Team:MoWestern Davidson/parts

From 2009.igem.org

(Difference between revisions)
(Parts)
(Characterization of Pre-Existing Part in the Registry)
 
(80 intermediate revisions not shown)
Line 1: Line 1:
{{Template:MoWestern_Davidson2009}}
{{Template:MoWestern_Davidson2009}}
-
 
==Parts==
==Parts==
-
[[Image:TRNA_parts3.png]]
 
-
{| border="1" cellpadding="2"
+
<center>
-
!width="205"|tRNAs
+
-
!width="30"|tRNA part number
+
-
!width="190"|FSL Reporter Genes
+
-
!width="30"|FSL part number
+
-
!width="80"|Controls
+
 +
<span style="color:#006400"> '''Green''' </span> Part has been cloned and sequence verified;            <span style="color:#B22222"> '''Red''' </span> Part is under construction
 +
 +
{| class="wikitable" style="text-align:center" border="1" cellpadding="2"
 +
!tRNAs
 +
!width="30"|tRNA part number
 +
!5mer Reporter Genes
 +
!width="30"|5mer Reporter part number
|-  
|-  
-
|Ser-CCCUC tRNA Suppressor || [http://partsregistry.org/Part:BBa_K199000 BBa_K199000] || RFP with CCCUC Addition || [http://partsregistry.org/Part:BBa_K199011 BBa_K199011] || pLac + RBS + RFP + TT ||
+
|<span style="color:#006400"> '''CCCUC tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199000 BBa_K199000] || <span style="color:#006400"> RFP with CCCUC Addition </span> <br> <span style="color:#B22222"> Tet with CCCUC Addition</span> || [http://partsregistry.org/Part:BBa_K199011 BBa_K199011]<br>[http://partsregistry.org/Part:BBa_K199012 BBa_K199012]
 +
|-
 +
|<span style="color:#006400"> '''CUAGU tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199001 BBa_K199001] || <span style="color:#006400"> RFP with CUAGU Addition </span> <br><span style="color:#006400">Tet with CUAGU Addition</span> || [http://partsregistry.org/Part:BBa_K199003 BBa_K199003]<br> [http://partsregistry.org/Part:BBa_K199004 BBa_K199004]
 +
|-
 +
|<span style="color:#006400"> '''CCACU tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199002 BBa_K199002] || <span style="color:#006400"> RFP with CCACU Addition </span><br> <span style="color:#006400"> Tet with CCACU Addition </span> || [http://partsregistry.org/Part:BBa_K199005 BBa_K199005]<br>[http://partsregistry.org/Part:BBa_K199006 BBa_K199006]
 +
|-
 +
|<span style="color:#006400"> '''CCAUC tRNA Suppressor (9-bp Anticodon)'''</span>  || [http://partsregistry.org/Part:BBa_K199007 BBa_K199007] || <span style="color:#006400"> RFP with CCAUC Addition </span><br><span style="color:#B22222"> Tet with CCAUC Addition</span> || [http://partsregistry.org/Part:BBa_K199009 BBa_K199009]<br> [http://partsregistry.org/Part:BBa_K199010 BBa_K199010]
 +
|-
 +
|<span style="color:#006400"> '''CCAUC tRNA Suppressor (10-bp Anticodon)''' </span>  || [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] || <span style="color:#006400"> RFP with CCAUC Addition </span><br> <span style="color:#B22222"> Tet with CCAUC Addition</span> || [http://partsregistry.org/Part:BBa_K199009 BBa_K199009]<br>[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]
 +
|-
 +
|<span style="color:#006400"> '''CGGUC tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] || <span style="color:#006400"> RFP with CGGUC Addition </span><br><span style="color:#006400"> Tet with CGGUC Addition </span>  || [http://partsregistry.org/Part:BBa_K199034 BBa_K199034]<br>[http://partsregistry.org/Part:BBa_K199035 BBa_K199035]
 +
|-
 +
|<span style="color:#006400"> '''CUACC tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] || <span style="color:#006400">  RFP with CUACC Addition </span> || [http://partsregistry.org/Part:BBa_K199085 BBa_K199085]
 +
|-
 +
