Team:Bologna/Project

From 2009.igem.org

(Difference between revisions)
 
(104 intermediate revisions not shown)
Line 1: Line 1:
 +
{{Template:BolognaTemplate}}
 +
<br>
<html>
<html>
-
<style type="text/css">
+
<center>
-
 
+
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font>
-
body {background-color:#000000}
+
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center>
-
strong {color: #c09a6d;}
+
<br><br>
-
 
+
<font face="Calibri" font size="4" color="#000000">
-
</style>
+
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks:  
 +
<br><br>
 +
<ul>
 +
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;
 +
</ul>
 +
<ul>
 +
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter.  For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.
 +
</ul>
 +
<br>
 +
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)
</html>
</html>
-
 
+
<br><br>
-
{| style="color:#ffffff;background-color:#1560BD;text-indent: 12pt;" cellpadding="1" cellspacing="1" border="0" bordercolor="#441111" width="965px" align="center"
+
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]
-
[[Image:DnaMenu.png|center|965px]]
+
<br><br>
-
!align="center"|[[Team:Bologna|<font color="#ffffff">HOME</font>]]
+
<font face="Calibri" font size="5" color="#000000"><b>CIS and TRANS Parts Design</b>
-
!align="center"|[[Team:Bologna/Project|<font color="#ffffff">PROJECT</font>]]
+
<br><br>
-
!align="center"|[[Team:Bologna/Team|<font color="#ffffff">TEAM</font>]]
+
<font face="Calibri" font size="4" color="#000000">
-
!align="center"|[[Team:Bologna/Software|<font color="#ffffff">SOFTWARE</font>]]
+
<html>
-
!align="center"|[[Team:Bologna/Modeling|<font color="#ffffff">MODELING</font>]]
+
<font face="Calibri" font size="4" color="#000000">
-
!align="center"|[[Team:Bologna/Wetlab|<font color="#ffffff">WETLAB</font>]]
+
To identify CIS-repressing and TRANS-repressor DNA sequences, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br>
-
!align="center"|[[Team:Bologna/Notebook|<font color="#ffffff">LAB-BOOK</font>]]
+
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br>
-
!align="center"|[[Team:Bologna/Parts|<font color="#ffffff">SUBMITTED PARTS</font>]]
+
b) have minimal unwanted interactions with genomic mRNA; <br>
-
!align="center"|[[Team:Bologna/Biosafety|<font color="#ffffff">BIOSAFETY AND PROTOCOLS</font>]]
+
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br>
-
|}
+
Here below are the CIS-repressing and TRANS-repressor sequences. More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html>
-
 
+
<br><br>
-
 
+
-
== '''Introduction''' ==
+
-
 
+
-
Our goal is to create a logic gate based on a post-transcriptional regulation system in Escherichia coli, using RNA to silence gene expression. We inserted a cis-acting sequence directly upstream of the rbs (ribosome binding site) to realize a "regulated rbs". We also designed the complementary trans-repressing sequence whose function is to recognize and cover the "regulated rbs" and prevent translation from it. Two versions of the trans- repressing sequence were designed with 2 different kinds of rbs covers. We want to use this short non-coding RNA segment placed in trans, to silence translation from dowstream the cis-acting sequence.  
+
-
We developed a bioinformatic tool to research the sequences and these are the results:
+
{| align="center"
{| align="center"
-
|- style="background: #1560BD; text-align: center;"
+
|- style="background: #1560BD; color:white; text-align: center;"
-
|colspan=4| <font size="+1">Cis-repressing sequence, inserted upstream of the target gene</font>
+
|colspan=4| <font size="+1"><b>CIS-repressing</b></font>
-
|- style="background: #1560BD; text-align: center;"
+
|- style="background: #99BADD; text-align: center;"
-
|width=100| '''Scar'''
+
|width=100| <font size="2">'''''Prefix'''''
-
|width=180| '''Cis-repressing'''
+
|width=180| <font size="2">'''''non-coding TRANS target'''''
-
|width=170| '''Rbs'''
+
|width=170| <font size="2">'''''RBS'''''
-
|width=110| '''Scar'''
+
|width=110| <font size="2">'''''Suffix'''''
|- style="background:#99BADD; color:black; text-align: center"
|- style="background:#99BADD; color:black; text-align: center"
-
| TACTAGAG
+
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG
-
| AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC
+
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC
-
| AAAGAGGAGAAA
+
| <font size="2" color="#FF6600">AAAGAGGAGAAA
-
| TACTAGAG
+
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG
|}
|}
-
 
<br>
<br>
{| align="center"
{| align="center"
-
|- style="background: #1560BD; text-align: center;"
+
|- style="background: #1560BD; color:white; text-align: center;"
-
|colspan=4| <font size="+1">Trans-repressor sequence with a cover of 7 bases (long version)</font>
+
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font>
-
|- style="background: #1560BD; text-align: center;"
+
|- style="background: #99BADD; text-align: center;"
-
|width=100| '''Scar'''
+
|width=100| <font size="2">'''''Prefix'''''
-
|width=180| '''Cover'''
+
|width=180| <font size="2">'''''RBS cover'''''
-
|width=150| '''Trans(long)'''
+
|width=170| <font size="2">'''''non-coding TRANS'''''
-
|width=110| '''Scar'''
+
|width=110| <font size="2">'''''Suffix'''''
|- style="background:#99BADD; color:black; text-align: center"
|- style="background:#99BADD; color:black; text-align: center"
-
| TACTAGAG
+
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG
-
| CCTCTTT
+
| <font size="2" color="#FF6600">CTTT
-
| GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT
+
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT
-
| TACTAGAG
+
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG
|}
|}
-
 
