CII coding region from λ phage'''
 +
|-
 +
|  3  ||  BBa_C0040 '''tetracycline repressor from transposon Tn10 (+LVA)'''
 +
|-
 +
|  4  ||  BBa_C0074
 +
|-
 +
|  5  ||  BBa_C0072
 +
|-
 +
|  6  ||  BBa_C0073
 +
|-
 +
|  7  ||  BBa_E0040
 +
|-
 +
|  t  ||  BBa_B0015
 +
|-
 +
|  A  ||  BBa_R0040
 +
|-
 +
|  P  ||  BBa_R0074
 +
|-
 +
|  L  ||  BBa_R0010
 +
|-
 +
|  M  ||  BBa_R0073
 +
|-
 +
|  C  ||  BBa_R0051
 +
|-
 +
|  pCI  ||  BBa_R1051
 +
|-
 +
|  p22  ||  BBa_R0053
 +
|-
 +
|  pLuxR  ||  BBa_R0062
 +
|-
 +
|  pLasR  ||  BBa_R0079
 +
|-
 +
|  E  ||  BBa_K116603
-
Our engineered ''E. coli'' (ViroCatcher) is designed to trap the viruses and successfully prevents viruses spreading out in our bodies. If we remove ViroCatcher, viruses will be cleaned up together as well with our ViroCatcher. To remove viruses, we must work out a method for E. coli removal.
+
|}
-
For removing ViroCatcher, we have two choices. One is to let it suicide, and the other is to let it be removed by our immune cells (like how dead cells are removed). Before removal, we must be sure that the intended work is done, and viruses must be removed at the same time. Therefore, we designed a removal gene and included it in ViroCatcher. If ViroCatcher gets the sinal of binding with viral proteins, it will turn on the removal gene and be removed.
 
-
Furthermore, if ViroCatcher did not catch anything, we still have to design a mechanism to let our ViroCatcher express the removal gene and remove itself. Otherwise, bacteria will fill our blood vessel and block our blood flow.
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 24 oscillator part.png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 90V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: BBa_R0051 pCI|287bp (49+238)|238bp|m|=
 +
|2: BBa_C0051 CI lam|988bp (750+238)|238bp|w|=
 +
|3: BBa_C0040 TetR|838bp (660+238)|238bp|w|=
 +
|4: BBa_B0034 RBS|250bp (12+238)|238bp|w|=
 +
|5: BBa_j13002 pTetR|302bp (74+238)|238bp|f|=
 +
|6: BBa_B0015 Term|445bp (129+316)|316bp|w|=
 +
|7: BBa_K116602 CII|532bp (294+238)|238bp|w|=
 +
|8: BBa_K116603 pRE|286bp (48+238)|238bp|w|=
 +
|9: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
 +
|10: Negative Control|0bp||w|=
 +
|11: marker 100bp|||n}} }}
-
== Selecting the Removal Gene ==
+
== Experiment of oscillator biobrick parts (2)==
-
We had considered the following three removal genes. In the end, we chose to use the expression of LPS.
+
-
=== Cell Suicide Generator ===
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 27 oscillator part(2).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
<br>[[image:NYMU 1.jpg]]
+
2% agarose, 90V, 30min
-
*The CcdB protein, constitutively expressed by P1010, is lethal to most of the BioBrick cell strains, only DB3.1 is resistant[5]. A hybrid promoter controls the production of LuxR and ccdB. The promoter is activated by HSL-LuxR complex and repressed by P22 c2. The LuxR coding region is preceded by a strong RBS and followed by a bad terminator (60% efficiency). This means there is read through into the ccdB coding region which can be translated from a very weak RBS. If the P22 c2 repressor is absent, there should be a strong enough LuxR background to allow autoactivation if HSL is added. The amound of ccdB should be sublethal as long as there is no significant activation[6].
+
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: BBa_R0040 pTetR|292bp (54+238)|238bp|w|=
 +
|2: BBa_E0840|1116bp (878+238)|238bp|w|=
 +
|3: CII<Term(from jesse)|669bp (294+8+129+238)|532bp (294+238)|f|=
 +
|4: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
 +
|5: Negative Control||Contamination ~300bp|f|=
 +
|6: -|-|-|n|=
 +
|7-8: BBa_B0015 Term (gel extraction)|155bp (129+26)||w|=
 +
|9: marker 100bp|||n}} }}
-
The most simple way to get rid of the ''E. coli'' is to let it suicide, however, there are many viruses that have been caught on the surface that we have to pay attention to. If ViroCatcher dies or explodes, the trapped viruses will spread into our bloodstream again. Cell Suicide Generator seems not to be a good choice.
+
== Experiment of oscillator biobrick parts (3)==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 29 oscillator part(3).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 90V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: CII<Term|669bp (294+8+129+238)|532bp (294+238)|w|=
 +
|2: CI lam<Term|1125bp (750+8+129+238)|988bp (750+238)|w|=
 +
|3: TetR<Term|1035bp (660+8+129+238)|898bp (660+238)|f|=
 +
|4: BBa_R0051 pCI|287bp (49+238)|238bp|m|=
 +
|5: BBa_j13002 pTetR+RBS|312bp (74+238)|238bp|w|=
 +
|6: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
 +
|7: Negative Control|0bp|Contamination ~300&700bp,|f|=
 +
|8: -|-|-|n|=
 +
|9-10: BBa_E0840 (Gel extraction)|878bp||w|=
 +
|11: marker 100bp|||n}} }}
 +
4: Inconclusive.
-
{{:Team:NYMU-Taipei/Part4|Cell suicide generator|=
+
== Experiment of oscillator biobrick parts (4)==
-
|R|R0034||=
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 31 oscillator part(4).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
|C|K145151|ccdB|=
+
2% agarose, 90V, 30min
-
|T|B0010||=
+
{{:Team:NYMU-Taipei/GELC|=
-
|T|B0012||}}
+
|0: marker 1kb+100bp|||n|=
 +
|1: BBa_R0074 pPenI|315bp (77+238)|238bp|w|=
 +
|2-6: BBa_C0074 PenI|739bp (423+316)|316bp|w|=
 +
|7-11: BBa_R0073 pMnt|383bp (67+316)|316bp|m|=
 +
|12-16: BBa_C0072 Mnt (Strong)|604bp (288+316)|316bp|w|=
 +
|17-21: BBa_C0073 Mnt (Weak)|604bp (288+316)|316bp|w|=
 +
|22: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
 +
|23: Negative Control|0bp|Contamination|f|=
 +
|24: marker 100bp|||n}}
 +
The result for lanes 7-11 look weird, but it could be because of the gel. A rerun will be done.}}
-
=== Macrophage Inflammatory Proteins ===
+
== Experiment of oscillator biobrick parts (5)==
-
<br>[[image:NYMU 2.jpg]]
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 07 31 oscillator part(5).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
* Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines. In humans, there are two major forms, MIP-1α and MIP-1β that are now officially named CCL3 and CCL4 respectively. Both are major factors produced by macrophages after they are stimulated with bacterial endotoxins[1]. They activate human granulocytes (neutrophils, eosinophils and basophils) which can lead to acute neutrophilic inflammation. They also induce the synthesis and release other pro-inflammatory cytokines such as interleukin 1 (IL-1), IL-6 and TNF-α from fibroblasts and macrophages. The genes for CCL3 and CCL4 are both located on human chromosome 17[2].
+
2% agarose, 90V, 30min
-
** Chemokine (C-C motif) ligand 3, also known as CCL3, is a human gene. Macrophage inflammatory protein-1 is a so-called monokine that is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes (Wolpe et al., 1988). Sherry et al. (1988) demonstrated 2 protein components of MIP1, called by them alpha and beta[supplied by OMIM][1].
+
{{:Team:NYMU-Taipei/GELC|=
-
** CCL4 is a CC chemokine with specificity for CCR5 receptors. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cell [2]. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells [3]. Perforin-low memory CD8+ T cells that normally synthesize MIP-1-beta [4].<br>[[image:Chemokine_concentration_chemotaxis.jpg]]<br>
+
|0: marker 1kb+100bp|||n|=
-
** The main function of chemokines is the induction of cell migration. Cells will move toward the direction of increment of continuous chemokine concentration gradient. In other words, cells migrate toward the source of chemokine. For example, the induction of lymphocyte to the lymphatic node is due to chemokines. Apply this thinking to our design, we want to use CCL3 and CCL4, or chemokines for macrophages, to assemble macrophages around ViroCatcher. It will raise the possibility that macrophages recognize the proteins of viruses and swallow the ''E. coli'' whole.<br> But there's a problem. CCL3 and CCL4 is two kinds of ligands of receptors of antibody. If we use this design, ViroCatchers will bind with each other, aggregate together, and block our blood vessels. So unfortunately, this design still cannot be used as the removal circuit.
+
|1-2: TetR<Term (Gel extraction)|821bp (660+8+129+24)|684bp (660+24)|f|=
 +
|4-5: CII<Term (Gel extraction)|455bp (294+8+129+24)|318bp (294+24)|w|=
 +
|7-9: CI<Term (Gel extraction)|911bp (750+8+129+24)|774bp (750+24)|w|=
 +
|10: marker 100bp|||n}} }}
-
=== Expression of LPS ===
+
== Experiment of oscillator biobrick parts (6)==
-
<br>[[image:NYMU 3.jpg]]
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 03 oscillator part(6).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
* In the [[Team:NYMU-Taipei/Project/Chassis|Chassis]] part of our project, we have mentioned that ViroCatcher is a LPS[7] knock-out stain, in order to avoid the detection by the immune system. Therefore, if we re-express LPS, our ViroCatcher will have the ability to attract immune cells and let immune system macrophage remove ViroCatcher itself along with the viruses bound to the surface[8][9]. To express LPS again in ViroCatcher, we just have to turn on ''msbB'' gene.
+
2% agarose, 90V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: BBa_R0074 pPenI|315bp (77+238)|238bp|w|=
 +
|2: BBa_C0074 PenI|739bp (423+316)|316bp|w|=
 +
|3: BBa_R0073 pMnt|383bp (67+316)|316bp|w|=
 +
|4: BBa_C0072 Mnt (Strong)|604bp (288+316)|316bp|w|=
 +
|5: BBa_C0073 Mnt (Weak)|604bp (288+316)|316bp|w|=
 +
|6: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
 +
|7: Negative Control|0bp|Contamination|f|=
 +
|8: marker 100bp|||n}} }}
 +
== Experiment of oscillator biobrick parts (7)==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 03 oscillator part(7).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 90V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: RBS + CII + Term|687bp |250bp|f|=
 +
|2: RBS + CI lam + Term|1143bp |250bp|f|=
 +
|3: RBS + TetR + Term|1053bp |250bp|f|=
 +
|4: pCI(plate from 090729)|287bp |238bp|m|=
 +
|5: E0840|604bp (288+316)|316bp|w|=
 +
|6: pCI(plasmid from 090730)|287bp |238bp|f|=
 +
|7: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
 +
|8: Negative Control|0bp|Contamination~300bp|f|=
 +
|9: marker 1kb+100bp|||n}} }}
-
==== Homo sapiens chemokine (C-C motif) ligand 3, mRNA (cDNA clone MGC:198546 IMAGE:9054485), complete cds[http://www.ncbi.nlm.nih.gov/nuccore/219521699] ====
+
== Experiment of oscillator biobrick parts (8)==
-
   
