"

 

From 2009.igem.org

Revision as of 00:26, 20 October 2009 (view source) Abrahamavelar (Talk | contribs) ← Older edit		Revision as of 00:30, 20 October 2009 (view source) Abrahamavelar (Talk | contribs) (→Abraham's lab journal) Newer edit →
Line 12:		Line 12:
	Use 10uL of this DNA extract as template for the PCR		Use 10uL of this DNA extract as template for the PCR
		+	The mixture for the PCR
	23uL H2O		23uL H2O
	2.5uL Forward primer <br>		2.5uL Forward primer <br>

---

Revision as of 00:30, 20 October 2009

Abraham's lab journal

Protocols

Colony PCR
Take the colony and resuspend in 200uL of TE 10:1 NaCl 10M Heat the suspension for 10 minutes at 95°C Centrifugue for 2 minutes at 14000 RPM Use 10uL of this DNA extract as template for the PCR

The mixture for the PCR 23uL H2O 2.5uL Forward primer
2.5uL Reverse primer
3.5uL dNTPs
2.5uL MgCl2
5uL Buffer10X
10uL DNA template
1uL taqDNA polymerase.

Transformation
Take 50micro liters of chemically competent cells (DH5alpha in our case) stored into a fridge at -70°C. Put the cells in ice.
Add the plasmid to be transformed (The quantity is depending of the source and concentration).
Let the samples in ice for 20 minutes.
Apply a heat shock at 41°C for 1 minute.
Incubate on ice for 5 minutes.
Incorporate 1mL of liquid-LB medium.

June 26th

---

I started working in the new lab.

Objectives: The final aim is to earn all the following devices and put all of them together into the plasmid we are suggesting, that extracted from P4

we learned to obtain the plasmid send by iGEM in the 2009 kit plates, and to transform it. July 10th We transformed the plasmids coming in the 2009 kit plates, BBa_I715038 ready to use T7 RNA polymerase inducible with IPTG BBa_K093005 RBS-RFP BBa_I13507 RBS-RFP-Transcriptional terminator

The T7 RNA polymerase is going to be used to test the functionality of the final device and of the partial constructions with this promoter.

RBS-RFP is going to be used after the asRNA-double_transcriptional_terminator as a reporter gene. (Check asRNA design)

RBS-RFP-T.terminator If is the case that we can not afford the asRNA after other constructions are finished, we will use this biobrick as a reporter, It would be with a promoter inducible with luxR-AHL dimer (BBa_R1062)

July 14th Plan to ligate double terminators (BBa_B0015) at the end of the AHL making enzyme (BBa_C0261) the kanamycine resistance cassette (BBa_P1003)

July 17-26th We MUST take vacation, the lab’s people will be on vacation and we’re not able to stay here without supervision of the advisor. We are supposed to read about general things involved in our project and also about applications in human’s health.

Aug 6th We recieved an e-mail from Mr. Gene, They say that E3 and E9 colicin domains have always been tricking to synthesize, The E3 toxin has already been amplified by PCR, but the E9 sequence has been dificult to obtain. The GFP biobrick is cloned into any plasmid from Mr.Gene

It seems that they were not able to clone neither E3 nor E9 colicines, we are worried about the dificulties that we will have to clone them.

Aug 7th From the transformations we performed on Aug 5th we observed some colonies, we expected them to grow in just 24hrs, but it took almost 2 days. we decided to perform colony PCR from.

Ligations Number of colonies Lines

     BBa_R1062 + BBa_I13507 		5			1 - 5 big
     BBa_J04450 + Cox			2			6, 7 big 
     BBa_C0261  + BBa_B0015 		2			8, 9 big
     BBa_K116640 + BBa_K116640	8			11-18 big
     OGR +  BBa_B0015 		5			1-5 small
     PCR positive control		/			6 small
     PCR negative control		/  			7 small	

Small gel Big gel

As seen in the 1% Agarose gel, we got 4 true positive colonies in the OGR + BBa_B0015 transformation, and 2 true positive for BBa_J04450 + Cox.

September 7th We reasoned that the idea of asRNA. If we design and prove that is functional we will repress the fage infection easier. The idea is that infected bacteria will send AHL to alarm their neighbors about the infection, afterwards the bacteria close to this place will express the asRNA, so if lytic phase of phages is faster than the transcription machinery and the toxin’s action time (This implies that the first infected bacteria will “lose” even when contains the construction), the bacterial population next to the infected will express an antisense that if the lytic phages infect one of the alerted bacteria, it will be already prepared with the antisense.

Sept 8th – 18th Design of the antisensense RNA We looked for any target that was mentioned as essential in the literature. We decided to attack phages in their replication process, because of the targets we found, so we reasoned that if the phage tries to replicate it’s genome the asRNA is going to block the process reducing dramatically the burst size or if the efficiency is high, there wont be any new phage. The target is NOT the RNA polymerase because we want it to express the kamikaze device.

The design included literature reading of examples to block the translation of proteins in bacteria, and particularly to those in which the target sequences were phages’. The 5’ of the transcript should be blocked. The replication is a good target, in some articles some of the components of the replication were targeted and the efficiency of plaquing diminished as well as the size of the plaques.

We met Dr. José Luis Reyes Taboada who is expert in the field of RNAs. With his guidance we looked for structures in RNAFold with high Gibbs energy values (the less negative, the better), we also checked that the structures were not blocking the RBS.

Why not to use the same target mRNA for both phages? Because the upstream sequences of the essential genes are not conserved more than 90%, and the efficiency of silencing would decrease dramatically for one if we take the antisense sequence of the other. Why not use the two different sequences but for the same target in the two phages (for example, both DNA polymerases)? Because they are more similar than any other pair of sequences, so they would interfere with each other.

