From 2009.igem.org
(Difference between revisions)
|
|
| (40 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| - | {{EPF-Lausanne09}}
| |
| - | <div CLASS="epfltrick">__TOC__
| |
| - | </div><div CLASS="epfl09">
| |
| | | | |
| - |
| |
| - | =Cloning strategy=
| |
| - | ==July==
| |
| - | ===Week 1===
| |
| - | ====06.07.09====
| |
| - | Four forward primers were designed to amplify:
| |
| - | <br> 1.Promoter T7, RBS, CBP and LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
| |
| - | 2.RBS, CBP and LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
| |
| - | 3.CBP and LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
| |
| - | 4.LOVTAP:
| |
| - | :gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
| |
| - | One reverse primer were designed:
| |
| - | :gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
| |
| - |
| |
| - |
| |
| - | The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
| |
| - |
| |
| - | ====07.07.09====
| |
| - | To design plasmids : software Vector NTI
| |
| - |
| |
| - | ====08.07.09====
| |
| - |
| |
| - | ====09.07.09====
| |
| - |
| |
| - | ====10.07.09====
| |
| - |
| |
| - | ==August==
| |
| - |
| |
| - | </div><div CLASS="epfl09bouchon"></div>
| |
Latest revision as of 08:05, 28 July 2009
"