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 04 oscillator part(8).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
        1 acactcgagc ccacattccg tcacctgctc agaatcatgc aggtctccac tgctgccctt
+
2% agarose, 90V, 30min
-
      61 gctgtcctcc tctgcaccat ggctctctgc aaccagttct ctgcatcact tgctgctgac
+
{{:Team:NYMU-Taipei/GELC|=
-
      121 acgccgaccg cctgctgctt cagctacacc tcccggcaga ttccacagaa tttcatagct
+
|0: marker 1kb+100bp|||n|=
-
      181 gactactttg agacgagcag ccagtgctcc aagcctggtg tcatcttcct aaccaagcga
+
|1: BBa_I13504 r7t|1113bp |250bp|w|=
-
      241 agccggcagg tctgtgctga ccccagtgag gagtgggtcc agaaatatgt cagcgacctg
+
|2: BBa_I13522 Ar7t|1176bp |292bp|w|=
-
      301 gagctgagtg cctgaggggt ccagaagctt cgaggcccag cgacctcggt gggcccagtg
+
|3: BBa_I13401 7t|1095bp |958bp|w|=
-
      361 gggaggagca ggagcctgag ccttgggaac atgcgtgtga cctccacagc tacctcttct
+
|4: BBa_R0051 pCI|287bp |238bp|m|=
-
      421 atggactggt tgttgccaaa cagccacact gtgggactct tcttaactta aattttaatt
+
|5: pTetR<E0240|1176bp |292bp|w|=
-
      481 tatttatact atttagtttt tgtaatttat tttcgatttc acagtgtgtt tgtgattgtt
+
|6: PenI<Term|876bp |739bp|f|=
-
      541 tgctctgaga gttccccctg tcccctc
+
|7: Mnt (Strong)<Term|741bp |604bp|m|=
 +
|8: Mnt (Weak)<Term|741bp |604bp|f|=
 +
|9: Positive Control BBa_E0240|1114bp (876+238)|238bp|w|=
 +
|10: Negative Control|0bp|Contamination~300bp|f|=
 +
|11: marker 100bp|||n}} }}
 +
== Experiment of oscillator biobrick parts (9) Gel Extraction ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 04 oscillator part(9).png||c=
 +
2% agarose, 90V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: B0034+CII+Term r2t|475bp |38bp|f|=
 +
|2: B0034+CII+Term r2t|475bp |38bp|f|=
 +
|3: B0034+CII+Term r2t|475bp |38bp|f|=
 +
|4: B0034+CI lam+Term r1t|931bp |38bp|f|=
 +
|5: B0034+CI lam+Term r1t|931bp |38bp|f|=
 +
|6: B0034+CI lam+Term r1t|931bp |38bp|f|=
 +
|7: B0034+Tet R+Term r3t|841bp |38bp|f|=
 +
|8: B0034+Tet R+Term r3t|841bp |38bp|f|=
 +
|9: B0034+Tet R+Term r3t|841bp |38bp|f|=
 +
|10: marker 100bp|||n}} }}
-
==== Homo sapiens chemokine (C-C motif) ligand 4, mRNA (cDNA clone MGC:126026 IMAGE:40032172), complete cds [http://www.ncbi.nlm.nih.gov/nuccore/74355495]====
+
== Experiment of oscillator biobrick parts (10) (Gel Extraction)==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 05 oscillator part(10).png||c=
 +
2% agarose, 90V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: BBa_I13504 r7t|901bp |0bp|w|=
 +
|2: BBa_I13401 7t|881bp |0bp|w|=
 +
|3: PenI+Term|584bp|447bp|f|=
 +
|4: Mnt (Strong)+Term 5t|449bp |312bp|f|=
 +
|5: Mnt (Weak)+Term 6t|449bp |312bp|f|=
 +
|6: TetR+Term 3t|821bp |684bp|f|=
 +
|7: marker 1kb+100bp|||n}} }}
-
        1 cacagctggg ttctgaagct tctgagttct gcagcctcac ctctgagaaa acctcttttc
+
== Experiment of oscillator biobrick parts (11)==
-
      61 caccaatacc atgaagctct gcgtgactgt cctgtctctc ctcatgctag tagctgcctt
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 06 oscillator part(11).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
      121 ctgctctcca gcgctctcag caccaatggg ctcagaccct cccaccgcct gctgcttttc
+
2% agarose, 90V, 30min
-
      181 ttacaccgcg aggaagcttc ctcgcaactt tgtggtagat tactatgaga ccagcagcct
+
{{:Team:NYMU-Taipei/GELC|=
-
      241 ctgctcccag ccagctgtgg tattccaaac caaaagaagc aagcaagtct gtgctgatcc
+
|0: marker 1kb+100bp|||n|=
-
      301 cagtgagacc tgggtccagg agtacgtgta tgacctggaa ctgaactgag ctgctcagag
+
|1: marker 1kb|||n|=
-
      361 acaggaagtc ttcagggaag gtcacctgag cccggatgct tctccatgag acacatctcc
+
|2: C|287bp |238bp|w|=
-
      421 tccatactca ggactcctct ccgcagttcc tgtcccttct cttaatttaa tcttttttat
+
|3: M|383bp |316bp|w|=
-
      481 gtgccgtgtt attgtattag
+
|4: 3t|1035bp |898bp|f|=
 +
|5: 4t|876bp |739bp|f|=
 +
|6: 5t|741bp |604bp|m|=
 +
|7: 6t|741bp |604bp|f|=
 +
|8: Positive Control E0240|1114bp |238bp|w|=
 +
|9: Negative Control |0bp |Contamination~300|f|=
 +
|10:  |bp |bp|n|=
 +
|11:  |bp |bp|n|=
 +
|12: r<1t|1143bp |250bp|f|=
 +
|13: r<2t|687bp |250bp|f|=
 +
|14: r<7t|1113bp |250bp|f|=
 +
|15: 3<t|1035bp |898bp|f|=
 +
|16: 5<t|741bp |604bp|f|=
 +
|17: Positive Control E0240|1114bp |238bp|w|=
 +
|18: Negative Control |0bp |Contamination~|f|=
 +
|19: marker 1kb|||n|=
 +
|20: marker 100bp|||n}} }}
-
==== Escherichia coli K-12 substr. MG1655 msbB gene sequence[http://biocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10614] ====
 
 +
== Experiment of oscillator biobrick parts (12)==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 11 oscillator part(12).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 90V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Lr7t|1321bp |438bp|f|=
 +
|2: Lr7t|1321bp |438bp|w|=
 +
|3: Positive Control E0240|1114bp |238bp|w|=
 +
|4: r1t|1143bp |250bp|w|=
 +
|5: r1t|1143bp |250bp|w|=
 +
|6: r1t|1143bp |250bp|w|=
 +
|7: r1t|1143bp |250bp|f|=
 +
|8: r1t|1143bp |250bp|w|=
 +
|9: r1t|1143bp |250bp|f|=
 +
|10: r1t|1143bp |250bp|w|=
 +
|11: r1t|1143bp |250bp|w|=
 +
|12: r2t|687bp |250bp|w|=
 +
|13: r2t|687bp |250bp|f|=
 +
|14: r2t|687bp |250bp|w|=
 +
|15: r2t|687bp |250bp|w|=
 +
|16: r2t|687bp |250bp|w|=
 +
|17: r2t|687bp |250bp|w|=
 +
|18: r2t|687bp |250bp|w|=
 +
|19: r2t|687bp |250bp|w|=
 +
|20: r2t|687bp |250bp|w|=
 +
|21: r2t|687bp |250bp|w|=
 +
|22: r2t|687bp |250bp|w|=
 +
|23: Negative Control |0bp ||w|=
 +
|24: marker 1kb+100bp|||n}} }}
-
        1 atgGAAACGA AAAAAAATAA TAGCGAATAC ATTCCTGAGT TTGATAAATC CTTTCGCCAC
+
== Experiment of oscillator biobrick parts (13) 2009/08/13==
-
      61 CCGCGCTACT GGGGAGCATG GCTGGGCGTA GCAGCGATGG CGGGTATCGC TTTAACGCCG
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 13 oscillator part(13).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
      121 CCAAAGTTCC GTGATCCCAT TCTGGCACGG CTGGGACGTT TTGCCGGACG ACTGGGAAAA
+
2% agarose, 90V, 38min
-
      181 AGCTCACGCC GTCGTGCGTT AATCAATCTG TCGCTCTGCT TTCCAGAACG TAGTGAAGCT
+
{{:Team:NYMU-Taipei/GELC|=
-
      241 GAACGCGAAG CGATTGTTGA TGAGATGTTT GCCACCGCGC CGCAAGCGAT GGCAATGATG
+
|0: marker 1kb+100bp|||n|=
-
      301 GCTGAGTTGG CAATACGCGG GCCGGAGAAA ATTCAGCCGC GCGTTGACTG GCAAGGGCTG
+
|1: 3t|1035bp |898bp|m|=
-
      361 GAGATCATCG AAGAGATGCG GCGTAATAAC GAGAAAGTTA TCTTTCTGGT GCCGCACGGT
+
|2: 3t|1035bp |898bp|m|=
-
      421 TGGGCCGTCG ATATTCCTGC CATGCTGATG GCCTCGCAAG GGCAGAAAAT GGCAGCGATG
+
|3: 3t|1035bp |898bp|f|=
-
      481 TTCCATAATC AGGGCAACCC GGTTTTTGAT TATGTCTGGA ACACGGTGCG TCGTCGCTTT
+
|4: 3t|1035bp |898bp|f|=
-
      541 GGCGGTCGTC TGCATGCGAG AAATGACGGT ATTAAACCAT TCATCCAGTC GGTACGTCAG
+
|5: 3t|1035bp |898bp|m|=
-
      601 GGGTACTGGG GATATTATTT ACCCGATCAG GATCATGGCC CAGAGCACAG CGAATTTGTG
+
|6: 4t|876bp |739bp|w|=
-
      661 GATTTCTTTG CCACCTATAA AGCGACGTTG CCCGCGATTG GTCGTTTGAT GAAAGTGTGC
+
|7: 4t|876bp |739bp|w|=
-
      721 CGTGCGCGCG TTGTACCGCT GTTTCCGATT TATGATGGCA AGACGCATCG TCTGACGATT
+
|8: 4t|876bp |739bp|f|=
-
      781 CAGGTGCGCC CACCGATGGA TGATCTGTTA GAGGCGGATG ATCATACGAT TGCGCGGCGG
+
|9: 4t|876bp |739bp|f|=
-
      841 ATGAATGAAG AAGTCGAGAT TTTTGTTGGT CCGCGACCAG AACAATACAC CTGGATACTA
+
|10: 4t|876bp |739bp|w|=
-
      901 AAATTGCTGA AAACTCGCAA ACCGGGCGAA ATCCAGCCGT ATAAGCGCAA AGATCTTTAT
+
|11: 5t|741bp |604bp|f|=
-
      961 CCCATCAAAT AA
+
|12: 5t|741bp |604bp|f|=
 +
|13: 5t|741bp |604bp|f|=
 +
|14: 5t|741bp |604bp|f|=
 +
|15: 5t|741bp |604bp|f|=
 +
|16: 6t|741bp |604bp|m|=
 +
|17: 6t|741bp |604bp|m|=
 +
|18: 6t|741bp |604bp|m|=
 +
|19: 6t|741bp |604bp|m|=
 +
|20: 6t|741bp |604bp|m|=
 +
|21: 1t|1125bp |988bp|w|=
 +
|22: Positive Control E0240|1114bp |238bp|w|=
 +
|23: Negative Control |0bp ||w|=
 +
|24: marker 1kb+100bp|||n}} }}
-
*Primer Design
+
== Experiment of oscillator biobrick parts (14) (Gel Extraction) 2009/08/13==
-
gaattcgcggccgcttctag atgGAAACGAAAAAAAATAATAGCGAA 55deg GC:26% length:27bp
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 13 oscillator part(14).png||c=
-
ctgcagcggccgctactagta TTATTTGATGGGATAAAGATCTTTGC 54deg GC:31% length:26bp
+
2% agarose, 90V, 36min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: r1t|929bp ||w|=
 +
|2: r1t|929bp ||w|=
 +
|3: marker 1kb+100bp|||n|=
 +
|4: r2t|473bp ||w|=
 +
|5: r2t|473bp ||w}} }}
-
== Goals ==
+
== Experiment of oscillator biobrick parts (15) 2009/08/15 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 15 oscillator part(15).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Ar7t|1176bp |292bp|w|=
 +
|2: Ar7t|1176bp |292bp|w|=
 +
|3: Ar7t|1176bp |292bp|w|=
 +
|4: Ar2t|749bp |292bp|f|=
 +
|5: Pr7t|1199bp |315bp|f|=
 +
|6: Lr7t|1322bp |438bp|w|=
 +
|7: Lr7t|1322bp |438bp|w|=
 +
|8: Lr7t|1322bp |438bp|w|=
 +
|9: Lr7t|1322bp |438bp|w|=
 +
|10: Cr7t|1171bp |287bp|f|=
 +
|11: Cr7t|1171bp |287bp|f|=
 +
|12: Cr7t|1171bp |287bp|f|=
 +
|13: Cr7t|1171bp |287bp|f|=
 +
|14: Er7t|1170bp |286bp|f|=
 +
|15: Er7t|1170bp |286bp|w|=
 +
|16: Er7t|1170bp |286bp|f|=
 +
|17: Er7t|1170bp |286bp|w|=
 +
|18: Er7t|1170bp |286bp|w|=
 +
|19: Positive Control E0240|1114bp |238bp|w|=
 +
|23: Negative Control |0bp ||w|=
 +
|24: marker 1kb+100bp|||n}} }}
-
There are two specific aims for the removal part. One is ViroCatcher binding to viruses and being removed, and the other is self-removal after a specified period of time. Since the gene msbB of LPS is knocked out, if there is an insertion of msbB gene into the plasmid, then msbB gene and the LPS functions will express. Once the LPS is expressed, the immune system is turned on and ViroCatcher is swallowed by macrophage through phagocytosis along with many viruses attached.
+
== Experiment of oscillator biobrick parts (16) (Gel Extraction) 2009/08/15==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 15 oscillator part(16).png||c=
 +
2% agarose, 100V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: 3t|821bp |684bp |w|=
 +
|2: 3t|821bp |684bp |w|=
 +
|3: 3t|821bp |684bp |w|=
 +
|4: 4t|584bp |447bp |f|=
 +
|5: 4t|584bp |447bp |f|=
 +
|6: 4t|584bp |447bp |f|=
 +
|7: marker 1kb+100bp|||n}} }}
-
If the machine catches nothing, it is still necessary to remove the ''E. coli'' machine after a period of time. This period of time should be controlled precisely, otherwise the machine will be removed before it catches any viruses. We compose an oscillator and a toggle switch together as our timer.
+
== Experiment of oscillator biobrick parts (17) 2009/08/16 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 16 oscillator part(17).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: pH sensor|512bp ||f|=
 +
|2: pH sensor|512bp ||f|=
 +
|3: pH sensor|512bp ||f|=
 +
|4: pH sensor|512bp ||f|=
 +
|5: r3t|1053bp |250bp |f|=
 +
|6: r3t|1053bp |250bp |f|=
 +
|7: r3t|1053bp |250bp |f|=
 +
|8: r3t|1053bp |250bp |w|=
 +
|9: Positive Control E0240|1114bp |238bp|w|=
 +
|10: Negative Control |0bp ||w|=
 +
|11: marker 1kb+100bp|||n}} }}
-
== Removal Design ==
 