The final result is following: The pink sequence represents the 5’UTR, the blue one is where the RBS is supposed to be, the common part is just the 5’ of the gene. GGGTGGCCTTTATGATTATCATTTAGCACGAAACCAAAGGAGGGCATTATGCTCGTAAGTGACATTGAGG

                                                 t3 DNA polymerase

AAACGAAACCTAAAGGAGATTAACATTATGGCTAAGAAGATTTTCACCTCTGCGCTGGGTACCGCTGAACCTTACGCTTACAT

                                       t7  gp2.5 ssDNA Binding Prot
                   

Their reverse complement sequences are: CCTCAATGTCACTTACGAGCATAATGCCCTCCTTTGGTTTCGTGCTAAATGATAATCATAAAGGCCACCC.

Form two possible secondary structures of -10 and -11 kcal/mol. ATGTAAGCGTAAGGTTCAGCGGTACCCAGCGCAGAGGTGAAAATCTTCTTAGCCATAATGTTAATCTCCTTTAGGTTTCGTTT Three possible secondary structures between -13.3 and 14.3 kcal/mol

Concatenated: CCTCAATGTCACTTACGAGCATAATGCCCTCCTTTGGTTTCGTGCTAAATGATAATCATAAAGGCCACCC ATGTAAGCGTAAGGTTCAGCGGTACCCAGCGCAGAGGTGAAAATCTTCTTAGCCATAATGTTAATCTCCTTTAGGTTTCGTTT

With 4 possible folds between -29.3 and -30.4 kcal/mol

In order to send the sequence to synthesis, we added the prefix, the suffix, after the concatenation of the asRNA with the double terminator (BBa_B0015), without any scar.

At the end we send to synthesis the following sequence. >Prefix_PLux_AsRNA(t3DNApol)_asRNA(t7SSBProt)_DoubleTerminator_Suffix GAATTCGCGGCCGCTTCTAGacctgtaggatcgtacaggttgacacaagaaaatggtttgttgatactcgaataaaCCTCAATGTCACTTACGAGCATAATGCCCTCCTTTGGTTTCGTGCTAAATGATAATCATAAAGGCCACCCATGTAAGCGTAAGGTTCAGCGGTACCCAGCGCAGAGGTGAAAATCTTCTTAGCCATAATGTTAATCTCCTTTAGGTTTCGTTTccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataTACTAGTAGCGGCCGCTGCAG

DATE ?? Mr.Gene shipment arrives.

Goals Final goals: Ensamble and prove the functionality of the kamikaze device. Get the time in wich a colicin, preferentially E3, kills E. coli c1-alpha Clone the bioparts received from Gene Art into any iGEM plasmid vector. Send them to the Registry of standard biological parts.

Partial goals: Get the time in wich a colicin, preferentially E3, kills Escherichia coli c1-alpha -Clone both colicines into any iGEM vector. -Clone both colicines at the suffix of the biobrick BBa_R0010 in order to get an IPTG inducible device -Measure the time of death after the induction with IPTG Clone the MultiPromoter_GFP with all the death device -Insert the MP_GFP biobrick into any iGEM vector. -Insert the 2 colicines after the MP_GFP -Join this product with all the other biobricks

september 21th. High quality PCR performed to the synthesized biobricks. This bioparts just arived from GeneArt shipment

MultiPromoter T3/T7_GFP (furthermore refered as MP_GFP)-- We recieved 5ng of plasmid containing this biobrick E3 RNase domain (furthermore called E3)-- We recieved just 0.1ng of PCR product of this biobrick E9 DNase domain (furthermore called E9)-- We recieved just 0.1ng of PCR product of this biobrick (Check Aug 6th for details)

PCR results were with the expected size for all three sequences.

Oct 3rd

Oct6th PCR colony for those that are still white. We expected to find true transformants, but from 25 colonies, just one contains a PCR product of the expected size. Almost all the few colonies with the pSB1T3 as a plasmid are red. In the case of those that are withe (the Kanamicine resistance conteiners) has just kanamicine ligated! we are surprised becouse we weren't expecting that the kanamicine resistance was able to clone without the colicin, just becouse of restriction enzymes combinations!

Oct 7th Plasmid extraction and digestion of the transformant colony whose PCR seemed to amplify a fragment of the expected size. Now we have a clone with the biobrick multipromoter_GFP inserted into the plasmid pSB1T3.

Oct 8th Preparation by dilution of Preffix and Suffix primers. High quality PCRs to E3 and E9, just to earn more of these DNA fragments in order to continue the efforts to clone them

October 9th Cut and dephosphatation of BBa_J04450 cut by EcoRI and PstI which expeled RFP from the plasmid. This new plasmid pSB4A5 is used due to the lack of transformants for the plasmid pSB4K5, both of them are low copy number plasmid. We reasoned that a high copy number plasmid may be the cause of our failure to clone E3 and E9 bacteriocines.

Oct 10th Digestion with different enzyme combinations to different biobricks.

• E9 & E3

EcoRI/PstI Xba/PstI EcoRI/Spe

• Kanamicine resistance casette BBa_J04450

Xba/PstI

• Double transcriptional terminator BBa_B0015

Eco/Spe

All of these digestions were performed in order to clone E3 and E9 into pSB4A5. Double transcriptional terminator will be inserted just before the colicines, as a control to stop basal transcription.

Retrieved from "http://2009.igem.org/Team:LCG-UNAM-Mexico/AbrahamJurnal"