Revision history of "Talk:Team:Waterloo/Notebook/Oligos"

From 2009.igem.org

Diff selection: mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.

Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
  • (cur | prev) 05:08, 20 October 2009 Hparikh (Talk | contribs) (3,931 bytes) (New page: {| width="100%" border="1" cellpadding="2" ! Description !! Oligo Name !! Sequence !! Length |- |BioBrick sequencing/colPCR primer (fwd) || iGEMvf2 || TGCCACCTGACGTCTAAGAA || 20 |- |BioBr...)