Team:MoWestern Davidson/parts
From 2009.igem.org
(Difference between revisions)
(→Parts) |
(→Parts) |
||
Line 55: | Line 55: | ||
|- | |- | ||
|<span style="color:#006400"> '''RBS RFP with CCACC Addition''' </span> || [http://partsregistry.org/Part:BBa_K199079 BBa_K199079] | |<span style="color:#006400"> '''RBS RFP with CCACC Addition''' </span> || [http://partsregistry.org/Part:BBa_K199079 BBa_K199079] | ||
+ | |- | ||
+ | |<span style="color:#006400"> '''pBad AGGAC tRNA''' </span> || [http://partsregistry.org/Part:BBa_K199082 BBa_K199082] | ||
+ | |- | ||
+ | |<span style="color:#B22222"> '''pBad CUACC tRNA''' </span><br><span style="color:#006400">'''pLac CUACC tRNA'''</span> || [http://partsregistry.org/Part:BBa_K199072 BBa_K199072] <br> [http://partsregistry.org/Part:BBa_K199091 BBa_K199091] | ||
+ | |- | ||
+ | |<span style="color:#006400"> '''pBad CUACU tRNA''' </span> || [http://partsregistry.org/Part:BBa_K199073 BBa_K199073] | ||
+ | |- | ||
+ | |<span style="color:#006400"> '''pBad CUAGC tRNA''' </span> || [http://partsregistry.org/Part:BBa_K199083 BBa_K199083] | ||
+ | |- | ||
+ | |<span style="color:#006400"> '''pBad CCAAU tRNA''' </span> || [http://partsregistry.org/Part:BBa_K199080 BBa_K199080] | ||
+ | |- | ||
+ | |<span style="color:#B22222"> '''pBad CCACC tRNA''' </span> || [http://partsregistry.org/Part:BBa_K199081 BBa_K199081] | ||
|} | |} | ||
</center><br><br> | </center><br><br> |
Revision as of 14:57, 16 October 2009
Parts
Green Part has been cloned Red Part is under construction
tRNAs | tRNA part number | 5mer Reporter Genes | 5mer Reporter part number |
---|---|---|---|
CCCUC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199000 BBa_K199000] | RFP with CCCUC Addition Tet with CCCUC Addition | [http://partsregistry.org/Part:BBa_K199011 BBa_K199011] [http://partsregistry.org/Part:BBa_K199012 BBa_K199012] |
CUAGU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199001 BBa_K199001] | RFP with CUAGU Addition Tet with CUAGU Addition | [http://partsregistry.org/Part:BBa_K199003 BBa_K199003] [http://partsregistry.org/Part:BBa_K199004 BBa_K199004] |
CCACU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199002 BBa_K199002] | RFP with CCACU Addition Tet with CCACU Addition | [http://partsregistry.org/Part:BBa_K199005 BBa_K199005] [http://partsregistry.org/Part:BBa_K199006 BBa_K199006] |
CCAUC tRNA Suppressor (9-bp Anticodon) | [http://partsregistry.org/Part:BBa_K199007 BBa_K199007] | RFP with CCAUC Addition Tet with CCAUC Addition | [http://partsregistry.org/Part:BBa_K199009 BBa_K199009] [http://partsregistry.org/Part:BBa_K199010 BBa_K199010] |
CCAUC tRNA Suppressor (10-bp Anticodon) | [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] | RFP with CCAUC Addition Tet with CCAUC Addition | [http://partsregistry.org/Part:BBa_K199009 BBa_K199009] [http://partsregistry.org/Part:BBa_K199010 BBa_K199010] |
CGGUC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] | RFP with CGGUC Addition Tet with CGGUC Addition | [http://partsregistry.org/Part:BBa_K199034 BBa_K199034] [http://partsregistry.org/Part:BBa_K199035 BBa_K199035] |
CUACC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] | RFP with CUACC Addition | [http://partsregistry.org/Part:BBa_K199085 BBa_K199085] |
AGGAC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199014 BBa_K199014] | RFP with AGGAC Addition | [http://partsregistry.org/Part:BBa_K199084 BBa_K199084] |
CCAAU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199047 BBa_K199047] | RFP with CCAAU Addition | [http://partsregistry.org/Part:BBa_K199088 BBa_K199088] |
CUAGC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199016 BBa_K199016] | CAT with CUAGC Addition RFP with CUAGC Addition | [http://partsregistry.org/Part:BBa_K199015 BBa_K199015] [http://partsregistry.org/Part:BBa_K199087 BBa_K199087] |
CUACU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199046 BBa_K199046] | RFP with CUACU Addition | [http://partsregistry.org/Part:BBa_K199086 BBa_K199086] |
CCACC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199048 BBa_K199048] | RFP with CCACC Addition | [http://partsregistry.org/Part:BBa_K199089 BBa_K199089] |
Intermediate and Control Parts | Part Number |
---|---|
RBS RFP with AGGAC Addition | [http://partsregistry.org/Part:BBa_K199074 BBa_K199074] |
RBS RFP with CUACC Addition | [http://partsregistry.org/Part:BBa_K199075 BBa_K199075] |
RBS RFP with CUACU Addition | [http://partsregistry.org/Part:BBa_K199076 BBa_K199076] |
RBS RFP with CUAGC Addition | [http://partsregistry.org/Part:BBa_K199077 BBa_K199077] |
RBS RFP with CCAAU Addition | [http://partsregistry.org/Part:BBa_K199078 BBa_K199078] |
RBS RFP with CCACC Addition | [http://partsregistry.org/Part:BBa_K199079 BBa_K199079] |
pBad AGGAC tRNA | [http://partsregistry.org/Part:BBa_K199082 BBa_K199082] |
pBad CUACC tRNA pLac CUACC tRNA | [http://partsregistry.org/Part:BBa_K199072 BBa_K199072] [http://partsregistry.org/Part:BBa_K199091 BBa_K199091] |
pBad CUACU tRNA | [http://partsregistry.org/Part:BBa_K199073 BBa_K199073] |
pBad CUAGC tRNA | [http://partsregistry.org/Part:BBa_K199083 BBa_K199083] |
pBad CCAAU tRNA | [http://partsregistry.org/Part:BBa_K199080 BBa_K199080] |
pBad CCACC tRNA | [http://partsregistry.org/Part:BBa_K199081 BBa_K199081] |
Characterization of Pre-Existing Part in the Registry
pLacIQ1 Promoter [http://partsregistry.org/Part:BBa_K091112 BBa_K091112]
EDIT THIS The MWSU/Davidson iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
TGTGTGGAATTGTGAGCGGATAACAATTTCACACA