Team:PKU Beijing/Project/AND Gate 2 Result

From 2009.igem.org

(Difference between revisions)
(Rescuing PhiR73 Translation by supD)
(Rescuing PhiR73 Translation by supD)
 
(20 intermediate revisions not shown)
Line 16: Line 16:
In our project, the second AND Gate is directly coupled to our Bistable system, by using a CI434 repressible, CI inducible promoter that is the same as the promoter upstream of CI in the Bistable module. This step is planned in the final assembly of the whole system. Before this, we use two inducible promoters to control PhiR73 with amber mutation and supD tRNA. PhiR73 with an amber mutation is placed downstream of the salicylate sensor promoter and the supD tRNA is placed under the arabinose sensor.  
In our project, the second AND Gate is directly coupled to our Bistable system, by using a CI434 repressible, CI inducible promoter that is the same as the promoter upstream of CI in the Bistable module. This step is planned in the final assembly of the whole system. Before this, we use two inducible promoters to control PhiR73 with amber mutation and supD tRNA. PhiR73 with an amber mutation is placed downstream of the salicylate sensor promoter and the supD tRNA is placed under the arabinose sensor.  
-
[[Image:PKU_Sencond_AND_Gate_Result.png|300px|right|thumb|fig1. Induction to Test the Second AND Gate<br>From left to right, it is the uninduced, induced with arabinose only in the concentration of 10^-4 M, the singal induction with salicylate only in a concentration of 10^-4 M, the double induction by using 10^-4 M arabinose and 10^-4 M salicylate. Both the salicylate singal induction and the double induction shows fluorescence.]]
 
Fig1. shows the testing result of the second AND Gate (singal mutation).
Fig1. shows the testing result of the second AND Gate (singal mutation).
Line 22: Line 21:
Although fluorescence can also be observed in the presence of salicylate. We don't care about it because the rbs is not adjusted, as we have experienced in the construction of the first AND Gate, the adjustment do make a difference.  
Although fluorescence can also be observed in the presence of salicylate. We don't care about it because the rbs is not adjusted, as we have experienced in the construction of the first AND Gate, the adjustment do make a difference.  
-
We also have the a control AND Gate with the sequence unmutated, it is observed that even without induction, there is basal fluorescence because of the leakage of PhiR73 activator. The mutated one shows almost no basal.  
+
We also have the a control AND Gate with the sequence unmutated, it is observed that even without induction, there is basal fluorescence because of the leakage of PhiR73 activator. The mutated one shows almost no basal (Data not shown).
 +
Fig2 shows the strength of flourescece of uninduced, singal induced and double induced ''E.coli''.
 +
 
 +
 
 +
[[Image:PKU_Sencond_AND_Gate_Result.png|320px|left|thumb|fig1. Induction to Test the Second AND Gate<br>From left to right, it is the uninduced, induced with arabinose only in the concentration of 10^-4 M, the singal induction with salicylate only in a concentration of 10^-4 M, the double induction by using 10^-4 M arabinose and 10^-4 M salicylate. Both the salicylate singal induction and the double induction shows fluorescence.]]
 +
 
 +
 
 +
[[Image:PKU_Second_AND_Gate_Data.png|320px|left|thumb|fig2. fluorescence strength in each case]]
{{PKU_Beijing/Foot}}
{{PKU_Beijing/Foot}}

Latest revision as of 15:37, 20 October 2009

 
Project > AND Gate 2 > Result

Sequence of the Mutated PhiR73 delta

After mutation, we send DNA for sequence to see whether TAG amber mutation is successfully introduced in the PhiR73 delta coding sequence. The following are the alignment of the original sequence and the singal mutated and double mutated sequence. It is shown that the sites are successfully mutated to TAG so that the mRNA is not functional without SupD tRNA.

Original ATGCGCTGCCCTTTCTGTCGTCATTCAGCGCATACCCGCACCAGCCGGTATGTGAGTGAC Mutated ATGCGCTGCCCTTTCTGTCGTCATTAGGCGCATACCCGCACCAGCCGGTATGTGAGTGAC ************************* ********************************* Original AATGTCAAAGAAAGTTATCTCCAGTGCCAGAATATTTACTGTTCGGCGACATTTAAAACG Mutated AATGTCAAAGAAAGTTATCTCCAGTGCCAGAATATTTACTGTTCGGCGACATTTAAAACG ************************************************************ Original CATGAGTCAATTTGTGCCGTGATTCGTTCTCCGGTCACGGAGGAAAAACCAGCACCGGCA Mutated CATGAGTCAATTTGTGCCGTGATTCGTTCTCCGGTCACGGAGGAAAAACCAGCACCGGCA ************************************************************ Original AGCACAGCACCGGCTGTTGTCCGAAAAGTTAAAGGCTGTTACAGCTCACCATTCAACCAT Mutated AGCACAGCACCGGCTGTTGTCCGAAAAGTTAAAGGCTGTTACAGCTCACCATTCAACCAT ************************************************************ Original TAA Mutated TAA ***
Original ATGCGCTGCCCTTTCTGTCGTCATTCAGCGCATACCCGCACCAGCCGGTATGTGAGTGAC 2Mutated ATGCGCTGCCCTTTCTGTCGTCATTAGGCGCATACCCGCACCTAGCGGTATGTGAGTGAC ************************* *************** *************** Original AATGTCAAAGAAAGTTATCTCCAGTGCCAGAATATTTACTGTTCGGCGACATTTAAAACG 2Mutated AATGTCAAAGAAAGTTATCTCCAGTGCCAGAATATTTACTGTTCGGCGACATTTAAAACG ************************************************************ Original CATGAGTCAATTTGTGCCGTGATTCGTTCTCCGGTCACGGAGGAAAAACCAGCACCGGCA 2Mutated CATGAGTCAATTTGTGCCGTGATTCGTTCTCCGGTCACGGAGGAAAAACCAGCACCGGCA ************************************************************ Original AGCACAGCACCGGCTGTTGTCCGAAAAGTTAAAGGCTGTTACAGCTCACCATTCAACCAT 2Mutated AGCACAGCACCGGCTGTTGTCCGAAAAGTTAAAGGCTGTTACAGCTCACCATTCAACCAT ************************************************************ Original TAA 2Mutated TAA ***


Rescuing PhiR73 Translation by supD

In our project, the second AND Gate is directly coupled to our Bistable system, by using a CI434 repressible, CI inducible promoter that is the same as the promoter upstream of CI in the Bistable module. This step is planned in the final assembly of the whole system. Before this, we use two inducible promoters to control PhiR73 with amber mutation and supD tRNA. PhiR73 with an amber mutation is placed downstream of the salicylate sensor promoter and the supD tRNA is placed under the arabinose sensor.


Fig1. shows the testing result of the second AND Gate (singal mutation).

Although fluorescence can also be observed in the presence of salicylate. We don't care about it because the rbs is not adjusted, as we have experienced in the construction of the first AND Gate, the adjustment do make a difference.

We also have the a control AND Gate with the sequence unmutated, it is observed that even without induction, there is basal fluorescence because of the leakage of PhiR73 activator. The mutated one shows almost no basal (Data not shown). Fig2 shows the strength of flourescece of uninduced, singal induced and double induced E.coli.


fig1. Induction to Test the Second AND Gate
From left to right, it is the uninduced, induced with arabinose only in the concentration of 10^-4 M, the singal induction with salicylate only in a concentration of 10^-4 M, the double induction by using 10^-4 M arabinose and 10^-4 M salicylate. Both the salicylate singal induction and the double induction shows fluorescence.


fig2. fluorescence strength in each case




^Top