<br>
<br>
{| align="center"
{| align="center"
-
|- style="background: #1560BD; text-align: center;"
+
|- style="background: #1560BD; color:white; text-align: center;"
-
|colspan=4| <font size="+1">Trans-repressor sequence with a cover of 4 bases (short version)</font>
+
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font>
-
|- style="background: #1560BD; text-align: center;"
+
|- style="background: #99BADD; text-align: center;"
-
|width=100| '''Scar'''
+
|width=100| <font size="2">'''''Prefix'''''
-
|width=180| '''Cover'''
+
|width=180| <font size="2">'''''RBS cover'''''
-
|width=150| '''Trans(short)'''
+
|width=170| <font size="2">'''''non-coding TRANS'''''
-
|width=110| '''Scar'''
+
|width=110| <font size="2">'''''Suffix'''''
|- style="background:#99BADD; color:black; text-align: center"
|- style="background:#99BADD; color:black; text-align: center"
-
| TACTAGAG
+
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG
-
| CTTT
+
| <font size="2" color="#FF6600">CCTCTTT
-
| GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT
+
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT
-
| TACTAGAG
+
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG
|}
|}
-
 
<br><br>
<br><br>
-
The sequence secondary structures of RNAs are obtained using the RNA mfold tool:
+
<html>
-
[[Image:Bol_cisrna.jpg|thumb|center|468px|'''Figure 1:''' Cis-repressing sequence]]
+
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b>
-
[[Image:Bol_trans_long.png|thumb|center|500px|'''Figure 2:''' Trans-repressor sequence (long version)]]
+
<br><br>
-
[[Image:Bol_trans_short.jpg|thumb|center|468px|'''Figure 3:''' Trans-repressor sequence (short version) ]]
+
<font face="Calibri" font size="4" color="#000000">
 +
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):
 +
</html>
 +
<br><br>
 +
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]
<br>
<br>
-
These are the three genetic circuits that we are currently studying:
+
The CIS-repressing sequence is assembled upstream of <i>lac</i> I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of  a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br>
-
[[Image:Circuito_with_rRBS_1.jpg|center|900px|]]
+
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br>
-
<br>
+
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.
-
[[Image:circuito_with_rRBS_1.1.jpg|center|900px|]]
+
<br><br>
 +
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b>
 +
<br><br>
 +
<font face="Calibri" font size="4" color="#000000">
 +
To characterize the T-REX device, we developed a [https://2009.igem.org/Team:Bologna/Modeling mathematical model] of the whole testing circuit considering the interaction between all its parts. Model equations were implemented in Simulink (Fig. 4) to simulate the circuit and it intermediate parts. After the identification of model parameters on the data obtained from experiments with the intermediate parts, the GFP level as a function of the TRANS/CIS affinity  was predicted by simulating the whole testing circuit .
 +
[[Image:ModelSandro.png|center|900px|thumb|<center>Figure 4 - Simulink Model</center>]]
 +
<br><br>
 +
<font face="Calibri" font size="5" color="#000000"><b>Characterization of Parts</b></font>
 +
<br><br>
 +
The Testing Circuit is constituted by intermediate parts that were experimentally characterized to obtain date for the model paramiter identification. Details of this characterization are available in the [https://2009.igem.org/Team:Bologna/Wetlab wet-lab] section.
 +
 
<br><br>
<br><br>
-
[[Image:circuito_with_rRBS_2.jpg|center|900px|]]
 

Latest revision as of 02:56, 22 October 2009

ProvaBol2.png
HOME TEAM PROJECT SOFTWARE MODELING WET LAB PARTS HUMAN PRACTICE JUDGING CRITERIA


T-REX Project

(Trans-Repressor of Expression)


The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in E. coli, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device T-REX (Trans Repressor of Expression).
T-REX consists of two new BioBricks:

  • CIS-repressing, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site (RBS);
  • TRANS-repressor, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a RBS cover, released in two versions of different length (either 4 or 7 nucleotides).
    The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.

Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (see Fig. 1, left panel). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS RNA duplex prevents ribosomes from binding to RBS on target mRNA, thus silencing protein synthesis. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (see Fig. 1, right panel)

Figure 1 - T-REX device



CIS and TRANS Parts Design

To identify CIS-repressing and TRANS-repressor DNA sequences, we developed BASER software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing);
b) have minimal unwanted interactions with genomic mRNA;
c) present a minimal probability of partial/shifted hybridization with complementary strands.

Here below are the CIS-repressing and TRANS-repressor sequences. More details about BASER and its functioning can be found in the software section.

CIS-repressing
Prefix non-coding TRANS target RBS Suffix
GAATTCGCGGCCGCTTCTAGAG AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC AAAGAGGAGAAA TACTAGTAGCGGCCGCTGCAG


TRANS-repressor (4)
Prefix RBS cover non-coding TRANS Suffix
GAATTCGCGGCCGCTTCTAGAG CTTT GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT TACTAGTAGCGGCCGCTGCAG


TRANS-repressor (7)
Prefix RBS cover non-coding TRANS Suffix
GAATTCGCGGCCGCTTCTAGAG CCTCTTT GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT TACTAGTAGCGGCCGCTGCAG



Testing Circuit

In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):

Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality


The CIS-repressing sequence is assembled upstream of lac I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator.
If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.

Mathematical Model

To characterize the T-REX device, we developed a mathematical model of the whole testing circuit considering the interaction between all its parts. Model equations were implemented in Simulink (Fig. 4) to simulate the circuit and it intermediate parts. After the identification of model parameters on the data obtained from experiments with the intermediate parts, the GFP level as a function of the TRANS/CIS affinity was predicted by simulating the whole testing circuit .

Figure 4 - Simulink Model



Characterization of Parts

The Testing Circuit is constituted by intermediate parts that were experimentally characterized to obtain date for the model paramiter identification. Details of this characterization are available in the wet-lab section.