|<span style="color:#006400"> '''AGGAC tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199014 BBa_K199014] || <span style="color:#006400"> RFP with AGGAC Addition </span>  || [http://partsregistry.org/Part:BBa_K199084 BBa_K199084]
 +
|-
 +
|<span style="color:#006400"> '''CCAAU tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199047 BBa_K199047] || <span style="color:#006400"> RFP with CCAAU Addition </span>  || [http://partsregistry.org/Part:BBa_K199088 BBa_K199088]
 +
|-
 +
|<span style="color:#006400"> '''CUAGC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199016 BBa_K199016] || <span style="color:#006400"> CAT with CUAGC Addition <br> RFP with CUAGC Addition</span>  || [http://partsregistry.org/Part:BBa_K199033 BBa_K199033] <Br> [http://partsregistry.org/Part:BBa_K199087 BBa_K199087]
 +
|-
 +
|<span style="color:#006400"> '''CUACU tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199046 BBa_K199046] || <span style="color:#B22222"> RFP with CUACU Addition </span>  || [http://partsregistry.org/Part:BBa_K199086 BBa_K199086]
 +
|-
 +
|<span style="color:#006400"> '''CCACC tRNA Suppressor''' </span>  || [http://partsregistry.org/Part:BBa_K199048 BBa_K199048] || <span style="color:#006400"> RFP with CCACC Addition </span> || [http://partsregistry.org/Part:BBa_K199089 BBa_K199089]
 +
|-
 +
|}
 +
<br>
 +
{| class="wikitable" style="text-align:center" border="1" cellpadding="2"
 +
!Intermediate and Control Parts
 +
!Part Number
 +
|-
 +
|<span style="color:#006400"> '''RBS RFP with AGGAC Addition''' </span>  || [http://partsregistry.org/Part:BBa_K199074 BBa_K199074]
 +
|-
 +
|<span style="color:#006400"> '''RBS RFP with CUACC Addition''' </span>  || [http://partsregistry.org/Part:BBa_K199075 BBa_K199075]
 +
|-
 +
|<span style="color:#006400"> '''RBS RFP with CUACU Addition''' </span>  || [http://partsregistry.org/Part:BBa_K199076 BBa_K199076]
 +
|-
 +
|<span style="color:#006400"> '''RBS RFP with CUAGC Addition''' </span>  || [http://partsregistry.org/Part:BBa_K199077 BBa_K199077]
 +
|-
 +
|<span style="color:#006400"> '''RBS RFP with CCAAU Addition''' </span>  || [http://partsregistry.org/Part:BBa_K199078 BBa_K199078]
 +
|-
 +
|<span style="color:#006400"> '''RBS RFP with CCACC Addition''' </span>  || [http://partsregistry.org/Part:BBa_K199079 BBa_K199079]
 +
|-
 +
|<span style="color:#006400"> '''pBad AGGAC tRNA''' </span>  || [http://partsregistry.org/Part:BBa_K199082 BBa_K199082]
 +
|-
 +
|<span style="color:#B22222"> '''pBad CUACC tRNA''' </span><br><span style="color:#006400">'''pLac CUACC tRNA'''</span> || [http://partsregistry.org/Part:BBa_K199072 BBa_K199072] <br> [http://partsregistry.org/Part:BBa_K199091 BBa_K199091]
 +
|-
 +
|<span style="color:#006400"> '''pBad CUACU tRNA''' </span>  || [http://partsregistry.org/Part:BBa_K199073 BBa_K199073]
 +
|-
 +
|<span style="color:#006400"> '''pBad CUAGC tRNA''' </span>  || [http://partsregistry.org/Part:BBa_K199083 BBa_K199083]
 +
|-
 +
|<span style="color:#006400"> '''pBad CCAAU tRNA''' </span>  || [http://partsregistry.org/Part:BBa_K199080 BBa_K199080]
 +
|-
 +
|<span style="color:#B22222"> '''pBad CCACC tRNA''' </span>  || [http://partsregistry.org/Part:BBa_K199081 BBa_K199081]
 +
|-
 +
|<span style="color:#006400"> '''pLacIQ1 CAT Cassette''' </span>  || [http://partsregistry.org/Part:BBa_K199013 BBa_K199013]
 +
|-
 +
|<span style="color:#006400"> '''pLac CAT Cassette''' </span>  || [http://partsregistry.org/Part:BBa_K199049 BBa_K199049]
 +
|-
 +
|<span style="color:#006400"> '''pLac GFP Cassette''' </span>  || [http://partsregistry.org/Part:BBa_K199055 BBa_K199055]
 +
|}
 +
</center><br><br>
 +
 
