"

 

From 2009.igem.org

You do not have permission to edit this page, for the following reason:

You can view and copy the source of this page:

[[image:NYMU Wt--rev.png]] {{:Team:NYMU-Taipei/Header}} == Motivation == Our engineered ''E. coli'' (ViroCatcher) is designed to trap the viruses and successfully prevents viruses spreading out in our bodies. If we remove ViroCatcher, viruses will be cleaned up together as well with our ViroCatcher. To remove viruses, we must work out a method for ''E. coli'' removal. For removing ViroCatcher, we have two choices. One is to let it suicide, and the other is to let it be removed by our immune cells (like how dead cells are removed). Before removal, we must be sure that the intended work is done, and viruses must be removed at the same time. Therefore, we designed a removal gene and included it in ViroCatcher. If ViroCatcher gets the signal of binding with viral proteins, it will turn on the removal gene and be removed. Furthermore, if ViroCatcher did not catch anything, we still have to design a mechanism to let our ViroCatcher express the removal gene and remove itself. Otherwise, bacteria will fill our blood vessels and block blood flow. == Selecting the Removal Gene == We had considered the following three removal genes. In the end, we chose to use the expression of LPS. === Cell Suicide Generator === <br>[[image:NYMU 1.jpg]] *The CcdB protein, constitutively expressed by P1010, is lethal to most of the BioBrick cell strains, only DB3.1 is resistant[5]. A hybrid promoter controls the production of LuxR and ccdB. The promoter is activated by HSL-LuxR complex and repressed by P22 c2. The LuxR coding region is preceded by a strong RBS and followed by a bad terminator (60% efficiency). This means there is read through into the ccdB coding region which can be translated from a very weak RBS. If the P22 c2 repressor is absent, there should be a strong enough LuxR background to allow autoactivation if HSL is added. The amound of ccdB should be sublethal as long as there is no significant activation[6]. The most simple way to get rid of the ''E. coli'' is to let it suicide, however, there are many viruses that have been caught on the surface that we have to pay attention to. If ViroCatcher dies or explodes, the trapped viruses will spread into our bloodstream again. Cell Suicide Generator seems not to be a good choice. {{:Team:NYMU-Taipei/Part4|Cell suicide generator|= |R|R0034||= |C|K145151|ccdB|= |T|B0010||= |T|B0012||}} === Macrophage Inflammatory Proteins === <br>[[image:NYMU 2.jpg]] * Macrophage Inflammatory Proteins (MIP) belong to the family of chemotactic cytokines known as chemokines[13]. In humans, there are two major forms, MIP-1α and MIP-1β that are now officially named CCL3 and CCL4 respectively. Both are major factors produced by macrophages after they are stimulated with bacterial endotoxins[1]. They activate human granulocytes (neutrophils, eosinophils and basophils) which can lead to acute neutrophilic inflammation. They also induce the synthesis and release other pro-inflammatory cytokines such as interleukin 1 (IL-1), IL-6 and TNF-α from fibroblasts and macrophages. The genes for CCL3 and CCL4 are both located on human chromosome 17[2]. ** Chemokine (C-C motif) ligand 3, also known as CCL3, is a human gene. Macrophage inflammatory protein-1 is a so-called monokine that is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes (Wolpe et al., 1988). Sherry et al. (1988) demonstrated 2 protein components of MIP1, called by them alpha and beta[supplied by OMIM][1][10]. ** CCL4 is a CC chemokine with specificity for CCR5 receptors[11]. It is a chemoattractant for natural killer cells, monocytes and a variety of other immune cell [2]. CCL4 is a major HIV-suppressive factor produced by CD8+ T cells [3]. Perforin-low memory CD8+ T cells that normally synthesize MIP-1-beta [4].