|
|
| (152 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| | {{EPF-Lausanne09}} | | {{EPF-Lausanne09}} |
| | <div CLASS="epfltrick">__TOC__ | | <div CLASS="epfltrick">__TOC__ |
| - | </div><div CLASS="epfl09"> | + | </div><div CLASS="epfl09lab"> |
| | | | |
| - | =Notebook=
| + | <html><br><br><br><br><br><br><br><center> |
| - | ===06.07.09=== | + | <font size="12" color="#007CBC">Notebook</font> |
| - | ;Wet lab:
| + | </center></html> |
| - | LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
| + | <br> |
| - | <br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. | + | <br> |
| - | LOVTAP is in a plasmid called pCal-n (see picture below):
| + | <FONT face="arial"> |
| | + | <p align="center"><big>'''{{CURRENTDAY}}.{{CURRENTMONTH}}.{{CURRENTYEAR}} | {{CURRENTTIME}}'''</big></p></FONT> |
| | | | |
| - | [[Image: pCAL-n.jpg|500px|thumb|center|pCal-n plasmid]]
| |
| | | | |
| - | <br>Some comments on the plasmid:
| + | ==Calendar== |
| - | <br>-CBP is a small peptide with which we could purify LOVTAP protein
| + | |
| - | <br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
| + | |
| | | | |
| | + | <center><table valign=top> |
| | + | <tr valign=top> |
| | + | <td valign=top>{{ #calendar: title=EPF-Lausanne |year=2009 | month=06 }} |
| | + | </td> |
| | + | |
| | + | <td valign=top> |
| | + | {{ #calendar: title=EPF-Lausanne |year=2009 | month=07 }} |
| | + | </td> |
| | + | <td valign=top> |
| | + | {{ #calendar: title=EPF-Lausanne |year=2009 | month=08 }} |
| | + | </td> |
| | + | <td valign=top> |
| | + | {{ #calendar: title=EPF-Lausanne |year=2009 | month=09 }} |
| | + | </td> |
| | + | <td valign=top> |
| | + | {{ #calendar: title=EPF-Lausanne |year=2009 | month=10 }} |
| | + | </td> |
| | + | </tr> |
| | + | </table></center> |
| | | | |
| - | ;Cloning strategy:
| + | <!--<html> |
| - | Four forward primers were designed to amplify:
| + | <iframe src="http://www.google.com/calendar/embed?title=EPFL Planning &height=600&wkst=1&bgcolor=%23FFFFFF&src=igem.epfl.09%40gmail.com&color=%23A32929&ctz=Europe%2FRome" style=" border-width:0 " width="800" height="600" frameborder="0" scrolling="no"></iframe> |
| - | <br> 1.Promoter T7, RBS, CBP and LOVTAP: | + | </html> |
| - | :gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
| + | |
| - | 2.RBS, CBP and LOVTAP:
| + | |
| - | :gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
| + | |
| - | 3.CBP and LOVTAP:
| + | |
| - | :gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
| + | |
| - | 4.LOVTAP:
| + | |
| - | :gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
| + | |
| - | One reverse primer were designed:
| + | |
| - | :gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
| + | |
| - | | + | |
| - | | + | |
| - | The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
| + | |
| - | | + | |
| - | ;People in the lab: Tu, Heidi, Rafael, Basile, Nath | + | |
| - | | + | |
| - | ===07.07.09=== | + | |
| - | | + | |
| - | ;Remark for the notebook:
| + | |
| - | First, it's great you already started to use the wiki and customised the menu!<br> Then I think we should add the name of the peoples who worked on each part of a process (or at least present the same day). It would allow easy team transitions.<br>
| + | |
| - | For the wiki in general, as you did in this page, it is much better not to use html tags.<br>
| + | |
| - | We will have a meeting for the modeling on tuesday, I will come to the lab before.<br><br>
| + | |
| - | ;Wet lab: | + | |
| - | | + | |
| - | We have to grow the 3 strains generously sent by [mailto:j.beatty@ubc.ca Tom Beatty]
| + | |
| - | | + | |
| - | The three strains are :
| + | |
| - | :*''R.Palustris'' CEA001 (wild type) ; should be grown on LB medium only
| + | |
| - | :*''R.Palustris'' BPHP1+ ; should be grown on LB with gentamycin (100 micrograms/ml)
| + | |
| - | :*''E.Coli'' DH10B (pBPH/hmu0) ; should be grown on LB with gentamycin (20 micorgrams/ml)
| + | |
| - | | + | |
| - | | + | |
| - | The transformed LOVTAP and TrpR worked well (N.B. the plasmid of TrpR is pUC19 so the antibiotic resistance is Amp -> see below)
| + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | [[Image: RTEmagicC_puc19_2.gif.gif|500px|thumb|center|pUC19 plasmid]]
| + | |
| - | | + | |
| - | | + | |
| - | We did the glycerol stock, located in the -80 fridge, first floor of the iGEM compartement.
| + | |
| - | | + | |
| - | Then, a miniprep was done with both cultures.
| + | |
| - | A LOVTAP plasmid aliquot was done, a TrpR plasmid aliquot was done, located in the -20 fridge, 2nd floor.
| + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | '''People in the lab'''
| + | |
| - | :Tu, Rafael, Nath, Heidi, Basile
| + | |
| - | | + | |
| - | | + | |
| - | ;Cloning strategy:
| + | |
| - | To design plasmids : software Vector NTI
| + | |
| - | | + | |
| - | {| style="color:#1b2c8a;background-color:#0c9;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
| + | |
| - | !align="center"|[[Team:EPF-Lausanne|Home]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/Team|The Team]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/Project|The Project]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/Parts|Parts Submitted to the Registry]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/Modeling|Modeling]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/Notebook|Notebook]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/Lectures|Lectures]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/Team Management|Team Management]]
| + | |
| - | !align="center"|[[Team:EPF-Lausanne/References|References]]
| + | |
| - | | + | |
| - | |}
| + | |
| | | | |
| | + | <html> |
| | + | <p align="center" class="style1"><a href="#top"><img src="https://static.igem.org/mediawiki/2009/thumb/0/06/Up_arrow.png/50px-Up_arrow.png" alt="Back to top" border="0"></a><br></p> |
| | + | </html> |
| | + | <br>--> |
| | </div><div CLASS="epfl09bouchon"></div> | | </div><div CLASS="epfl09bouchon"></div> |
"