 +
==Characterization of Pre-Existing Part in the Registry==
 +
 
 +
'''pLacIQ1 Promoter''' [http://partsregistry.org/Part:BBa_K091112 BBa_K091112] is an exceptionally strong promoter that has been documented.
 +
 
 +
The MWSU/Davidson iGEM 2009 team sequenced this promoter isolated from cells that had grown for several weeks when we obtained gel results indicating that the part might be too large. The team found that there was a 35 bp spontaneous insertion within this promoter directly before the suffix. We believe that the ''E.coli'' cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
 +
 
 +
  TGTGTGGAATTGTGAGCGGATAACAATTTCACACA
 +
 
 +
Our experience with this part and our conclusion concerning the mutation have been added to the promoter description in the Parts Registry so that other teams will be aware of this unique possibility. Users are encouraged to sequence parts using this promoter during the construction process. We have some versions that are wild-type and others that are mutated. If you build a new version yourself, do not maintain the plasmid in cultures for very long. Freeze down a stock as soon as possible to avoid the introduction of a silencing mutation in the promoter.
 +
 
 +
{{Template:MoWestern_Davidson2009_end}}

Latest revision as of 20:11, 21 October 2009

Parts

Green Part has been cloned and sequence verified; Red Part is under construction

tRNAs tRNA part number 5mer Reporter Genes 5mer Reporter part number
CCCUC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199000 BBa_K199000] RFP with CCCUC Addition
Tet with CCCUC Addition
[http://partsregistry.org/Part:BBa_K199011 BBa_K199011]
[http://partsregistry.org/Part:BBa_K199012 BBa_K199012]
CUAGU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199001 BBa_K199001] RFP with CUAGU Addition
Tet with CUAGU Addition
[http://partsregistry.org/Part:BBa_K199003 BBa_K199003]
[http://partsregistry.org/Part:BBa_K199004 BBa_K199004]
CCACU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199002 BBa_K199002] RFP with CCACU Addition
Tet with CCACU Addition
[http://partsregistry.org/Part:BBa_K199005 BBa_K199005]
[http://partsregistry.org/Part:BBa_K199006 BBa_K199006]
CCAUC tRNA Suppressor (9-bp Anticodon) [http://partsregistry.org/Part:BBa_K199007 BBa_K199007] RFP with CCAUC Addition
Tet with CCAUC Addition
[http://partsregistry.org/Part:BBa_K199009 BBa_K199009]
[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]
CCAUC tRNA Suppressor (10-bp Anticodon) [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] RFP with CCAUC Addition
Tet with CCAUC Addition
[http://partsregistry.org/Part:BBa_K199009 BBa_K199009]
[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]
CGGUC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] RFP with CGGUC Addition
Tet with CGGUC Addition
[http://partsregistry.org/Part:BBa_K199034 BBa_K199034]
[http://partsregistry.org/Part:BBa_K199035 BBa_K199035]
CUACC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] RFP with CUACC Addition [http://partsregistry.org/Part:BBa_K199085 BBa_K199085]
AGGAC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199014 BBa_K199014] RFP with AGGAC Addition [http://partsregistry.org/Part:BBa_K199084 BBa_K199084]
CCAAU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199047 BBa_K199047] RFP with CCAAU Addition [http://partsregistry.org/Part:BBa_K199088 BBa_K199088]
CUAGC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199016 BBa_K199016] CAT with CUAGC Addition
RFP with CUAGC Addition
[http://partsregistry.org/Part:BBa_K199033 BBa_K199033]
[http://partsregistry.org/Part:BBa_K199087 BBa_K199087]
CUACU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199046 BBa_K199046] RFP with CUACU Addition [http://partsregistry.org/Part:BBa_K199086 BBa_K199086]
CCACC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199048 BBa_K199048] RFP with CCACC Addition [http://partsregistry.org/Part:BBa_K199089 BBa_K199089]


Intermediate and Control Parts Part Number
RBS RFP with AGGAC Addition [http://partsregistry.org/Part:BBa_K199074 BBa_K199074]
RBS RFP with CUACC Addition [http://partsregistry.org/Part:BBa_K199075 BBa_K199075]
RBS RFP with CUACU Addition [http://partsregistry.org/Part:BBa_K199076 BBa_K199076]
RBS RFP with CUAGC Addition [http://partsregistry.org/Part:BBa_K199077 BBa_K199077]
RBS RFP with CCAAU Addition [http://partsregistry.org/Part:BBa_K199078 BBa_K199078]
RBS RFP with CCACC Addition [http://partsregistry.org/Part:BBa_K199079 BBa_K199079]
pBad AGGAC tRNA [http://partsregistry.org/Part:BBa_K199082 BBa_K199082]
pBad CUACC tRNA
pLac CUACC tRNA
[http://partsregistry.org/Part:BBa_K199072 BBa_K199072]
[http://partsregistry.org/Part:BBa_K199091 BBa_K199091]
pBad CUACU tRNA [http://partsregistry.org/Part:BBa_K199073 BBa_K199073]
pBad CUAGC tRNA [http://partsregistry.org/Part:BBa_K199083 BBa_K199083]
pBad CCAAU tRNA [http://partsregistry.org/Part:BBa_K199080 BBa_K199080]
pBad CCACC tRNA [http://partsregistry.org/Part:BBa_K199081 BBa_K199081]
pLacIQ1 CAT Cassette [http://partsregistry.org/Part:BBa_K199013 BBa_K199013]
pLac CAT Cassette [http://partsregistry.org/Part:BBa_K199049 BBa_K199049]
pLac GFP Cassette [http://partsregistry.org/Part:BBa_K199055 BBa_K199055]


Characterization of Pre-Existing Part in the Registry

pLacIQ1 Promoter [http://partsregistry.org/Part:BBa_K091112 BBa_K091112] is an exceptionally strong promoter that has been documented.

The MWSU/Davidson iGEM 2009 team sequenced this promoter isolated from cells that had grown for several weeks when we obtained gel results indicating that the part might be too large. The team found that there was a 35 bp spontaneous insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:

 TGTGTGGAATTGTGAGCGGATAACAATTTCACACA

Our experience with this part and our conclusion concerning the mutation have been added to the promoter description in the Parts Registry so that other teams will be aware of this unique possibility. Users are encouraged to sequence parts using this promoter during the construction process. We have some versions that are wild-type and others that are mutated. If you build a new version yourself, do not maintain the plasmid in cultures for very long. Freeze down a stock as soon as possible to avoid the introduction of a silencing mutation in the promoter.