-
=== Removal for Binding Viruses ===
+
== Experiment of oscillator biobrick parts (18) (digestion) 2009/08/17==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 17 oscillator part(18).png||c=
 +
2% agarose, 100V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb|||n|=
 +
|1: marker 100bp|||n|=
 +
|2: Cr7t(XN)|311,2701bp|253bp,2701bp|f|=
 +
|3: Er7t(NP)|36,274,2701bp|253bp,2701bp|w|=
 +
|4: pH Sensor Plasmid #1 Amplify 1-2 (XP)|296,2057bp|1180,2057bp|f|=
 +
|5: pH Sensor Plasmid #1 Amplify 3-4 (XP)|296,2057bp|1180,2057bp|f|=
 +
|6: pH Sensor Plasmid #1 Amplify 1-2 (XN)|2353bp|536,2701bp|f|=
 +
|6: pH Sensor Plasmid #1 Amplify 3-4 (XN)|2353bp|536,2701bp|f|=
 +
|7: marker 1kb+100bp|||n}}
 +
Comments
 +
* Colony's of lanes 4-7 came from the same plate. Because this part was left over from last year, we didn't know if this plasmid contained K116001 or K116002. This gel's digestion results say K116002.
-
Mentioned before at [[Team:NYMU-Taipei/Project/Signal Transduction|Signal]], an output promoter called ompC promoter will be inactivate through the way of the signal transduction of binding with viruses. Obviously, if we use a promoter inhibited by the ompC promoter output protein , when ompC inactivated, the gene we want to express will tun on. Therefore, we come out this design:
+
}}
-
[[image:NYMU 5.jpg]](this picture must be changed)
+
== Experiment of oscillator biobrick parts (19) (Gel Extraction) 2009/08/17==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 17 oscillator part(19).png||c=
 +
2% agarose, 100V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 100bp|||n|=
 +
|1: marker 1kb|||n|=
 +
|2: Er7t|958bp |74bp |w|=
 +
|3: Er7t|958bp |74bp |w|=
 +
|4: Er7t|958bp |74bp |w|=
 +
|5: Cr7t|959bp |75bp |f|=
 +
|6: Cr7t|959bp |75bp |f|=
 +
|7: Cr7t|959bp |75bp |f|=
 +
|8: marker 1kb|||n|=
 +
|9: marker 100bp|||n}} }}
-
Use the tetR promoter as a switch for the msbB gene. If the receptor catches a virus, TetR protein absent, tetR promoter will turn on msbB gene, then LPS will be expressed and it will attract the immune system. ViroCatcher will be cleaned up by immune cells together with the trapped viruses.
 
-
=== Timed Removal ===
+
== Experiment of oscillator biobrick parts (20) 2009/08/18 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 18 oscillator part(20).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: AR7t|1175bp |292bp |w|=
 +
|2: AR7t|1175bp |292bp |w|=
 +
|3: PR7t|1198bp |315bp |m|=
 +
|4: PR7t|1198bp |315bp |f|=
 +
|5: CR7t|1170bp |287bp |f|=
 +
|6: CR7t|1170bp |287bp |f|=
 +
|7: pMnt|383bp |316bp |m|=
 +
|8: CI lam|988bp |238bp |m|=
 +
|9: Positive Control E0240|1114bp |238bp|w|=
 +
|10: Negative Control |0bp |contamination~700bp|f|=
 +
|11: marker 1kb+100bp|||n}} }}
-
If the receptor does not catch anything, the ompC promoter will not be turned on, and the removal gene will not be expressed, so ViroCatcher cannot be removed when it catches nothing. How to make sure our Viro Catcher is removed from the human body? We worked out this set of design:  
+
== Experiment of oscillator biobrick parts (21) (Gel Extraction) 2009/08/18==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 18 oscillator part(21).png||c=
 +
2% agarose, 100V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: r3t(XP)|841bp |38bp |w|=
 +
|2: r3t(XP)|841bp |38bp |w|=
 +
|3: r3t(XP)|841bp |38bp |w|=
 +
|4: term(XP)|155bp |445bp |w|=
 +
|5: term(XP)|155bp |445bp |w|=
 +
|6: term(XP)|155bp |445bp |w|=
 +
|7: marker 1kb+100bp|||n}} }}
-
[[image:NYMU 4.jpg]]
+
== Experiment of oscillator biobrick parts (22) 2009/08/19 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 19 oscillator part(22).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|60s|300s|rp=VR|fp=VF2|polName=pfu|pol=0.5|ddH20=39.5}}|c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: nhaA|274bp |0bp |w|=
 +
|2: Positive Control Term|445bp |316bp|w|=
 +
|3: Negative Control |0bp ||w|=
 +
|4: marker 1kb+100bp|||n}}
 +
PCR of nhaA using this protocol worked.
-
This circuit is composed of three parts - oscillator, toggle switch, and remover. Oscillator and toggle switch work together as the timer. The oscillator is consist of two genes. One gene activate the other gene and get a negative feedback. When output proteins of oscillator reach a threshold that preset, then the promoter of toggle switch will be activate, and output protein of toggle switch will suddenly activate the promoter of remover.
+
}}
-
The following picture shows how the timer works by modeling:<br>
+
== Experiment of oscillator biobrick parts (23) 2009/08/19 ==
-
[[image:NYMU threshold.png|350px]]
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 19 oscillator part(23).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: 4<t|876bp |739bp |m|=
 +
|2: 4<t|876bp |739bp |m|=
 +
|3: 4<t|876bp |739bp |m|=
 +
|4: 4<t|876bp |739bp |m|=
 +
|5: 5<t|741bp |604bp |f|=
 +
|6: 5<t|741bp |604bp |f|=
 +
|7: 5<t|741bp |604bp |f|=
 +
|8: 5<t|741bp |604bp |f|=
 +
|9: 6<t|741bp |604bp |m|=
 +
|10: 6<t|741bp |604bp |m|=
 +
|11: 6<t|741bp |604bp |m|=
 +
|12: 6<t|741bp |604bp |m|=
 +
|13: M<R7t|1267bp |383bp |f|=
 +
|14: M<R7t|1267bp |383bp |f|=
 +
|15: M<r7t|1267bp |383bp |f|=
 +
|16: M<r7t|1267bp |383bp |f|=
 +
|17: M|383bp |316bp |w|=
 +
|18: P|315bp |238bp |w|=
 +
|19: 1|988bp |238bp |m|=
 +
|20: 5|604bp |316bp |m|=
 +
|21: 6|604bp |316bp |m|=
 +
|22: Positive Control E0240|1114bp |238bp|w|=
 +
|23: Negative Control |0bp |contamination~300,1100bp|f|=
 +
|24: marker 1kb+100bp|||n}} }}
-
We stop the timer by setting a threshold. As the protein produced by the oscillator promoter accumulates and reaches a certain threshold, the output promoter activity would suddenly change. This output promoter is connected to removal gene ''msbB''. Therefore, at the time that timer stops, LPS expressed and attract macrophages.  
+
== Experiment of oscillator biobrick parts (24) 2009/08/20 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 20 oscillator part(24).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 27min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: nhaA -->(l)|512bp |238bp |w|=
 +
|2: A<r2t|749bp |292bp |f|=
 +
|3: E<r3t|1109bp |286bp |f|=
 +
|4: E<r3t|1109bp |286bp |f|=
 +
|5: E<r3t|1109bp |286bp |f|=
 +
|6: 4t|876bp |739bp |f|=
 +
|7: 5t|741bp |604bp |f|=
 +
|8: 6t|741bp |604bp |f|=
 +
|9: Positive Control E0240|1114bp |238bp|w|=
 +
|10: Negative Control |0bp ||w|=
 +
|11: marker 1kb+100bp|||n}}
 +
Comments:
 +
* Next time, for the failed ligations, revert back to using old enzymes and redo. Maybe it's something to do with not being familiar enough with the new brands.
 +
* Ligating digested PCR product nhaA(XP) onto an empty pSB1A2 plasmid (obtained from extracting it from digesting E0240(XP)) worked.
 +
}}
-
This setting can control the micromachine to trigger an immune response after a period of time. This period of time is controlled precisely, otherwise ViroCatcher will be removed too fast or too late. Anyway, no matter what kind of situation, our ViroCatcher will be removed.
 
-
== Experiment Results ==
+
== Experiment of oscillator biobrick parts (25) 2009/08/21 ==
-
====Protocol of Promoter Strength Testing====
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 21 oscillator part(25).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
#extract the Biobrick promoter
+
2% agarose, 100V, 28min
-
#combine it with GFP generator {{:Team:NYMU-Taipei/BBa|I13504}} with the promoter and then transform
+
{{:Team:NYMU-Taipei/GELC|=
-
#colony PCR
+
|0: marker 1kb+100bp|||n|=
-
#liquid incubation and plasmid extraction
+
|1: E<r3t-->(l)|1109bp |286bp |w|=
-
#measure the amount of fluroresence by using an ELISA reader with a 96 well plate
+
|2: E<r3t|1109bp |286bp |f|=
-
#data collection
+
|3: E<r3t|1109bp |286bp |f|=
-
#using pTet as the standard having the value of 1
+
|4: E<r3t|1109bp |286bp |f|=
-
#characterize the basal level expression without any inducer or repressor interaction
+
|5: E<r3t|1109bp |286bp |f|=
 +
|6: E<r3t|1109bp |286bp |f|=
 +
|7: E<r3t|1109bp |286bp |f|=
 +
|8: E<r3t|1109bp |286bp |f|=
 +
|9: Positive Control E0240|1114bp |238bp|w|=
 +
|10: Negative Control |0bp |contamination~700,1100,1400|f|=
 +
|11: marker 1kb+100bp|||n}}
-
==== Oscillator Modeling ====
+
Comments: liquid incubation of number 1}}
-
[[/Modeling|Modeling]]
+
-
==== Promoter Strength Testing ====
 
-
[[Team:NYMU-Taipei/Project/Promoter Strength Testing|Reporting Assay of Promoter Strength Testing]]
 