<br>[[image:Chemokine_concentration_chemotaxis.jpg]]<br> ** The main function of chemokines is the induction of cell migration[12]. Cells will move toward the direction of increment of continuous chemokine concentration gradient. In other words, cells migrate toward the source of chemokine. For example, the induction of lymphocyte to the lymphatic node is due to chemokines. Apply this thinking to our design, we want to use CCL3 and CCL4, or chemokines for macrophages, to assemble macrophages around ViroCatcher. It will raise the possibility that macrophages recognize the proteins of viruses and swallow the ''E. coli'' whole.<br> But there's a problem. CCL3 and CCL4 is two kinds of ligands of receptors of antibody. If we use this design, ViroCatchers will bind with each other, aggregate together, and block our blood vessels. So unfortunately, this design still cannot be used as the removal circuit. === Expression of LPS === <br>[[image:NYMU 3.jpg]] * In the [[Team:NYMU-Taipei/Project/Chassis|Chassis]] part of our project, we have mentioned that ViroCatcher is a LPS[7] knock-out stain, in order to avoid the detection by the immune system. Therefore, if we re-express LPS, our ViroCatcher will have the ability to attract immune cells and let immune system macrophage remove ViroCatcher itself along with the viruses bound to the surface[8][9]. To express LPS again in ViroCatcher, we just have to turn on ''msbB'' gene. ==== Homo sapiens chemokine (C-C motif) ligand 3, mRNA (cDNA clone MGC:198546 IMAGE:9054485), complete cds[http://www.ncbi.nlm.nih.gov/nuccore/219521699] ==== 1 acactcgagc ccacattccg tcacctgctc agaatcatgc aggtctccac tgctgccctt 61 gctgtcctcc tctgcaccat ggctctctgc aaccagttct ctgcatcact tgctgctgac 121 acgccgaccg cctgctgctt cagctacacc tcccggcaga ttccacagaa tttcatagct 181 gactactttg agacgagcag ccagtgctcc aagcctggtg tcatcttcct aaccaagcga 241 agccggcagg tctgtgctga ccccagtgag gagtgggtcc agaaatatgt cagcgacctg 301 gagctgagtg cctgaggggt ccagaagctt cgaggcccag cgacctcggt gggcccagtg 361 gggaggagca ggagcctgag ccttgggaac atgcgtgtga cctccacagc tacctcttct 421 atggactggt tgttgccaaa cagccacact gtgggactct tcttaactta aattttaatt 481 tatttatact atttagtttt tgtaatttat tttcgatttc acagtgtgtt tgtgattgtt 541 tgctctgaga gttccccctg tcccctc ==== Homo sapiens chemokine (C-C motif) ligand 4, mRNA (cDNA clone MGC:126026 IMAGE:40032172), complete cds [http://www.ncbi.nlm.nih.gov/nuccore/74355495]==== 1 cacagctggg ttctgaagct tctgagttct gcagcctcac ctctgagaaa acctcttttc 61 caccaatacc atgaagctct gcgtgactgt cctgtctctc ctcatgctag tagctgcctt 121 ctgctctcca gcgctctcag caccaatggg ctcagaccct cccaccgcct gctgcttttc 181 ttacaccgcg aggaagcttc ctcgcaactt tgtggtagat tactatgaga ccagcagcct 241 ctgctcccag ccagctgtgg tattccaaac caaaagaagc aagcaagtct gtgctgatcc 301 cagtgagacc tgggtccagg agtacgtgta tgacctggaa ctgaactgag ctgctcagag 361 acaggaagtc ttcagggaag gtcacctgag cccggatgct tctccatgag acacatctcc 421 tccatactca ggactcctct ccgcagttcc tgtcccttct cttaatttaa tcttttttat 481 gtgccgtgtt attgtattag ==== Escherichia coli K-12 substr. MG1655 msbB gene sequence[http://biocyc.org/ECOLI/sequence-rc?type=GENE&object=EG10614] ==== 1 atgGAAACGA AAAAAAATAA TAGCGAATAC ATTCCTGAGT TTGATAAATC CTTTCGCCAC 61 CCGCGCTACT GGGGAGCATG GCTGGGCGTA GCAGCGATGG CGGGTATCGC TTTAACGCCG 121 CCAAAGTTCC GTGATCCCAT TCTGGCACGG CTGGGACGTT TTGCCGGACG ACTGGGAAAA 181 AGCTCACGCC GTCGTGCGTT AATCAATCTG TCGCTCTGCT TTCCAGAACG TAGTGAAGCT 241 GAACGCGAAG CGATTGTTGA TGAGATGTTT GCCACCGCGC CGCAAGCGAT GGCAATGATG 301 GCTGAGTTGG CAATACGCGG GCCGGAGAAA ATTCAGCCGC GCGTTGACTG GCAAGGGCTG 361 GAGATCATCG AAGAGATGCG GCGTAATAAC GAGAAAGTTA TCTTTCTGGT GCCGCACGGT 421 TGGGCCGTCG ATATTCCTGC CATGCTGATG GCCTCGCAAG GGCAGAAAAT GGCAGCGATG 481 TTCCATAATC AGGGCAACCC GGTTTTTGAT TATGTCTGGA ACACGGTGCG TCGTCGCTTT 541 GGCGGTCGTC TGCATGCGAG AAATGACGGT ATTAAACCAT TCATCCAGTC GGTACGTCAG 601 GGGTACTGGG GATATTATTT ACCCGATCAG GATCATGGCC CAGAGCACAG CGAATTTGTG 661 GATTTCTTTG CCACCTATAA AGCGACGTTG CCCGCGATTG GTCGTTTGAT GAAAGTGTGC 721 CGTGCGCGCG TTGTACCGCT GTTTCCGATT TATGATGGCA AGACGCATCG TCTGACGATT 781 CAGGTGCGCC CACCGATGGA TGATCTGTTA GAGGCGGATG ATCATACGAT TGCGCGGCGG 841 ATGAATGAAG AAGTCGAGAT TTTTGTTGGT CCGCGACCAG AACAATACAC CTGGATACTA 901 AAATTGCTGA