

(Difference between revisions)
(Preparing inserts)
(27 intermediate revisions not shown)
Line 1: Line 1:
          height: 1550px;
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana">
===Preparing inserts===
=Our BioBricks=
We have contributed to the Registry with [ a set of parts], but one of them outstands all the others: [ aequorin]. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca<sup>2+</sup> to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca<sup>2+</sup>. There are some works that use aequorin to sense Ca<sup>2+</sup>, but we have tamed the protein to emit light whenever we want with the activation through electric current.
Total DNA was extracted from our yeast strains.<br>
A thorough characterization has been made and can be found either at the [ corresponding page] in this wiki or at the [ Registry].
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br>
Firstly, aequorin sequence is:<br>
Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.
1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt<br>
61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt<br>
121 gacgagatgg tctacaaggc atctgatatt gtcatcaata accttggagc aacacctgag<br>
181 caagccaaac gacacaaaga tgctgtagga gccttcttcg gaggagctgg aatgaaatat<br>
241 ggtgtggaaa ctgattggcc tgcatacatt gaaggatgga aaaaattggc tactgatgaa<br>
a 3D model of [ aequorin], our outstanding BioBrick contribution to the Registry.
301 ttggagaaat acgccaaaaa cgaaccaacg ctcatccgta tatggggtga tgctttgttt<br>
361 gatatcgttg acaaagatca aaatggagct attacactgg atgaatggaa agcatacacc<br>
421 aaagctgctg gtatcatcca atcatcagaa gattgcgagg aaacatccag agtgtgcgat<br>
481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg<br>
541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a<br>
And our oligos (EcoRI and XbaI sites in bold) were:<br>
Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’<br>
Reverse: 5’tactagtagcggccgctgcagttaggggac 3’<br>
PCR was conducted as follows:<br>
<ol>A first denaturation cycle
<ol>94º 3'</ol>
Followed by 30 amplification cycles:
<ol>94º 30''
55º 1'
72º 1'</ol>
And a final extension step:
<ol>72º 7'</ol>
1 = wt (1 microlitre)<br>
2 = wt (2 microlitres)<br>
3 = Cch1 (1 microlitre)<br>
4 = Mid1 (1 microlitre)<br>
5 = Negative Control<br>
6 = Possitive Control<br>
(We used the same MWM)<br>
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br>
Amplicons were digested (H buffer) with EcoRI y XbaI.<br>

Latest revision as of 23:24, 21 October 2009

Our BioBricks

We have contributed to the Registry with a set of parts, but one of them outstands all the others: aequorin. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca2+ to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca2+. There are some works that use aequorin to sense Ca2+, but we have tamed the protein to emit light whenever we want with the activation through electric current.

A thorough characterization has been made and can be found either at the corresponding page in this wiki or at the Registry.

Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.


a 3D model of aequorin, our outstanding BioBrick contribution to the Registry.