-
====Colony PCR Gel Pictures====
+
== Experiment of oscillator biobrick parts (26) 2009/08/22 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 22 oscillator part(26).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: P<r3t|1138bp |315bp |f|=
 +
|2: P<r3t|1138bp |315bp |f|=
 +
|3: P<r3t|1138bp |315bp |f|=
 +
|4: P<r3t|1138bp |315bp |f|=
 +
|5: 4<t|876bp |739bp |f|=
 +
|6: 4<t|876bp |739bp |f|=
 +
|7: 4<t|876bp |739bp |w|=
 +
|8: 4<t-->(4)|876bp |739bp |w|=
 +
|9: Positive Control E0240|1113bp |250bp|w|=
 +
|10: Negative Control |0bp |contamination~700|f|=
 +
|11: marker 1kb+100bp|||n}}
 +
Comments:
 +
*4t in lane 5 seems strange. It is not correct,but not fail either. Lane 7 and 8 are correct. They could do liquid incubation.
-
{| border="1"
+
*There are no colony on the yesterday's plate Ar2t, so there is no need to do colony PCR.
-
|  [[image:NYMU Gel 1.png|640px]] || '''Figure 1.''' 1.pTet with generator ({{:Team:NYMU-Taipei/BBa|K195610}}) 2.pLac with generator ({{:Team:NYMU-Taipei/BBa|K195612}}) 3.pRE with generator ({{:Team:NYMU-Taipei/BBa|K195609}})
+
-
|}
+
-
{| border="1"
+
*Ligation&Transformation: Ar7t、Pr7t、Lr7t(33.3uL competent cell each)  
-
|  [[image:NYMU Gel 2-1.png|640px]]  || '''Figure 2.''' L1~L2 pTet with generator ({{:Team:NYMU-Taipei/BBa|K195610}}) L3~L4 pPenI with generator ({{:Team:NYMU-Taipei/BBa|K195611}}) L5~L6 pLac with generator ({{:Team:NYMU-Taipei/BBa|K195612}})
+
-
|}
+
-
{| border="1"
+
}}
-
|  [[image:NYMU Gel 5-1.png|640px]]  ||  '''Figure 3.''' L1~L4 pLuxR with generator ({{:Team:NYMU-Taipei/BBa|K195615}}) L5 pCI with generator ({{:Team:NYMU-Taipei/BBa|K195613}}) L6~L8 pLasR with generator ({{:Team:NYMU-Taipei/BBa|K195616}})
+
-
|}
+
-
{| border="1"
+
== Experiment of oscillator biobrick parts (27) 2009/08/23 colony PCR==
-
| [[image:NYMU Gel 4-1.png|640px]]  ||  '''Figure 4.''' L1~L4 p22 with generator ({{:Team:NYMU-Taipei/BBa|K195614}}) L5~L8 pLuxR with generator ({{:Team:NYMU-Taipei/BBa|K195615}})
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 23 oscillator part(27).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
|}
+
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: A<r7t-->(1)|1176bp |292bp |w|=
 +
|2: A<r7t|1176bp |292bp |w|=
 +
|3: P<r7t-->(2)|1199bp |315bp |w|=
 +
|4: P<r7t|1199bp |315bp |w|=
 +
|5: L<r7t-->(3)|1322bp |438bp |w|=
 +
|6: L<r7t|1322bp |438bp |w|=
 +
|7: P<r3t|1138bp |315bp |f|=
 +
|8: P<r3t|1138bp |315bp |f|=
 +
|9: Positive Control E0240|1113bp |250bp|w|=
 +
|10: Negative Control |0bp ||w|=
 +
|11: marker 1kb+100bp|||n}}
-
{| border="1"
+
Comments:
-
| [[image:NYMU Gel 6-1.png|640px]] ||  '''Figure 5.''' L1~L6 pRE with PenI repressor gene ({{:Team:NYMU-Taipei/BBa|K195621}})
+
*all the colonies that are transformed yesterday are all correct. Pr3t is from the checking plate 090821.
 +
*haven't done the liquid incubation yet, should I do the liquid?
 +
*Lr7t is green enough to be identified. Ar7t and Pr7t are not sure enough for me to identify.
-
|}
+
*'''r7t''' is BBa_I13504 from Biobrick, not the ligation from r<7t.
-
====Graph of Experiments====
+
*Today's transformation :
 +
**Ar<2t
 +
**Ar<7t
 +
*'''Ar''' is BBa_J13002 from Biobrick.
 +
}}
-
{| border="1"
+
== Experiment of oscillator biobrick parts (28) 2009/08/23 testing the reheating gel ==
-
|  [[image:NYMU Promoter Strength Test-1.png|640px]]  || '''Figure 1.''' This is the relative promoter strength to pTet, which was tested by measuring the flurorescence with an ELISA Reader. pLux and pLas are inducible promoters, so their measured promoter strength is their basal level strength.
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 23 oscillator part(28).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: r1t|1176bp |292bp |w|=
 +
|2: CI lam|988bp |238bp |m|=
 +
|3: pMnt|1199bp |315bp |w|=
 +
|4: unknown|bp |bp |f|=
 +
|5: unknown|bp |bp |f|=
 +
|6: unknown|bp |bp |f|=
 +
|7: marker 1kb+100bp|||n}}
-
|}
+
Comments:
 +
* This gel is made by many pieces of gel and be reheat once. The result seems that this gel could be use to check DNA length, not suitable for gel extraction.
-
{| border="1"
+
* CI lam is from the old PCR tube. The result is not that reliable since it is not fresh enough. But the result is strange because it is not success or failure either.
-
|  [[image:NYMU Chart (Lr2tEr7t) without line-1.png|640px]]  || '''Figure 2.''' This is the component testing with the activator CII at the downstream of pLac inducing pRE to express GFP.
+
*pMnt seems to be right since that the right marker is upper than th left one, so the length is not sure.
-
|}
+
-
{| border="1"
+
}}
-
|  [[image:NYMU Chart (oscillator) 3-1.png|640px]]  || ''' Figure 3.''' This is the measurement by using an ELISA reader, graphing Fluorescence versus O.D of the Time Delay device(I) ({{:Team:NYMU-Taipei/BBa|K195622}})
+
== Experiment of oscillator biobrick parts (29) 2009/08/26 ==
-
|}
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 26 oscillator part(29).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Pr3t|1138bp |315bp |f|=
 +
|2: Pr3t|1138bp |315bp |m|=
 +
|3: Pr3t|1138bp |315bp |f|=
 +
|4: Pr3t|1138bp |315bp |f|=
 +
|5: Pr3t|1138bp |315bp |f|=
 +
|6: Pr3t|1138bp |315bp |f|=
 +
|7: Pr3t|1138bp |315bp |f|=
 +
|8: Pr3t|1138bp |315bp |f|=
 +
|9: Positive Control E0240|1113bp |250bp|w|=
 +
|10: Negative Control |0bp |Contamination~1400bp|f|=
 +
|11: marker 1kb+100bp|||n}}
-
=== ''msbB'' gene PCR Results ===
+
Comments:
-
{| border="1"
+
*It is not that correct since those colony have not 100% correct.
-
| [[image:NYMU MsbB.png|640px]] || '''Figure 1.''' This gel picture shows the result of PCR by L1~L5 is the length of msbB gene. L6 is negative control.
+
*Pr3t in lane 2 seems to be correct in the upper band, while it also has the wrong length band.
-
|}
+
 
 +
 
 +
}}
 +
== Experiment of oscillator biobrick parts (29) 2009/08/27 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 27 oscillator part(30).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Pr3t|1138bp |315bp |f|=
 +
|2: Pr3t|1138bp |315bp |f|=
 +
|3: Pr3t|1138bp |315bp |f|=
 +
|4: Pr3t|1138bp |315bp |f|=
 +
|5: Pr3t|1138bp |315bp |f|=
 +
|6: nhaA+ E0240|1396bp |512bp |f|=
 +
|7: nhaA+ E0240|1396bp |512bp |f|=
 +
|8: nhaA+ E0240|1396bp |512bp |f|=
 +
|9: Positive Control E0240|1113bp |250bp|w|=
 +
|10: Negative Control |0bp |Contamination~1400bp|f|=
 +
|11: marker 1kb+100bp|||n}}
 +
 
 +
Comment:
 +
 
 +
*all of those bands are fail. It means that nhaA+E0240 didn't ligate well.
 +
 
 +
*DO the ligation again?
 +
 
 +
 
 +
 
 +
}}
 +
 
 +
== Experiment of oscillator biobrick parts (30) 2009/08/28 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 28 oscillator part(31).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Pr3t|1138bp |315bp |f|=
 +
|2: Pr3t|1138bp |315bp |f|=
 +
|3: Pr3t|1138bp |315bp |w|=
 +
|4: Pr3t|1138bp |315bp |f|=
 +
|5: Pr3t|1138bp |315bp |f|=
 +
|6: Pr3t|1138bp |315bp |w|=
 +
|7: Ar2t|749bp |292bp |f|=
 +
|8: Ar2t|749bp |292bp |w|=
 +
|9: Positive Control E0240|1113bp |250bp|w|=
 +
|10: Negative Control |0bp ||w|=
 +
|11: marker 1kb+100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
* It is great progress that we have finally done the ligation of the Ar2t. Doing the liquid this time, including correct one and fail one.
 +
 
 +
* Pr3t is correct. Doing the liquid culture tomorrow from the checking plate 090828.
 +
 
 +
 
 +
}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (31) 2009/08/31 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 31 oscillator part(32).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Ar2t<Er7t|1689bp |749bp |f|=
 +
|2: Ar2t<Er7t|1689bp |749bp |f|=
 +
|3: Ar2t<Er7t|1689bp |749bp |f|=
 +
|4: Ar2t<Er7t|1689bp |749bp |f|=
 +
|5: Ar2t<Er7t|1689bp |749bp |f|=
 +
|6: Ar2t<Er7t|1689bp |749bp |f|=
 +
|7: Ar2t<Er7t|1689bp |749bp |f|=
 +
|8: Ar2t<Er7t|1689bp |749bp |f|=
 +
|9: Positive Control E0240|1113bp |250bp|w|=
 +
|10: Negative Control |0bp |Contamination~700bp|f|=
 +
|11: marker 1kb+100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
*Because the ligation is fail, I restarted from the ligation again. I changed the protocol, which I used 5.5uL inserted DNA instead of using 4uL inserted DNA.  
 +
 
 +
*Since there are still have colony on the plate, we will run colony PCR again with the ligation I did today(L<r7t and Ar2t<Er7t.}}
 +
 
 +
== Experiment of oscillator biobrick parts (32) Gel Extraction 2009/08/31 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 08 31 oscillator part(33).png||c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: 4t|584bp |447bp |f|=
 +
|2: 4t|584bp |447bp |f|=
 +
|3: 4t|584bp |447bp |f|=
 +
|4: 4t|584bp |447bp |f|=
 +
|5: r2t|475bp |38bp |w|=
 +
|6: r2t|475bp |38bp |w|=
 +
|7: r2t|475bp |38bp |w|=
 +
|8: r2t|475bp |38bp |w|=
 +
|9: marker 1kb+100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
*The failure of 4t is due to the digestion, so we have to digest it again.
 +
 
 +
*r2t is fine, so we have extract them from the gel.}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (33) 2009/09/01 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 01 oscillator part(34).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
 +
|2: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
 +
|3: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
 +
|4: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
 +
|5: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
 +
|6: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
 +
|7: Ar2t<Er7t(090830 ligation)|1689bp |749bp |f|=
 +
|8: L<r2t|895bp |438bp |w|=
 +
|9: L<r2t|895bp |438bp |f|=
 +
|10: L<r2t|895bp |438bp |f|=
 +
|11: L<r2t|895bp |438bp |f|=
 +
|12: L<r2t|895bp |438bp |f|=
 +
|13: L<r2t|895bp |438bp |w|=
 +
|14: L<r2t|895bp |438bp |f|=
 +
|15: Ar2t<Er7t(090831 ligation)|1689bp |749bp |w|=
 +
|16: Ar2t<Er7t(090831 ligation)|1689bp |749bp |f|=
 +
|17: Ar2t<Er7t(090831 ligation)|1689bp |749bp |f|=
 +
|18: Ar2t<Er7t(090831 ligation)|1689bp |749bp |w|=
 +
|19: Ar2t<Er7t(090831 ligation)|1689bp |749bp |w|=
 +
|20: Ar2t<Er7t(090831 ligation)|1689bp |749bp |f|=
 +
|21: Ar2t<Er7t(090831 ligation)|1689bp |749bp |m|=
 +
|22: Positive Control E0240|1114bp |238bp|w|=
 +
|23: Negative Control |0bp |contamination~250,1400bp|f|=
 +
|24: marker 1kb+100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
* Liquid incubation should be done by the next day.
 +
 
 +
* I have do the liquid of the 9 and 19. Only 19 is correct. I will do the Digestion and Ligation tomorrow.
 +
}}
 +
 
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (34) Gel Extraction 2009/09/02 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 02 oscillator part(35).png||c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Ar2tEr7t|1476bp |537bp |w|=
 +
|2: Ar2tEr7t|1476bp |537bp |w|=
 +
|3: Ar2tEr7t|1476bp |537bp |w|=
 +
|4: Ar2t|537bp |80bp |f|=
 +
|5: Ar2t|537bp |80bp |f|=
 +
|6: Ar2t|537bp |80bp |f|=
 +
|7: marker 1kb+100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
*The failure of Ar2t is strange, maybe it is that I put too much DNA in the digestion. 
 +
 
 +
*Ar2tEr7t is not digested well, next time we should not put too much DNA.
 +
 
 +
*concentration measurement before the digestion
 +
 
 +
}}
 +
 
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (35) 2009/09/03 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 03 oscillator part(36).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|140s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
 +
|2: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
 +
|3: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
 +
|4: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
 +
|5: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
 +
|6: Er3t<Ar2tEr7t|2567bp |1109bp |w|=
 +
|7: Er3t<Ar2tEr7t|2567bp |1109bp |m|=
 +
|8: Er3t<Ar2tEr7t|2567bp |1109bp |f|=
 +
|9: Positive Control E0240|1113bp |250bp|w|=
 +
|10: Negative Control |0bp |Contamination~290bp,1300bp,1400bp |f|=
 +
|11: marker 1kb+100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
*There is a lot of contamination in the negative control. We speculated that it might be due to buffer since that eyelight used the old taq and buffer. 
 +
*The length seems to be right, but it is still need to be measured by GFP machine to check if it could be oscillate. 
 +
 
 +
}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (36) Gel Extraction 2009/09/03 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 03 oscillator part(37).png||c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Ar2t(8-2)|537bp |80bp |f|=
 +
|2: Ar2t(8-2)|537bp |80bp |f|=
 +
|3: Ar2t(8-2)|537bp |80bp |f|=
 +
|4: Er3t|897bp |74bp |w|=
 +
|5: Er3t|897bp |74bp |w|=
 +
|6: Er3t|897bp |74bp |w|=
 +
|7: -|||n|=
 +
|8: 4t|584bp |447bp |w|=
 +
|9: 4t|584bp |447bp |w|=
 +
|10: 4t|584bp |447bp |w|=
 +
|11: marker 1kb+100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
*Ar2t still fails. Er3t is the one that we are trying to ligate with Ar2t.
 +
 
 +
 
 +
}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (37) 2009/09/04 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 04 oscillator part(38).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|110s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Lr2t<Er7t|1834bp |895bp |f|=
 +
|2: Lr2t<Er7t|1834bp |895bp |f|=
 +
|3: Lr2t<Er7t|1834bp |895bp |f|=
 +
|4: Lr2t<Er7t|1834bp |895bp |f|=
 +
|5: Lr2t<Er7t|1834bp |895bp |w|=
 +
|6: P<r2t|772bp |315bp |f|=
 +
|7: P<r2t|772bp |315bp |w|=
 +
|8: P<r2t|772bp |315bp |f|=
 +
|9: P<r2t|772bp |315bp |w|=
 +
|10: P<r2t|772bp |315bp |f|=
 +
|11: Ar2t<Er3t|1628bp |749bp |f|=
 +
|12: Ar2t<Er3t|1628bp |749bp |f|=
 +
|13: Ar2t<Er3t|1628bp |749bp |w|=
 +
|14: Ar2t<Er3t|1628bp |749bp |f|=
 +
|15: Ar2t<Er3t|1628bp |749bp |f|=
 +
|16: r<4t|816bp |250bp |w|=
 +
|17: r<4t|816bp |250bp |f|=
 +
|18: r<4t|816bp |250bp |w|=
 +
|19: r<4t|816bp |250bp |w|=
 +
|20: r<4t|816bp |250bp |w|=
 +
|21: r<4t|816bp |250bp |w|=
 +
|22: Positive Control E0240|1114bp |238bp|w|=
 +
|23: Negative Control |0bp ||m|=
 +
|24: marker 1kb+100bp|||n}}
 +
 
