Team:Valencia/Parts

From 2009.igem.org

(Difference between revisions)
(Preparing inserts)
 
(26 intermediate revisions not shown)
Line 1: Line 1:
-
{{Template:Valencia09iGEM2}}
+
{{Template:Valencia09iGEM23}}
 +
<html>
 +
<style>
 +
#content{
 +
          height: 1550px;
 +
        }
 +
</style>
 +
</html>
 +
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana">
 +
<br>
-
===Preparing inserts===
+
=Our BioBricks=
 +
<br>
 +
We have contributed to the Registry with [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 a set of parts], but one of them outstands all the others: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 aequorin]. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca<sup>2+</sup> to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca<sup>2+</sup>. There are some works that use aequorin to sense Ca<sup>2+</sup>, but we have tamed the protein to emit light whenever we want with the activation through electric current.
-
Total DNA was extracted from our yeast strains.<br>
+
A thorough characterization has been made and can be found either at the [https://2009.igem.org/Team:Valencia/Parts/Characterization corresponding page] in this wiki or at the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 Registry].
-
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br>
+
-
 
+
Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.
-
 
+
<br>
-
Firstly, aequorin sequence is:<br>
+
<br>
-
 
+
<center>[http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 https://static.igem.org/mediawiki/2009/3/35/Aequorin.GIF]
-
1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt<br>
+
<br>
-
61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt<br>
+
a 3D model of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 aequorin], our outstanding BioBrick contribution to the Registry.
-
121 gacgagatgg tctacaaggc atctgatatt gtcatcaata accttggagc aacacctgag<br>
+
</center>
-
181 caagccaaac gacacaaaga tgctgtagga gccttcttcg gaggagctgg aatgaaatat<br>
+
-
241 ggtgtggaaa ctgattggcc tgcatacatt gaaggatgga aaaaattggc tactgatgaa<br>
+
-
301 ttggagaaat acgccaaaaa cgaaccaacg ctcatccgta tatggggtga tgctttgttt<br>
+
-
361 gatatcgttg acaaagatca aaatggagct attacactgg atgaatggaa agcatacacc<br>
+
-
421 aaagctgctg gtatcatcca atcatcagaa gattgcgagg aaacatccag agtgtgcgat<br>
+
-
481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg<br>
+
-
541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a<br>
+
-
 
+
-
 
+
-
 
+
-
And our oligos (EcoRI and XbaI sites in bold) were:<br>
+
-
Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’<br>
+
-
Reverse: 5’tactagtagcggccgctgcagttaggggac 3’<br>
+
-
 
+
-
 
+
-
+
-
 
+
-
PCR was conducted as follows:<br>
+
-
 
+
-
<ol>A first denaturation cycle
+
-
<ol>94º 3'</ol>
+
-
Followed by 30 amplification cycles:
+
-
<ol>94º 30''
+
-
55º 1'
+
-
72º 1'</ol>
+
-
And a final extension step:
+
-
<ol>72º 7'</ol>
+
-
</ol>
+
-
 
+
-
 
+
-
'''Results:'''<br>
+
-
 
+
-
[[Image:.jpg]]<br>
+
-
 
+
-
1 = wt (1 microlitre)<br>
+
-
2 = wt (2 microlitres)<br>
+
-
3 = Cch1 (1 microlitre)<br>
+
-
4 = Mid1 (1 microlitre)<br>
+
-
5 = Negative Control<br>
+
-
6 = Possitive Control<br>
+
-
(We used the same MWM)<br>
+
-
 
+
-
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br>
+
-
 
+
-
Amplicons were digested (H buffer) with EcoRI y XbaI.<br>
+

Latest revision as of 23:24, 21 October 2009



Our BioBricks


We have contributed to the Registry with a set of parts, but one of them outstands all the others: aequorin. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca2+ to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca2+. There are some works that use aequorin to sense Ca2+, but we have tamed the protein to emit light whenever we want with the activation through electric current.

A thorough characterization has been made and can be found either at the corresponding page in this wiki or at the Registry.

Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.

Aequorin.GIF


a 3D model of aequorin, our outstanding BioBrick contribution to the Registry.