AAACTCGCAA ACCGGGCGAA ATCCAGCCGT ATAAGCGCAA AGATCTTTAT 961 CCCATCAAAT AA *Primer Design gaattcgcggccgcttctag atgGAAACGAAAAAAAATAATAGCGAA 55deg GC:26% length:27bp ctgcagcggccgctactagta TTATTTGATGGGATAAAGATCTTTGC 54deg GC:31% length:26bp == Goals == There are two specific aims for the removal part. One is ViroCatcher binding to viruses and being removed, and the other is self-removal after a specified period of time. Since the gene msbB of LPS is knocked out, if there is an insertion of msbB gene into the plasmid, then msbB gene and the LPS functions will express. Once the LPS is expressed, the immune system is turned on and ViroCatcher is swallowed by macrophage through phagocytosis along with many viruses attached. If the machine catches nothing, it is still necessary to remove the ''E. coli'' machine after a period of time. This period of time should be controlled precisely, otherwise the machine will be removed before it catches any viruses. We compose an oscillator and a toggle switch together as our timer. == Removal Design == === Removal for Binding Viruses === Mentioned before at [[Team:NYMU-Taipei/Project/Signal Transduction|Signal]], an output promoter called ompC promoter will be inactivate through the way of the signal transduction of binding with viruses. If we use a promoter inhibited by the ompC promoter output protein, when ompC inactivated, the gene we want to express will tun on. Therefore, we come out this design: [[image:NYMU 5.jpg]] Use the tetR promoter as a switch for the msbB gene. If the receptor catches a virus, TetR protein will stop expressing, and the pTet promoter will turn on msbB gene, then LPS will be expressed and it will attract the immune system. ViroCatcher will then be cleaned up by immune cells together with the trapped viruses. === Timed Removal === If the receptor does not catch anything, the ompC promoter will not be turned on, and the removal gene will not be expressed, so ViroCatcher cannot be removed when it catches nothing. How to make sure our Viro Catcher is removed from the human body? We worked out this set of design: [[image:NYMU 4.jpg]] This circuit is composed of three parts - oscillator, toggle switch, and remover. Oscillator and toggle switch work together as the timer. The oscillator is consist of two genes. One gene activate the other gene and get a negative feedback. When output proteins of oscillator reach a threshold that preset, then the promoter of toggle switch will be activate, and output protein of toggle switch will suddenly activate the promoter of remover. The following picture shows how the timer works by modeling:<br> [[image:NYMU threshold.png|350px]] We stop the timer by setting a threshold. As the protein produced by the oscillator promoter accumulates and reaches a certain threshold, the output promoter activity would suddenly change. This output promoter is connected to removal gene ''msbB''. Therefore, at the time that timer stops, LPS expressed and attract macrophages. This setting can control the micromachine to trigger an immune response after a period of time. This period of time is controlled precisely, otherwise ViroCatcher will be removed too fast or too late. Anyway, no matter what kind of situation, our ViroCatcher will be removed. == Experiment Results == ==== Lab note ==== [[Team:NYMU-Taipei/Project/Lab Note]] ====Protocol of Promoter Strength Testing==== #extract the Biobrick promoter #combine it with GFP generator {{:Team:NYMU-Taipei/BBa|I13504}} with the promoter and then transform #colony PCR #liquid incubation and plasmid extraction #measure the amount of fluroresence by using an ELISA reader with a 96 well plate #data collection #using pTet as the standard having the value of 1 #characterize the basal level expression without any inducer or repressor interaction ==== Promoter Strength Testing Reporting Assays ==== [[Team:NYMU-Taipei/Project/Promoter Strength Testing|Reporting Assay of Promoter Strength Testing]] ==== Oscillator Modeling ==== [[Team:NYMU-Taipei/Project/Removal/Modeling|Modeling]] ====Colony PCR Gel Pictures==== {| border="1" | [[image:NYMU Gel 1.png|640px]] || '''Figure 1.''' 