 +
Comments
 +
 
 +
*There is no contamination since I use the old buffer and enzyme. In addition, I change to use new dNTP and I speculated the contamination might be due to new buffer. 
 +
 
 +
*Need to make liquid incubation by using checking plate
 +
 
 +
}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (38) Gel Extraction 2009/09/09 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 09 oscillator part(39).png||c=
 +
2% agarose, 100V, 28min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 100bp|||n|=
 +
|1: marker 1kb|||n|=
 +
|2: r4t|604bp |38bp |w|=
 +
|3: r4t|604bp |38bp |w|=
 +
|4: r4t|604bp |38bp |w|=
 +
|5: -|||n|=
 +
|6: Ar2tEr7t|707bp |?bp |w|=
 +
|7: Er3tAr2tEr7t|707bp|?bp|w|=
 +
|8: marker 1kb|||n|=
 +
|9: marker 100bp|||n|=}}
 +
 
 +
Comments:
 +
 
 +
*r4t is correct though it is not digested well enough.
 +
 
 +
 
 +
}}
 +
 
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (39) 2009/09/11 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 11 oscillator part(40).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|110s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: A<r4t|878bp |292bp |f|=
 +
|2: E<r4t|872bp |286bp |w|=
 +
|3: E<r4t|872bp |286bp |w|=
 +
|4: E<r4t|872bp |286bp |w|=
 +
|5: E<r4t|872bp |286bp |w|=
 +
|6: E<r4t|872bp |286bp |w|=
 +
|7: E<r4t|872bp |286bp |w|=
 +
|8: Pr2t<Er7t|1712bp |772bp |f|=
 +
|9: Pr2t<Er7t|1712bp |772bp |f|=
 +
|10: Pr2t<Er7t|1712bp |772bp |f|=
 +
|11: Pr2t<Er7t|1712bp |772bp |f|=
 +
|12: Pr2t<Er7t|1712bp |772bp |f|=
 +
|13: Pr2t<Er7t|1712bp |772bp |f|=
 +
|14: Positive Control E0240|1114bp |238bp|w|=
 +
|15: Negative Control |0bp ||w|=
 +
|16: marker 1kb+100bp|||n}}
 +
 
 +
Comments
 +
 
 +
*It is awful that the plate of Ar4t only have one colony on it. Maybe it is due to the bad digestion of pTet(A). Should the experiment be started from the digestion of pTet or ligation?
 +
 
 +
*Pr2t<Er7t could do the colony PCR again to check if there are another correct colony. 
 +
}}
 +
 
 +
 
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (40) 2009/09/15 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 15 oscillator part(41).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|100s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Pr2t<Er7t|1712bp |772bp |f|=
 +
|2: Pr2t<Er7t|1712bp |772bp |f|=
 +
|3: Pr2t<Er7t|1712bp |772bp |f|=
 +
|4: Pr2t<Er7t|1712bp |772bp |f|=
 +
|5: Pr2t<Er7t|1712bp |772bp |m|=
 +
|6: A<r4t|878bp |292bp |f|=
 +
|7: A<r4t|878bp |292bp |f|=
 +
|8: A<r4t|878bp |292bp |f|=
 +
|9: Positive Control E0240|1114bp |238bp|w|=
 +
|10: Negative Control |0bp |contamination~700bp|f|=
 +
|11: marker 1kb+100bp|||n}}
 +
 
 +
 
 +
Comments:
 +
 
 +
*Redo the colony PCR again and use more colony to check if there is a correct colony.
 +
*Lane 5 is strange, maybe it is the P<Er7t because the r2t hasn't been ligated correctly.
 +
*Ar4t keeps fail, however there are some small colony we can pick up.
 +
 
 +
}}
 +
 
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (41) 2009/09/17 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 17 oscillator part(42).png|{{:Team:NYMU-Taipei/PCR|60s|15s|110s|100s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 29in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: A<r4t|878bp |292bp |w|=
 +
|2: A<r4t|878bp |292bp |w|=
 +
|3: A<r4t|878bp |292bp |w|=
 +
|4: A<r4t|878bp |292bp |w|=
 +
|5: A<r4t|878bp |292bp |w|=
 +
|6: A<r4t|878bp |292bp |w|=
 +
|7: A<r4t|878bp |292bp |w|=
 +
|8: A<r4t|878bp |292bp |w|=
 +
|9: A<r4t|878bp |292bp |w|=
 +
|10: A<r4t|878bp |292bp |w|=
 +
|11: A<r4t|878bp |292bp |w|=
 +
|12: Pr2t<Er7t|1712bp |772bp |f|=
 +
|13: Pr2t<Er7t|1712bp |772bp |f|=
 +
|14: Pr2t<Er7t|1712bp |772bp |f|=
 +
|15: Pr2t<Er7t|1712bp |772bp |f|=
 +
|16: Pr2t<Er7t|1712bp |772bp |f|=
 +
|17: Pr2t<Er7t|1712bp |772bp |f|=
 +
|18: Pr2t<Er7t|1712bp |772bp |w|=
 +
|19: Pr2t<Er7t|1712bp |772bp |m|=
 +
|20: Pr2t<Er7t|1712bp |772bp |f|=
 +
|21: Pr2t<Er7t|1712bp |772bp |f|=
 +
|22: Positive Control E0240|1114bp |238bp|w|=
 +
|23: Negative Control |0bp |contamination~300bp,700bp|f|=
 +
|24: marker 1kb+100bp|||n}}
 +
 
 +
 
 +
Comments:
 +
 
 +
}}
 +
 
 +
== Experiment of oscillator biobrick parts (42) 2009/09/18 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 18 oscillator part(43).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|40s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: pLuxR|293bp |238bp |w|=
 +
|2: pLuxR|293bp |238bp |w|=
 +
|3: pCI|287bp |238bp |w|=
 +
|4: pCI|287bp |238bp |w|=
 +
|5: p22|292bp |238bp |w|=
 +
|6: p22|292bp |238bp |w|=
 +
|7: pLasR|395bp |238bp |w|=
 +
|8: pLasR|395bp |238bp |w|=
 +
|9: Positive Control Term|445bp |316bp|w|=
 +
|10: Negative Control |0bp |contamination~700bp|f|=
 +
|11: marker 1kb+100bp|||n}}}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (43) 2009/09/22 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 22 oscillator part(44).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|70s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 100bp|||n|=
 +
|1: p22+r7t|1175bp |292bp |m|=
 +
|2: p22+r7t|1175bp |292bp |w|=
 +
|3: p22+r7t|1175bp |292bp |w|=
 +
|4: p22+r7t|1175bp |292bp |w|=
 +
|5: pLuxR+r7t|1176bp |293bp |w|=
 +
|6: pLuxR+r7t|1176bp |293bp |w|=
 +
|7: pLuxR+r7t|1176bp |293bp |w|=
 +
|8: pLuxR+r7t|1176bp |293bp |w|=
 +
|9: Positive Control E0240|1114bp |238bp|w|=
 +
|10: Negative Control |0bp ||w|=
 +
|11: marker 100bp|||n}}}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (44) 2009/09/24 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 24 oscillator part(45).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 100bp|||n|=
 +
|1: pLuxR+r7t|1176bp |293bp |m|=
 +
|2: pLuxR+r7t|1176bp |293bp |w|=
 +
|3: pLuxR+r7t|1176bp |293bp |w|=
 +
|4: pCI+r7t|1170bp |287bp |m|=
 +
|5: pLasR+r7t|1278bp |395bp |w|=
 +
|6: pLasR+r7t|1278bp |395bp |w|=
 +
|7: pLasR+r7t|1278bp |395bp |w|=
 +
|8: pLasR+r7t|1278bp |395bp |w|=
 +
|9: Positive Control E0240|1114bp |238bp|w|=
 +
|10: Negative Control |0bp |contamination~1100bp|w|=
 +
|11: marker 100bp|||n}}
 +
 
 +
Comments:
 +
 
 +
*It is strange that the colony of pCI+r7t is glowing obviously, but the length seems to be wrong.
 +
 
 +
}}
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (45) (Gel Extraction) 2009/09/28==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 09 28 oscillator part(46).png||c=
 +
2% agarose, 100V, 30min
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 1kb+100bp|||n|=
 +
|1: Pr2tEr7t-18|1500bp |560bp |w|=
 +
|2: Pr2tEr7t-18|1500bp |560bp |w|=
 +
|3: Pr2tEr7t-18|1500bp |560bp |w|=
 +
|4: Pr2tEr7t-19|1500bp |560bp |m|=
 +
|5: Pr2tEr7t-19|1500bp |560bp |m|=
 +
|6: Pr2tEr7t-19|1500bp |560bp |m|=
 +
|7: unknown|841bp |38bp |m|=
 +
|8: unknown|841bp |38bp |m|=
 +
|9: unknown|841bp |38bp |m|=
 +
|10: unknown|841bp |38bp |m|=
 +
|11: marker 1kb+100bp|||n}} }}
 +
 
 +
 
 +
 
 +
== Experiment of oscillator biobrick parts (46) 2009/10/17 ==
 +
{{:Team:NYMU-Taipei/GEL|NYMU 2009 10 17 oscillator part(47).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
 +
2% agarose, 100V, 28in
 +
{{:Team:NYMU-Taipei/GELC|=
 +
|0: marker 100bp|||n|=
 +
|1: Er4t<Pr2t|1414bp |872bp |f|=
 +
|2: Er4t<Pr2t|1414bp |872bp |f|=
 +
|3: Er4t<Pr2t|1414bp |872bp |f|=
 +
|4: Er4t<Pr2t|1414bp |872bp |f|=
 +
|5: Er4t<Pr2t|1414bp |872bp |f|=
 +
|6: Er4t<Pr2t|1414bp |872bp |f|=
 +
|7: Er4t<Pr2t|1414bp |872bp |f|=
 +
|8: Er4t<Pr2t|1414bp |872bp |f|=
 +
|9: Positive Control Lr7t|1321bp |438bp|w|=
 +
|10: Negative Control |0bp |contamination~1100bp|w|=
 +
|11: marker 100bp|||n}}}}
-
== References ==
 
-
[1]Sang Chin Lee,† Mary E. Brummet,* Syed Shahabuddin,* Thasia G. Woodworth,‡
+
== Experiment of oscillator biobrick parts (47) 2009/10/18 ==
-
Steve N. Georas,* Kristin M. Leiferman,§ Steven C. Gilman,‡ Cristiana Stellato,*
+
{{:Team:NYMU-Taipei/GEL|NYMU 2009 10 18 oscillator part(48).png|{{:Team:NYMU-Taipei/PCR|60s|15s|20s|80s|300s|rp=VR|fp=VF2}}|c=
-
Ron P. Gladue,‡ Robert P. Schleimer,* and Lisa A. Beck2*:'''Cutaneous Injection of Human Subjects with Macrophage Inflammatory Protein-1a Induces Significant Recruitment of Neutrophils and Monocytes1.'''The Journal of Immunology, 2000, 164: 3392–3401.
+
2% agarose, 100V, 30in
-
<br>[2]D. HALLER,1,2* S. BLUM,3 C. BODE,1 W. P. HAMMES,2 AND E. J. SCHIFFRIN3:'''Activation of Human Peripheral Blood Mononuclear Cells by Nonpathogenic Bacteria In Vitro: Evidence of NK Cells as Primary Targets.'''2000, American Society for Microbiology<br>
+
{{:Team:NYMU-Taipei/GELC|=
-
[3]F. Porcheray,* S. Viaud,* A.-C. Rimaniol,‡C. Léone,* B. Samah,*N. Dereuddre-Bosquet,‡D.Dormont*†and G. Gras*:'''Macrophage activation switching: an asset for the resolution of inflammation.'''doi:10.1111/j.1365-2249.2005.02934.x
+
|0: marker 100bp|||n|=
-
<br>[4]A. Hrabák1, T. Bajor2 and I. Csuka1:'''The effect of various infl ammatory agents on the phagocytosis and cytokine profi le of mouse and rat macrophages.'''Infl amm. res. 57 (2008) 75–831023-3830/08/020075-9DOI 10.1007/s00011-007-7057-7<br>
+
|1: marker 1kb|||n|=
-
[5]http://partsregistry.org/wiki/index.php/Part:BBa_P1010
+
|2: Ar4t<Pr3t|1786bp |878bp |f|=
-
<br>[6]http://partsregistry.org/Part:BBa_K145230<br>
+
|3: Ar4t<Pr3t|1786bp |878bp |m|=
-
[7] [http://en.wikipedia.org/wiki/Lipopolysaccharide#Lipid_A/ LPS]
+
|4: Ar4t<Pr3t|1786bp |878bp |f|=
-
<br>[8] [[File:NYMU LPS濃度對於細胞CD14的表現的影響.pdf]]
+
|5: Er4t<Pr2t|1414bp |872bp |f|=
-
<br>[9]Sudipta Tripathi, David Bruch and Dilip S Kittur*:'''Ginger extract inhibits LPS induced macrophage activation and function.'''2008 Tripathi et al; licensee BioMed Central Ltd.BMC Complementary and Alternative Medicine 2008, 8:1 doi:10.1186/1472-6882-8-1
+
|6: Er4t<Pr2t|1414bp |872bp |f|=
-
{{:Team:NYMU-Taipei/Footer}}
+
|7: Er4t<Pr2t|1414bp |872bp |f|=
 +
|8: Er4t<Pr2t|1414bp |872bp |f|=
 +
|9: Er4t<Pr2t|1414bp |872bp |f|=
 +
|10: Er4t<Pr2t|1414bp |872bp |w|=
 +
|11: Er4t<Pr2t|1414bp |872bp |m|=
 +
|12: Er4t<Pr2t|1414bp |872bp |f|=
 +
|13: Er4t<Pr2t|1414bp |872bp |f|=
 +
|14: Positive Control Ar7t|1175bp |292bp|w|=
 +
|15: Negative Control |0bp |contamination~1100bp|w|=
 +
|16: Negative Control |0bp |contamination~1100bp|w|=
 +
|17: marker 1kb|||n|=
 +
|18: marker 100bp|||n}}}}

