

(Difference between revisions)
(24 intermediate revisions not shown)
Line 1: Line 1:
          height: 1550px;
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana">
===Preparing inserts===
=Our BioBricks=
We have contributed to the Registry with [ a set of parts], but one of them outstands all the others: [ aequorin]. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca<sup>2+</sup> to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca<sup>2+</sup>. There are some works that use aequorin to sense Ca<sup>2+</sup>, but we have tamed the protein to emit light whenever we want with the activation through electric current.
Total DNA was extracted from our yeast strains.<br>
A thorough characterization has been made and can be found either at the [ corresponding page] in this wiki or at the [ Registry].
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br>
Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.
And our oligos (EcoRI and XbaI sites in bold) were:<br>
Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’<br>
Reverse: 5’tactagtagcggccgctgcagttaggggac 3’<br>
a 3D model of [ aequorin], our outstanding BioBrick contribution to the Registry.
PCR was conducted as follows:<br>
<ol>A first denaturation cycle
<ol>94º 3min</ol>
Followed by 30 amplification cycles:
<ol>94º 30s<br>
55º 1min<br>
72º 1min<br></ol>
And a final extension step:
<ol>72º 7min</ol>
1 = wt (1 microlitre)<br>
2 = wt (2 microlitres)<br>
3 = Cch1 (1 microlitre)<br>
4 = Mid1 (1 microlitre)<br>
5 = Negative Control<br>
6 = Possitive Control<br>
(We used the same MWM)<br>
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br>
Amplicons were digested (H buffer) with EcoRI y XbaI.<br>
===Preparing vectors===
Competent cells were transformed with: <br>
Plasmids were extracted (High pure miniprep plasmid isolation kit ROCHE) <br>
Plasmid were digested with EcoRI and XbaI<br>
===Ligating Biobricks into plasmids===
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br>
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br>
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br>
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br>

Latest revision as of 23:24, 21 October 2009

Our BioBricks

We have contributed to the Registry with a set of parts, but one of them outstands all the others: aequorin. This reporter protein needs a prosthetic group, coelenterazine, and citoplasmic Ca2+ to work. This means that light is only emitted whenever the researcher uses coelenterazine and whenever there is a media full of Ca2+. There are some works that use aequorin to sense Ca2+, but we have tamed the protein to emit light whenever we want with the activation through electric current.

A thorough characterization has been made and can be found either at the corresponding page in this wiki or at the Registry.

Additionally, we have used a collection of knock outs in order to have genetic negative control that help us confirm that the light effect is not an artifact.


a 3D model of aequorin, our outstanding BioBrick contribution to the Registry.