1.pTet with generator ({{:Team:NYMU-Taipei/BBa|K195610}}) 2.pLac with generator ({{:Team:NYMU-Taipei/BBa|K195612}}) 3.pRE with generator ({{:Team:NYMU-Taipei/BBa|K195609}}) |} {| border="1" | [[image:NYMU Gel 2-1.png|640px]] || '''Figure 2.''' L1~L2 pTet with generator ({{:Team:NYMU-Taipei/BBa|K195610}}) L3~L4 pPenI with generator ({{:Team:NYMU-Taipei/BBa|K195611}}) L5~L6 pLac with generator ({{:Team:NYMU-Taipei/BBa|K195612}}) |} {| border="1" | [[image:NYMU Gel 5-1.png|640px]] || '''Figure 3.''' L1~L4 pLuxR with generator ({{:Team:NYMU-Taipei/BBa|K195615}}) L5 pCI with generator ({{:Team:NYMU-Taipei/BBa|K195613}}) L6~L8 pLasR with generator ({{:Team:NYMU-Taipei/BBa|K195616}}) |} {| border="1" | [[image:NYMU Gel 4-1.png|640px]] || '''Figure 4.''' L1~L4 p22 with generator ({{:Team:NYMU-Taipei/BBa|K195614}}) L5~L8 pLuxR with generator ({{:Team:NYMU-Taipei/BBa|K195615}}) |} {| border="1" | [[image:NYMU Gel 6-1.png|640px]] || '''Figure 5.''' L1~L6 pRE with PenI repressor gene ({{:Team:NYMU-Taipei/BBa|K195621}}) |} ====Graph of Experiments==== {| border="1" | [[image:NYMU Chart (Lr2tEr7t) without line-1.png|640px]] || '''Figure 1.''' This is the component testing with the activator CII at the downstream of pLac inducing pRE to express GFP. |} {| border="1" | [[image:NYMU Chart (oscillator) 3-1.png|640px]] || ''' Figure 2.''' This is the measurement by using an ELISA reader, graphing Fluorescence versus O.D of the Time Delay device(I) ({{:Team:NYMU-Taipei/BBa|K195622}}) |} === ''msbB'' gene PCR Results === {| border="1" | [[image:NYMU MsbB.png|640px]] || '''Figure 1.''' This gel picture shows the result of PCR by L1~L5 is the length of msbB gene. L6 is negative control. |} == References == [1]Sang Chin Lee,† Mary E. Brummet,* Syed Shahabuddin,* Thasia G. Woodworth,‡ Steve N. Georas,* Kristin M. Leiferman,§ Steven C. Gilman,‡ Cristiana Stellato,* Ron P. Gladue,‡ Robert P. Schleimer,* and Lisa A. Beck2*:'''Cutaneous Injection of Human Subjects with Macrophage Inflammatory Protein-1a Induces Significant Recruitment of Neutrophils and Monocytes1.'''The Journal of Immunology, 2000, 164: 3392–3401. <br>[2]D. HALLER,1,2* S. BLUM,3 C. BODE,1 W. P. HAMMES,2 AND E. J. SCHIFFRIN3:'''Activation of Human Peripheral Blood Mononuclear Cells by Nonpathogenic Bacteria In Vitro: Evidence of NK Cells as Primary Targets.'''2000, American Society for Microbiology<br> [3]F. Porcheray,* S. Viaud,* A.-C. Rimaniol,‡C. Léone,* B. Samah,*N. Dereuddre-Bosquet,‡D.Dormont*†and G. Gras*:'''Macrophage activation switching: an asset for the resolution of inflammation.'''doi:10.1111/j.1365-2249.2005.02934.x <br>[4]A. Hrabák1, T. Bajor2 and I. Csuka1:'''The effect of various infl ammatory agents on the phagocytosis and cytokine profi le of mouse and rat macrophages.'''Infl amm. res. 57 (2008) 75–831023-3830/08/020075-9DOI 10.1007/s00011-007-7057-7<br> [5]http://partsregistry.org/wiki/index.php/Part:BBa_P1010 <br>[6]http://partsregistry.org/Part:BBa_K145230<br> [7] [http://en.wikipedia.org/wiki/Lipopolysaccharide#Lipid_A/ LPS] <br>[8] ZHANG Hai-yu, SHAN Yu-xing, WU Ning, CHEN Guang-wei '''effect of LPS with different doses on CD14 surface expression in J774A.1 cell line''' <br>[9]Sudipta Tripathi, David Bruch and Dilip S Kittur*:'''Ginger extract inhibits LPS induced macrophage activation and function.'''2008 Tripathi et al; licensee BioMed Central Ltd.BMC Complementary and Alternative Medicine 2008, 8:1 doi:10.1186/1472-6882-8-1 <br>[10][http://en.wikipedia.org/wiki/CCL3 Chemoattractant of CCL3] <br>[11][http://en.wikipedia.org/wiki/CCL4 Chemoattractant of CCL4] <br>[12][http://en.wikipedia.org/wiki/Chemokine Chemokine] <br>[13][http://en.wikipedia.org/wiki/Macrophage_Inflammatory_Protein function of Macrophage Inflammatory Protein] {{:Team:NYMU-Taipei/Footer}}

Return to Team:NYMU-Taipei/Project/Removal.

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Privacy policy
• Disclaimers