Revision as of 21:05, 21 October 2009

Contents

Experiment of oscillator biobrick parts

1 BBa_C0051 cI repressor from E. coli phage lambda (+LVA)
2 BBa_K116602 CII coding region from λ phage
3 BBa_C0040 tetracycline repressor from transposon Tn10 (+LVA)
4 BBa_C0074
5 BBa_C0072
6 BBa_C0073
7 BBa_E0040
t BBa_B0015
A BBa_R0040
P BBa_R0074
L BBa_R0010
M BBa_R0073
C BBa_R0051
pCI BBa_R1051
p22 BBa_R0053
pLuxR BBa_R0062
pLasR BBa_R0079
E BBa_K116603


NYMU 2009 07 24 oscillator part.png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: BBa_R0051 pCI 287bp (49+238) 238bp
2: BBa_C0051 CI lam 988bp (750+238) 238bp
3: BBa_C0040 TetR 838bp (660+238) 238bp
4: BBa_B0034 RBS 250bp (12+238) 238bp
5: BBa_j13002 pTetR 302bp (74+238) 238bp
6: BBa_B0015 Term 445bp (129+316) 316bp
7: BBa_K116602 CII 532bp (294+238) 238bp
8: BBa_K116603 pRE 286bp (48+238) 238bp
9: Positive Control BBa_E0240 1114bp (876+238) 238bp
10: Negative Control 0bp
11: marker 100bp


Experiment of oscillator biobrick parts (2)

NYMU 2009 07 27 oscillator part(2).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: BBa_R0040 pTetR 292bp (54+238) 238bp
2: BBa_E0840 1116bp (878+238) 238bp
3: CII<Term(from jesse) 669bp (294+8+129+238) 532bp (294+238)
4: Positive Control BBa_E0240 1114bp (876+238) 238bp
5: Negative Control Contamination ~300bp
6: - - -
7-8: BBa_B0015 Term (gel extraction) 155bp (129+26)
9: marker 100bp


Experiment of oscillator biobrick parts (3)

NYMU 2009 07 29 oscillator part(3).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: CII<Term 669bp (294+8+129+238) 532bp (294+238)
2: CI lam<Term 1125bp (750+8+129+238) 988bp (750+238)
3: TetR<Term 1035bp (660+8+129+238) 898bp (660+238)
4: BBa_R0051 pCI 287bp (49+238) 238bp
5: BBa_j13002 pTetR+RBS 312bp (74+238) 238bp
6: Positive Control BBa_E0240 1114bp (876+238) 238bp
7: Negative Control 0bp Contamination ~300&700bp,
8: - - -
9-10: BBa_E0840 (Gel extraction) 878bp
11: marker 100bp

4: Inconclusive.

Experiment of oscillator biobrick parts (4)

NYMU 2009 07 31 oscillator part(4).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: BBa_R0074 pPenI 315bp (77+238) 238bp
2-6: BBa_C0074 PenI 739bp (423+316) 316bp
7-11: BBa_R0073 pMnt 383bp (67+316) 316bp
12-16: BBa_C0072 Mnt (Strong) 604bp (288+316) 316bp
17-21: BBa_C0073 Mnt (Weak) 604bp (288+316) 316bp
22: Positive Control BBa_E0240 1114bp (876+238) 238bp
23: Negative Control 0bp Contamination
24: marker 100bp

The result for lanes 7-11 look weird, but it could be because of the gel. A rerun will be done.


Experiment of oscillator biobrick parts (5)

NYMU 2009 07 31 oscillator part(5).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1-2: TetR<Term (Gel extraction) 821bp (660+8+129+24) 684bp (660+24)
4-5: CII<Term (Gel extraction) 455bp (294+8+129+24) 318bp (294+24)
7-9: CI<Term (Gel extraction) 911bp (750+8+129+24) 774bp (750+24)
10: marker 100bp


Experiment of oscillator biobrick parts (6)

NYMU 2009 08 03 oscillator part(6).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: BBa_R0074 pPenI 315bp (77+238) 238bp
2: BBa_C0074 PenI 739bp (423+316) 316bp
3: BBa_R0073 pMnt 383bp (67+316) 316bp
4: BBa_C0072 Mnt (Strong) 604bp (288+316) 316bp
5: BBa_C0073 Mnt (Weak) 604bp (288+316) 316bp
6: Positive Control BBa_E0240 1114bp (876+238) 238bp
7: Negative Control 0bp Contamination
8: marker 100bp


Experiment of oscillator biobrick parts (7)

NYMU 2009 08 03 oscillator part(7).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: RBS + CII + Term 687bp 250bp
2: RBS + CI lam + Term 1143bp 250bp
3: RBS + TetR + Term 1053bp 250bp
4: pCI(plate from 090729) 287bp 238bp
5: E0840 604bp (288+316) 316bp
6: pCI(plasmid from 090730) 287bp 238bp
7: Positive Control BBa_E0240 1114bp (876+238) 238bp
8: Negative Control 0bp Contamination~300bp
9: marker 1kb+100bp


Experiment of oscillator biobrick parts (8)

NYMU 2009 08 04 oscillator part(8).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: BBa_I13504 r7t 1113bp 250bp
2: BBa_I13522 Ar7t 1176bp 292bp
3: BBa_I13401 7t 1095bp 958bp
4: BBa_R0051 pCI 287bp 238bp
5: pTetR<E0240 1176bp 292bp
6: PenI<Term 876bp 739bp
7: Mnt (Strong)<Term 741bp 604bp
8: Mnt (Weak)<Term 741bp 604bp
9: Positive Control BBa_E0240 1114bp (876+238) 238bp
10: Negative Control 0bp Contamination~300bp
11: marker 100bp


Experiment of oscillator biobrick parts (9) Gel Extraction

NYMU 2009 08 04 oscillator part(9).png


2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: B0034+CII+Term r2t 475bp 38bp
2: B0034+CII+Term r2t 475bp 38bp
3: B0034+CII+Term r2t 475bp 38bp
4: B0034+CI lam+Term r1t 931bp 38bp
5: B0034+CI lam+Term r1t 931bp 38bp
6: B0034+CI lam+Term r1t 931bp 38bp
7: B0034+Tet R+Term r3t 841bp 38bp
8: B0034+Tet R+Term r3t 841bp 38bp
9: B0034+Tet R+Term r3t 841bp 38bp
10: marker 100bp


Experiment of oscillator biobrick parts (10) (Gel Extraction)

NYMU 2009 08 05 oscillator part(10).png


2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: BBa_I13504 r7t 901bp 0bp
2: BBa_I13401 7t 881bp 0bp
3: PenI+Term 584bp 447bp
4: Mnt (Strong)+Term 5t 449bp 312bp
5: Mnt (Weak)+Term 6t 449bp 312bp
6: TetR+Term 3t 821bp 684bp
7: marker 1kb+100bp


Experiment of oscillator biobrick parts (11)

NYMU 2009 08 06 oscillator part(11).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: marker 1kb
2: C 287bp 238bp
3: M 383bp 316bp
4: 3t 1035bp 898bp
5: 4t 876bp 739bp
6: 5t 741bp 604bp
7: 6t 741bp 604bp
8: Positive Control E0240 1114bp 238bp
9: Negative Control 0bp Contamination~300
10: bp bp
11: bp bp
12: r<1t 1143bp 250bp
13: r<2t 687bp 250bp
14: r<7t 1113bp 250bp
15: 3<t 1035bp 898bp
16: 5<t 741bp 604bp
17: Positive Control E0240 1114bp 238bp
18: Negative Control 0bp Contamination~
19: marker 1kb
20: marker 100bp


Experiment of oscillator biobrick parts (12)

NYMU 2009 08 11 oscillator part(12).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: Lr7t 1321bp 438bp
2: Lr7t 1321bp 438bp
3: Positive Control E0240 1114bp 238bp
4: r1t 1143bp 250bp
5: r1t 1143bp 250bp
6: r1t 1143bp 250bp
7: r1t 1143bp 250bp
8: r1t 1143bp 250bp
9: r1t 1143bp 250bp
10: r1t 1143bp 250bp
11: r1t 1143bp 250bp
12: r2t 687bp 250bp
13: r2t 687bp 250bp
14: r2t 687bp 250bp
15: r2t 687bp 250bp
16: r2t 687bp 250bp
17: r2t 687bp 250bp
18: r2t 687bp 250bp
19: r2t 687bp 250bp
20: r2t 687bp 250bp
21: r2t 687bp 250bp
22: r2t 687bp 250bp
23: Negative Control 0bp
24: marker 1kb+100bp


Experiment of oscillator biobrick parts (13) 2009/08/13

NYMU 2009 08 13 oscillator part(13).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 90V, 38min

Descr Win length Fail length
0: marker 1kb+100bp
1: 3t 1035bp 898bp
2: 3t 1035bp 898bp
3: 3t 1035bp 898bp
4: 3t 1035bp 898bp
5: 3t 1035bp 898bp
6: 4t 876bp 739bp
7: 4t 876bp 739bp
8: 4t 876bp 739bp
9: 4t 876bp 739bp
10: 4t 876bp 739bp
11: 5t 741bp 604bp
12: 5t 741bp 604bp
13: 5t 741bp 604bp
14: 5t 741bp 604bp
15: 5t 741bp 604bp
16: 6t 741bp 604bp
17: 6t 741bp 604bp
18: 6t 741bp 604bp
19: 6t 741bp 604bp
20: 6t 741bp 604bp
21: 1t 1125bp 988bp
22: Positive Control E0240 1114bp 238bp
23: Negative Control 0bp
24: marker 1kb+100bp


Experiment of oscillator biobrick parts (14) (Gel Extraction) 2009/08/13

NYMU 2009 08 13 oscillator part(14).png


2% agarose, 90V, 36min

Descr Win length Fail length
0: marker 1kb+100bp
1: r1t 929bp
2: r1t 929bp
3: marker 1kb+100bp
4: r2t 473bp
5: r2t 473bp


Experiment of oscillator biobrick parts (15) 2009/08/15

NYMU 2009 08 15 oscillator part(15).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: Ar7t 1176bp 292bp
2: Ar7t 1176bp 292bp
3: Ar7t 1176bp 292bp
4: Ar2t 749bp 292bp
5: Pr7t 1199bp 315bp
6: Lr7t 1322bp 438bp
7: Lr7t 1322bp 438bp
8: Lr7t 1322bp 438bp
9: Lr7t 1322bp 438bp
10: Cr7t 1171bp 287bp
11: Cr7t 1171bp 287bp
12: Cr7t 1171bp 287bp
13: Cr7t 1171bp 287bp
14: Er7t 1170bp 286bp
15: Er7t 1170bp 286bp
16: Er7t 1170bp 286bp
17: Er7t 1170bp 286bp
18: Er7t 1170bp 286bp
19: Positive Control E0240 1114bp 238bp
23: Negative Control 0bp
24: marker 1kb+100bp


Experiment of oscillator biobrick parts (16) (Gel Extraction) 2009/08/15

NYMU 2009 08 15 oscillator part(16).png


2% agarose, 100V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: 3t 821bp 684bp
2: 3t 821bp 684bp
3: 3t 821bp 684bp
4: 4t 584bp 447bp
5: 4t 584bp 447bp
6: 4t 584bp 447bp
7: marker 1kb+100bp


Experiment of oscillator biobrick parts (17) 2009/08/16

NYMU 2009 08 16 oscillator part(17).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: pH sensor 512bp
2: pH sensor 512bp
3: pH sensor 512bp
4: pH sensor 512bp
5: r3t 1053bp 250bp
6: r3t 1053bp 250bp
7: r3t 1053bp 250bp
8: r3t 1053bp 250bp
9: Positive Control E0240 1114bp 238bp
10: Negative Control 0bp
11: marker 1kb+100bp


Experiment of oscillator biobrick parts (18) (digestion) 2009/08/17

NYMU 2009 08 17 oscillator part(18).png


2% agarose, 100V, 30min

Descr Win length Fail length
0: marker 1kb
1: marker 100bp
2: Cr7t(XN) 311,2701bp 253bp,2701bp
3: Er7t(NP) 36,274,2701bp 253bp,2701bp
4: pH Sensor Plasmid #1 Amplify 1-2 (XP) 296,2057bp 1180,2057bp
5: pH Sensor Plasmid #1 Amplify 3-4 (XP) 296,2057bp 1180,2057bp
6: pH Sensor Plasmid #1 Amplify 1-2 (XN) 2353bp 536,2701bp
6: pH Sensor Plasmid #1 Amplify 3-4 (XN) 2353bp 536,2701bp
7: marker 1kb+100bp

Comments

  • Colony's of lanes 4-7 came from the same plate. Because this part was left over from last year, we didn't know if this plasmid contained K116001 or K116002. This gel's digestion results say K116002.


