Team:EPF-Lausanne/Notebook/Cloning Strategy

From 2009.igem.org

(Difference between revisions)
(08.07.09)
(Removing all content from page)
 
(28 intermediate revisions not shown)
Line 1: Line 1:
-
{{EPF-Lausanne09}}
 
-
<div CLASS="epfltrick">__TOC__
 
-
</div><div CLASS="epfl09">
 
-
 
-
=Cloning strategy=
 
-
==July==
 
-
 
-
===06.07.09===
 
-
Four forward primers were designed to amplify:
 
-
<br> 1.Promoter T7, RBS, CBP and LOVTAP:
 
-
:gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
 
-
2.RBS, CBP and LOVTAP:
 
-
:gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
 
-
3.CBP and LOVTAP:
 
-
:gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
 
-
4.LOVTAP:
 
-
:gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
 
-
One reverse primer were designed:
 
-
:gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
 
-
 
-
 
-
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
 
-
 
-
===07.07.09===
 
-
To design plasmids : software Vector NTI
 
-
 
-
===08.07.09===
 
-
Inducible LOVTAP biobrick strategy
 
-
: Problem to overcome: Pst sites in LOVTAP sequence.
 
-
:*Our goal: Biobrick LacI promoter-RBS-LOVTAP-Term ( in this order).
 
-
:*Material: Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate).
 
-
:*Strategy: LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP).
 
-
LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously).
 
-
Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX.
 
-
 
-
===09.07.09===
 
-
Partial digestion strategy.
 
-
 
-
===10.07.09===
 
-
 
-
===13.07.09===
 
-
Restriction enzymes  on [http://www.neb.com/nebecomm/products/category1.asp?#2 Biolabs website]
 
-
and [http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp clevage oligonucleotides]
 
-
 
-
TRP promoter biobrick strategy
 
-
 
-
===14.07.09===
 
-
Primers designed for LOVTAP read-out and RBphP project:
 
-
 
-
1.Forward primer Trp promoter:
 
-
:gtttcttc gaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgc
 
-
 
-
2.Reverse primer Trp promoter:
 
-
:ctagctagctaggtcgataccctttttacgtgaacttgcgtactagttaactagttcgatgattaattgtca
 
-
 
-
3.1st Forward primer Inverter TetR:
 
-
:aatcatcgaactagttaactagtacgcaagttcacgtaaaaagggtatcgacaaagaggagaaatactagatgtcc
 
-
 
-
4.2nd Forward primer Inverter TetR:
 
-
:gtttcttcgaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagta
 
-
 
-
5.Reverse Primer Inverter TetR:
 
-
:ctagctagctag tttctcctctttctctagtagtgc
 
-
 
-
 
-
6.Forward primer ppsR1 R.Palustris CGA009:
 
-
:gtttcttcgaattcgcggccgcttctagatgctggaggatatttgccctggtg
 
-
 
-
7.Reverse primer ppsR1 R.Palustris CGA009:
 
-
:gtttcttcctgcagcggccgctactagtattactcatcggctccgtctccttc
 
-
 
-
8.Forward primer ppsR2 R.Palustris CGA009:
 
-
:gtttcttcgaattcgcggccgcttctagatggcgtcaaagtccgttcatgcc
 
-
 
-
9.Reverse primer ppsR2 R.Palustris CGA009:
 
-
:gtttcttcctgcagcggccgctactagtatcaatcctctgcgtcgtctgagg
 
-
 
-
 
-
10.Forward primer BrBphP Bradyrhizobium ORS278:
 
-
:gtttcttcgaattcgcggccgcttctagatgcccgttccgctgacgac
 
-
 
-
11.Reverse primer BrBphP Bradyrhizobium ORS278:
 
-
:gtttcttcctgcagcggccgctactagtatcactcctcgctctgcgagc
 
-
 
-
12.Forward primer ppsR1 Bradyrhizobium ORS278:
 
-
:gtttcttcgaattcgcggccgcttctagatgagggcgttcagagctcc
 
-
 
-
13.Reverse primer ppsR1 Bradyrhizobium ORS278:
 
-
:gtttcttcctgcagcggccgctactagtactattccaactgactgtcttcttcgc
 
-
 
-
14.Forward primer ppsR2 Bradyrhizobium ORS278:
 
-
:gtttcttcgaattcgcggccgcttctagatggccgagtttcacggtccac
 
-
 
-
15.Reverse primer ppsR2 Bradyrhizobium ORS278:
 
-
:gtttcttcctgcagcggccgctactagtactagctccccttttcggtttcctc
 
-
 
-
===15.07.09===
 
-
 
-
===16.07.09===
 
-
 
-
===17.07.09===
 
-
 
-
==August==
 
-
 
-
</div><div CLASS="epfl09bouchon"></div>
 

Latest revision as of 08:05, 28 July 2009