Experiment of oscillator biobrick parts (19) (Gel Extraction) 2009/08/17

NYMU 2009 08 17 oscillator part(19).png


2% agarose, 100V, 30min

Descr Win length Fail length
0: marker 100bp
1: marker 1kb
2: Er7t 958bp 74bp
3: Er7t 958bp 74bp
4: Er7t 958bp 74bp
5: Cr7t 959bp 75bp
6: Cr7t 959bp 75bp
7: Cr7t 959bp 75bp
8: marker 1kb
9: marker 100bp


Experiment of oscillator biobrick parts (20) 2009/08/18

NYMU 2009 08 18 oscillator part(20).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: AR7t 1175bp 292bp
2: AR7t 1175bp 292bp
3: PR7t 1198bp 315bp
4: PR7t 1198bp 315bp
5: CR7t 1170bp 287bp
6: CR7t 1170bp 287bp
7: pMnt 383bp 316bp
8: CI lam 988bp 238bp
9: Positive Control E0240 1114bp 238bp
10: Negative Control 0bp contamination~700bp
11: marker 1kb+100bp


Experiment of oscillator biobrick parts (21) (Gel Extraction) 2009/08/18

NYMU 2009 08 18 oscillator part(21).png


2% agarose, 100V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: r3t(XP) 841bp 38bp
2: r3t(XP) 841bp 38bp
3: r3t(XP) 841bp 38bp
4: term(XP) 155bp 445bp
5: term(XP) 155bp 445bp
6: term(XP) 155bp 445bp
7: marker 1kb+100bp


Experiment of oscillator biobrick parts (22) 2009/08/19

NYMU 2009 08 19 oscillator part(22).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
pfu 0.5μl
ddH20 39.5μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 60s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: nhaA 274bp 0bp
2: Positive Control Term 445bp 316bp
3: Negative Control 0bp
4: marker 1kb+100bp

PCR of nhaA using this protocol worked.


Experiment of oscillator biobrick parts (23) 2009/08/19

NYMU 2009 08 19 oscillator part(23).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: 4<t 876bp 739bp
2: 4<t 876bp 739bp
3: 4<t 876bp 739bp
4: 4<t 876bp 739bp
5: 5<t 741bp 604bp
6: 5<t 741bp 604bp
7: 5<t 741bp 604bp
8: 5<t 741bp 604bp
9: 6<t 741bp 604bp
10: 6<t 741bp 604bp
11: 6<t 741bp 604bp
12: 6<t 741bp 604bp
13: M<R7t 1267bp 383bp
14: M<R7t 1267bp 383bp
15: M<r7t 1267bp 383bp
16: M<r7t 1267bp 383bp
17: M 383bp 316bp
18: P 315bp 238bp
19: 1 988bp 238bp
20: 5 604bp 316bp
21: 6 604bp 316bp
22: Positive Control E0240 1114bp 238bp
23: Negative Control 0bp contamination~300,1100bp
24: marker 1kb+100bp


Experiment of oscillator biobrick parts (24) 2009/08/20

NYMU 2009 08 20 oscillator part(24).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 27min

Descr Win length Fail length
0: marker 1kb+100bp
1: nhaA -->(l) 512bp 238bp
2: A<r2t 749bp 292bp
3: E<r3t 1109bp 286bp
4: E<r3t 1109bp 286bp
5: E<r3t 1109bp 286bp
6: 4t 876bp 739bp
7: 5t 741bp 604bp
8: 6t 741bp 604bp
9: Positive Control E0240 1114bp 238bp
10: Negative Control 0bp
11: marker 1kb+100bp

Comments:

  • Next time, for the failed ligations, revert back to using old enzymes and redo. Maybe it's something to do with not being familiar enough with the new brands.
  • Ligating digested PCR product nhaA(XP) onto an empty pSB1A2 plasmid (obtained from extracting it from digesting E0240(XP)) worked.


Experiment of oscillator biobrick parts (25) 2009/08/21

NYMU 2009 08 21 oscillator part(25).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: E<r3t-->(l) 1109bp 286bp
2: E<r3t 1109bp 286bp
3: E<r3t 1109bp 286bp
4: E<r3t 1109bp 286bp
5: E<r3t 1109bp 286bp
6: E<r3t 1109bp 286bp
7: E<r3t 1109bp 286bp
8: E<r3t 1109bp 286bp
9: Positive Control E0240 1114bp 238bp
10: Negative Control 0bp contamination~700,1100,1400
11: marker 1kb+100bp


Comments: liquid incubation of number 1


Experiment of oscillator biobrick parts (26) 2009/08/22

NYMU 2009 08 22 oscillator part(26).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: P<r3t 1138bp 315bp
2: P<r3t 1138bp 315bp
3: P<r3t 1138bp 315bp
4: P<r3t 1138bp 315bp
5: 4<t 876bp 739bp
6: 4<t 876bp 739bp
7: 4<t 876bp 739bp
8: 4<t-->(4) 876bp 739bp
9: Positive Control E0240 1113bp 250bp
10: Negative Control 0bp contamination~700
11: marker 1kb+100bp


Comments:

  • 4t in lane 5 seems strange. It is not correct,but not fail either. Lane 7 and 8 are correct. They could do liquid incubation.
  • There are no colony on the yesterday's plate Ar2t, so there is no need to do colony PCR.
  • Ligation&Transformation: Ar7t、Pr7t、Lr7t(33.3uL competent cell each)


Experiment of oscillator biobrick parts (27) 2009/08/23 colony PCR

NYMU 2009 08 23 oscillator part(27).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: A<r7t-->(1) 1176bp 292bp
2: A<r7t 1176bp 292bp
3: P<r7t-->(2) 1199bp 315bp
4: P<r7t 1199bp 315bp
5: L<r7t-->(3) 1322bp 438bp
6: L<r7t 1322bp 438bp
7: P<r3t 1138bp 315bp
8: P<r3t 1138bp 315bp
9: Positive Control E0240 1113bp 250bp
10: Negative Control 0bp
11: marker 1kb+100bp


Comments:

  • all the colonies that are transformed yesterday are all correct. Pr3t is from the checking plate 090821.
  • haven't done the liquid incubation yet, should I do the liquid?
  • Lr7t is green enough to be identified. Ar7t and Pr7t are not sure enough for me to identify.
  • r7t is BBa_I13504 from Biobrick, not the ligation from r<7t.
  • Today's transformation :
    • Ar<2t
    • Ar<7t
  • Ar is BBa_J13002 from Biobrick.


Experiment of oscillator biobrick parts (28) 2009/08/23 testing the reheating gel

NYMU 2009 08 23 oscillator part(28).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: r1t 1176bp 292bp
2: CI lam 988bp 238bp
3: pMnt 1199bp 315bp
4: unknown bp bp
5: unknown bp bp
6: unknown bp bp
7: marker 1kb+100bp


Comments:

  • This gel is made by many pieces of gel and be reheat once. The result seems that this gel could be use to check DNA length, not suitable for gel extraction.
  • CI lam is from the old PCR tube. The result is not that reliable since it is not fresh enough. But the result is strange because it is not success or failure either.
  • pMnt seems to be right since that the right marker is upper than th left one, so the length is not sure.

Experiment of oscillator biobrick parts (29) 2009/08/26

NYMU 2009 08 26 oscillator part(29).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 29min

Descr Win length Fail length
0: marker 1kb+100bp
1: Pr3t 1138bp 315bp
2: Pr3t 1138bp 315bp
3: Pr3t 1138bp 315bp
4: Pr3t 1138bp 315bp
5: Pr3t 1138bp 315bp
6: Pr3t 1138bp 315bp
7: Pr3t 1138bp 315bp
8: Pr3t 1138bp 315bp
9: Positive Control E0240 1113bp 250bp
10: Negative Control 0bp Contamination~1400bp
11: marker 1kb+100bp


Comments:

  • It is not that correct since those colony have not 100% correct.
  • Pr3t in lane 2 seems to be correct in the upper band, while it also has the wrong length band.

Experiment of oscillator biobrick parts (29) 2009/08/27

NYMU 2009 08 27 oscillator part(30).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 29min

Descr Win length Fail length
0: marker 1kb+100bp
1: Pr3t 1138bp 315bp
2: Pr3t 1138bp 315bp
3: Pr3t 1138bp 315bp
4: Pr3t 1138bp 315bp
5: Pr3t 1138bp 315bp
6: nhaA+ E0240 1396bp 512bp
7: nhaA+ E0240 1396bp 512bp
8: nhaA+ E0240 1396bp 512bp
9: Positive Control E0240 1113bp 250bp
10: Negative Control 0bp Contamination~1400bp
11: marker 1kb+100bp


Comment:

  • all of those bands are fail. It means that nhaA+E0240 didn't ligate well.
  • DO the ligation again?


Experiment of oscillator biobrick parts (30) 2009/08/28

NYMU 2009 08 28 oscillator part(31).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 29min

Descr Win length Fail length
0: marker 1kb+100bp
1: Pr3t 1138bp 315bp
2: Pr3t 1138bp 315bp
3: Pr3t 1138bp 315bp
4: Pr3t 1138bp 315bp
5: Pr3t 1138bp 315bp
6: Pr3t 1138bp 315bp
7: Ar2t 749bp 292bp
8: Ar2t 749bp 292bp
9: Positive Control E0240 1113bp 250bp
10: Negative Control 0bp
11: marker 1kb+100bp


Comments:

  • It is great progress that we have finally done the ligation of the Ar2t. Doing the liquid this time, including correct one and fail one.
  • Pr3t is correct. Doing the liquid culture tomorrow from the checking plate 090828.


Experiment of oscillator biobrick parts (31) 2009/08/31

NYMU 2009 08 31 oscillator part(32).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: Ar2t<Er7t 1689bp 749bp
2: Ar2t<Er7t 1689bp 749bp
3: Ar2t<Er7t 1689bp 749bp
4: Ar2t<Er7t 1689bp 749bp
5: Ar2t<Er7t 1689bp 749bp
6: Ar2t<Er7t 1689bp 749bp
7: Ar2t<Er7t 1689bp 749bp
8: Ar2t<Er7t 1689bp 749bp
9: Positive Control E0240 1113bp 250bp
10: Negative Control 0bp Contamination~700bp
11: marker 1kb+100bp


Comments:

  • Because the ligation is fail, I restarted from the ligation again. I changed the protocol, which I used 5.5uL inserted DNA instead of using 4uL inserted DNA.
  • Since there are still have colony on the plate, we will run colony PCR again with the ligation I did today(L<r7t and Ar2t<Er7t.


Experiment of oscillator biobrick parts (32) Gel Extraction 2009/08/31

NYMU 2009 08 31 oscillator part(33).png


2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: 4t 584bp 447bp
2: 4t 584bp 447bp
3: 4t 584bp 447bp
4: 4t 584bp 447bp
5: r2t 475bp 38bp
6: r2t 475bp 38bp
7: r2t 475bp 38bp
8: r2t 475bp 38bp
9: marker 1kb+100bp


Comments:

  • The failure of 4t is due to the digestion, so we have to digest it again.
  • r2t is fine, so we have extract them from the gel.


Experiment of oscillator biobrick parts (33) 2009/09/01

NYMU 2009 09 01 oscillator part(34).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 29in

Descr Win length Fail length
0: marker 1kb+100bp
1: Ar2t<Er7t(090830 ligation) 1689bp 749bp
2: Ar2t<Er7t(090830 ligation) 1689bp 749bp
3: Ar2t<Er7t(090830 ligation) 1689bp 749bp
4: Ar2t<Er7t(090830 ligation) 1689bp 749bp
5: Ar2t<Er7t(090830 ligation) 1689bp 749bp
6: Ar2t<Er7t(090830 ligation) 1689bp 749bp
7: Ar2t<Er7t(090830 ligation) 1689bp 749bp
8: L<r2t 895bp 438bp
9: L<r2t 895bp 438bp
10: L<r2t 895bp 438bp
11: L<r2t 895bp 438bp
12: L<r2t 895bp 438bp
13: L<r2t 895bp 438bp
14: L<r2t 895bp 438bp
15: Ar2t<Er7t(090831 ligation) 1689bp 749bp
16: Ar2t<Er7t(090831 ligation) 1689bp 749bp
17: Ar2t<Er7t(090831 ligation) 1689bp 749bp
18: Ar2t<Er7t(090831 ligation) 1689bp 749bp
19: Ar2t<Er7t(090831 ligation) 1689bp 749bp
20: Ar2t<Er7t(090831 ligation) 1689bp 749bp
21: Ar2t<Er7t(090831 ligation) 1689bp 749bp
22: Positive Control E0240 1114bp 238bp
23: Negative Control 0bp contamination~250,1400bp
24: marker 1kb+100bp


Comments:

  • Liquid incubation should be done by the next day.
  • I have do the liquid of the 9 and 19. Only 19 is correct. I will do the Digestion and Ligation tomorrow.



Experiment of oscillator biobrick parts (34) Gel Extraction 2009/09/02

NYMU 2009 09 02 oscillator part(35).png


2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: Ar2tEr7t 1476bp 537bp
2: Ar2tEr7t 1476bp 537bp
3: Ar2tEr7t 1476bp 537bp
4: Ar2t 537bp 80bp
5: Ar2t 537bp 80bp
6: Ar2t 537bp 80bp
7: marker 1kb+100bp


Comments:

  • The failure of Ar2t is strange, maybe it is that I put too much DNA in the digestion.
  • Ar2tEr7t is not digested well, next time we should not put too much DNA.
  • concentration measurement before the digestion



Experiment of oscillator biobrick parts (35) 2009/09/03

NYMU 2009 09 03 oscillator part(36).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 140s
3. 72oC: 300s
2% agarose, 100V, 29min

Descr Win length Fail length
0: marker 1kb+100bp
1: Er3t<Ar2tEr7t 2567bp 1109bp
2: Er3t<Ar2tEr7t 2567bp 1109bp
3: Er3t<Ar2tEr7t 2567bp 1109bp
4: Er3t<Ar2tEr7t 2567bp 1109bp
5: Er3t<Ar2tEr7t 2567bp 1109bp
6: Er3t<Ar2tEr7t 2567bp 1109bp
7: Er3t<Ar2tEr7t 2567bp 1109bp
8: Er3t<Ar2tEr7t 2567bp 1109bp
9: Positive Control E0240 1113bp 250bp
10: Negative Control 0bp Contamination~290bp,1300bp,1400bp
11: marker 1kb+100bp


Comments:

  • There is a lot of contamination in the negative control. We speculated that it might be due to buffer since that eyelight used the old taq and buffer.
  • The length seems to be right, but it is still need to be measured by GFP machine to check if it could be oscillate.


Experiment of oscillator biobrick parts (36) Gel Extraction 2009/09/03

NYMU 2009 09 03 oscillator part(37).png


2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 1kb+100bp
1: Ar2t(8-2) 537bp 80bp
2: Ar2t(8-2) 537bp 80bp
3: Ar2t(8-2) 537bp 80bp
4: Er3t 897bp 74bp
5: Er3t 897bp 74bp
6: Er3t 897bp 74bp
7: -
8: 4t 584bp 447bp
9: 4t 584bp 447bp
10: 4t 584bp 447bp
11: marker 1kb+100bp


Comments:

  • Ar2t still fails. Er3t is the one that we are trying to ligate with Ar2t.


Experiment of oscillator biobrick parts (37) 2009/09/04

NYMU 2009 09 04 oscillator part(38).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 110s
3. 72oC: 300s
2% agarose, 100V, 29in

Descr Win length Fail length
0: marker 1kb+100bp
1: Lr2t<Er7t 1834bp 895bp
2: Lr2t<Er7t 1834bp 895bp
3: Lr2t<Er7t 1834bp 895bp
4: Lr2t<Er7t 1834bp 895bp
5: Lr2t<Er7t 1834bp 895bp
6: P<r2t 772bp 315bp
7: P<r2t 772bp 315bp
8: P<r2t 772bp 315bp
9: P<r2t 772bp 315bp
10: P<r2t 772bp 315bp
11: Ar2t<Er3t 1628bp 749bp
12: Ar2t<Er3t 1628bp 749bp
13: Ar2t<Er3t 1628bp 749bp
14: Ar2t<Er3t 1628bp 749bp
15: Ar2t<Er3t 1628bp 749bp
16: r<4t 816bp 250bp
17: r<4t 816bp 250bp
18: r<4t 816bp 250bp
19: r<4t 816bp 250bp
20: r<4t 816bp 250bp
21: r<4t 816bp 250bp
22: Positive Control E0240 1114bp 238bp
23: Negative Control 0bp
24: marker 1kb+100bp


Comments

  • There is no contamination since I use the old buffer and enzyme. In addition, I change to use new dNTP and I speculated the contamination might be due to new buffer.
  • Need to make liquid incubation by using checking plate


Experiment of oscillator biobrick parts (38) Gel Extraction 2009/09/09

NYMU 2009 09 09 oscillator part(39).png


2% agarose, 100V, 28min

Descr Win length Fail length
0: marker 100bp
1: marker 1kb
2: r4t 604bp 38bp
3: r4t 604bp 38bp
4: r4t 604bp 38bp
5: -
6: Ar2tEr7t 707bp  ?bp
7: Er3tAr2tEr7t 707bp  ?bp
8: marker 1kb
9: marker 100bp


Comments:

  • r4t is correct though it is not digested well enough.



Experiment of oscillator biobrick parts (39) 2009/09/11

NYMU 2009 09 11 oscillator part(40).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 110s
3. 72oC: 300s
2% agarose, 100V, 28in

Descr Win length Fail length
0: marker 1kb+100bp
1: A<r4t 878bp 292bp
2: E<r4t 872bp 286bp
3: E<r4t 872bp 286bp
4: E<r4t 872bp 286bp
5: E<r4t 872bp 286bp
6: E<r4t 872bp 286bp
7: E<r4t 872bp 286bp
8: Pr2t<Er7t 1712bp 772bp
9: Pr2t<Er7t 1712bp 772bp
10: Pr2t<Er7t 1712bp 772bp
11: Pr2t<Er7t 1712bp 772bp
12: Pr2t<Er7t 1712bp 772bp
13: Pr2t<Er7t 1712bp 772bp
14: Positive Control E0240 1114bp 238bp
15: Negative Control 0bp
16: marker 1kb+100bp


Comments

  • It is awful that the plate of Ar4t only have one colony on it. Maybe it is due to the bad digestion of pTet(A). Should the experiment be started from the digestion of pTet or ligation?
  • Pr2t<Er7t could do the colony PCR again to check if there are another correct colony.



Experiment of oscillator biobrick parts (40) 2009/09/15

NYMU 2009 09 15 oscillator part(41).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 100s
3. 72oC: 300s
2% agarose, 100V, 29in

Descr Win length Fail length
0: marker 1kb+100bp
1: Pr2t<Er7t 1712bp 772bp
2: Pr2t<Er7t 1712bp 772bp
3: Pr2t<Er7t 1712bp 772bp
4: Pr2t<Er7t 1712bp 772bp
5: Pr2t<Er7t 1712bp 772bp
6: A<r4t 878bp 292bp
7: A<r4t 878bp 292bp
8: A<r4t 878bp 292bp
9: Positive Control E0240 1114bp 238bp
10: Negative Control 0bp contamination~700bp
11: marker 1kb+100bp


Comments:

  • Redo the colony PCR again and use more colony to check if there is a correct colony.
  • Lane 5 is strange, maybe it is the P<Er7t because the r2t hasn't been ligated correctly.
  • Ar4t keeps fail, however there are some small colony we can pick up.



Experiment of oscillator biobrick parts (41) 2009/09/17

NYMU 2009 09 17 oscillator part(42).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 110s
72oC: 100s
3. 72oC: 300s
2% agarose, 100V, 29in

Descr Win length Fail length
0: marker 1kb+100bp
1: A<r4t 878bp 292bp
2: A<r4t 878bp 292bp
3: A<r4t 878bp 292bp
4: A<r4t 878bp 292bp
5: A<r4t 878bp 292bp
6: A<r4t 878bp 292bp
7: A<r4t 878bp 292bp
8: A<r4t 878bp 292bp
9: A<r4t 878bp 292bp
10: A<r4t 878bp 292bp
11: A<r4t 878bp 292bp
12: Pr2t<Er7t 1712bp 772bp
13: Pr2t<Er7t 1712bp 772bp
14: Pr2t<Er7t 1712bp 772bp
15: Pr2t<Er7t 1712bp 772bp
16: Pr2t<Er7t 1712bp 772bp
17: Pr2t<Er7t 1712bp 772bp
18: Pr2t<Er7t 1712bp 772bp
19: Pr2t<Er7t 1712bp 772bp
20: Pr2t<Er7t 1712bp 772bp
21: Pr2t<Er7t 1712bp 772bp
22: Positive Control E0240 1114bp 238bp
23: Negative Control 0bp contamination~300bp,700bp
24: marker 1kb+100bp


Comments:


Experiment of oscillator biobrick parts (42) 2009/09/18

NYMU 2009 09 18 oscillator part(43).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 40s
3. 72oC: 300s
2% agarose, 100V, 28in

Descr Win length Fail length
0: marker 1kb+100bp
1: pLuxR 293bp 238bp
2: pLuxR 293bp 238bp
3: pCI 287bp 238bp
4: pCI 287bp 238bp
5: p22 292bp 238bp
6: p22 292bp 238bp
7: pLasR 395bp 238bp
8: pLasR 395bp 238bp
9: Positive Control Term 445bp 316bp
10: Negative Control 0bp contamination~700bp
11: marker 1kb+100bp


Experiment of oscillator biobrick parts (43) 2009/09/22

NYMU 2009 09 22 oscillator part(44).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 70s
3. 72oC: 300s
2% agarose, 100V, 28in

Descr Win length Fail length
0: marker 100bp
1: p22+r7t 1175bp 292bp
2: p22+r7t 1175bp 292bp
3: p22+r7t 1175bp 292bp
4: p22+r7t 1175bp 292bp
5: pLuxR+r7t 1176bp 293bp
6: pLuxR+r7t 1176bp 293bp
7: pLuxR+r7t 1176bp 293bp
8: pLuxR+r7t 1176bp 293bp
9: Positive Control E0240 1114bp 238bp
10: Negative Control 0bp
11: marker 100bp


Experiment of oscillator biobrick parts (44) 2009/09/24

NYMU 2009 09 24 oscillator part(45).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28in

Descr Win length Fail length
0: marker 100bp
1: pLuxR+r7t 1176bp 293bp
2: pLuxR+r7t 1176bp 293bp
3: pLuxR+r7t 1176bp 293bp
4: pCI+r7t 1170bp 287bp
5: pLasR+r7t 1278bp 395bp
6: pLasR+r7t 1278bp 395bp
7: pLasR+r7t 1278bp 395bp
8: pLasR+r7t 1278bp 395bp
9: Positive Control E0240 1114bp 238bp
10: Negative Control 0bp contamination~1100bp
11: marker 100bp


Comments:

  • It is strange that the colony of pCI+r7t is glowing obviously, but the length seems to be wrong.


Experiment of oscillator biobrick parts (45) (Gel Extraction) 2009/09/28

NYMU 2009 09 28 oscillator part(46).png


2% agarose, 100V, 30min

Descr Win length Fail length
0: marker 1kb+100bp
1: Pr2tEr7t-18 1500bp 560bp
2: Pr2tEr7t-18 1500bp 560bp
3: Pr2tEr7t-18 1500bp 560bp
4: Pr2tEr7t-19 1500bp 560bp
5: Pr2tEr7t-19 1500bp 560bp
6: Pr2tEr7t-19 1500bp 560bp
7: unknown 841bp 38bp
8: unknown 841bp 38bp
9: unknown 841bp 38bp
10: unknown 841bp 38bp
11: marker 1kb+100bp



Experiment of oscillator biobrick parts (46) 2009/10/17

NYMU 2009 10 17 oscillator part(47).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 28in

Descr Win length Fail length
0: marker 100bp
1: Er4t<Pr2t 1414bp 872bp
2: Er4t<Pr2t 1414bp 872bp
3: Er4t<Pr2t 1414bp 872bp
4: Er4t<Pr2t 1414bp 872bp
5: Er4t<Pr2t 1414bp 872bp
6: Er4t<Pr2t 1414bp 872bp
7: Er4t<Pr2t 1414bp 872bp
8: Er4t<Pr2t 1414bp 872bp
9: Positive Control Lr7t 1321bp 438bp
10: Negative Control 0bp contamination~1100bp
11: marker 100bp


Experiment of oscillator biobrick parts (47) 2009/10/18

NYMU 2009 10 18 oscillator part(48).png


Mix: 50μl
template 1μl
forward primer VF2 1μl
reverse primer VR 1μl
dNTP 2μl
10x buffer 5μl
taq 0.25μl
ddH20 39.75 μl
Protocol:
1. 94oC: 60s
2.
30 cycles 		94oC: 15s
55oC: 20s
72oC: 80s
3. 72oC: 300s
2% agarose, 100V, 30in

Descr Win length Fail length
0: marker 100bp
1: marker 1kb
2: Ar4t<Pr3t 1786bp 878bp
3: Ar4t<Pr3t 1786bp 878bp
4: Ar4t<Pr3t 1786bp 878bp
5: Er4t<Pr2t 1414bp 872bp
6: Er4t<Pr2t 1414bp 872bp
7: Er4t<Pr2t 1414bp 872bp
8: Er4t<Pr2t 1414bp 872bp
9: Er4t<Pr2t 1414bp 872bp
10: Er4t<Pr2t 1414bp 872bp
11: Er4t<Pr2t 1414bp 872bp
12: Er4t<Pr2t 1414bp 872bp
13: Er4t<Pr2t 1414bp 872bp
14: Positive Control Ar7t 1175bp 292bp
15: Negative Control 0bp contamination~1100bp
16: Negative Control 0bp contamination~1100bp
17: marker 1kb
18: marker 100bp
Retrieved from "http://2009.igem.org/Team:NYMU-Taipei/Project/Lab_Note"