Team:Todai-Tokyo/Notebook/isoleucine

From 2009.igem.org

(Difference between revisions)
(6/14)
Line 143: Line 143:
== 6/14 ==
== 6/14 ==
 +
Creating a biobrick part out of yqiT
 +
Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:
 +
 +
 +
Plate 1 1D (from 2009 iGEM distribution provided by Tokyo University)
 +
promoter (lacI regulated)
 +
 +
 +
Overview:
 +
 +
 +
PCR yqiT gene from genome
 +
 +
gel-purify DNA from the PCR product
 +
 +
digest lacI regulated promoter and purified PCR product by XbaI/PstI
 +
 +
gel-purify the digested vector (lacI regulated promoter without the insert i.e. empty) and the yqiT gene
 +
 +
ligate the above 2 fragments of DNA together
 +
 +
transform into E. coli and select for ampicillin resistance
 +
 +
check for transformation success using colony PCR by yqiT primers
 +
 +
PCR of yqiT gene
 +
The Bacillus subtilis genome was provided by Bacillus subtilis 168
 +
 +
 +
The following primers were used to amplify an approx. 1095bp fragment from the Bacillus subtilis genome.
 +
 +
yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene)
 +
 +
yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene)
 +
 +
PCR protocol
 +
 +
The following was mixed in a PCR tube:
 +
 +
1ul 20uM yqiT EX primer
 +
 +
1ul 20uM yqiT SP primer
 +
 +
2ul 10X Pfu Ultra buffer
 +
 +
1.6ul dNTP mix
 +
 +
0.15ul Bacillus subtilis genome
 +
 +
0.5ul Pfu Ultra enzyme
 +
 +
13.75ul MilliQ
 +
 +
 +
Performed PCR using the following program:
 +
 +
 +
1. 95℃ 2 minutes
 +
 +
2. 95℃ 30 seconds
 +
 +
3. 50℃ 30 seconds
 +
 +
4. 72℃ 40 seconds
 +
 +
5. Repeat 2-4 29 times
 +
 +
6. 25℃ ∞
 +
 +
 +
Purified PCR product using the Promega PCR purification kit.
 +
 +
Ran on gel to gel purify:
 +
 +
Lanes 1:marker 6ul
 +
 +
Lanes 2:yqiT PCR product 10ul + 10xLoading Dye 2ul
 +
 +
 +
[[Image:090614.jpg]]
 +
 +
 +
PCR successful
 +
 +
 +
Ligation
 +
 +
Ligated gel purified yqiT and vector with TaKaRa Solutions 1:
 +
 +
 +
lacI regulated promoter (vector) 2ul
 +
 +
yqiT 8ul
 +
 +
TaKaRa Solutions 1 6ul
 +
 +
 +
Incubated mixtures at 37℃ for 10 minutes.
 +
 +
 +
Transformation
== 6/21 ==
== 6/21 ==

Revision as of 16:08, 30 June 2009

Contents

Plan

Aim: Create bacteria that produce a noxious odour when induced to do so

Methods:

  1. Clone the yqiT gene from Bacillus subtilis into a biobrick vector.
  2. Make constructs that express this gene constitutively and under the control of an inducible promoter.

6/5

Constructs to be created:

  1. yqiT
  2. ptetR-RBS-yqiT-dterm
  3. pAraC-RBS-yqiT-dterm
  4. pLacI-RBS-yqiT-dterm

Obtaining DNA:

Resuspended DNA in the following wells with 10ul water:

Plate 1 1D
[http://partsregistry.org/wiki/index.php/Part:BBa_R0080 AraC regulated promoter]

Plate 1 12E
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 LacI regulated promoter]

Plate 1 1H
[http://partsregistry.org/wiki/index.php/Part:BBa_B0030 Strong RBS]

Plate 1 13B
[http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 TetR repressed POPS generator]

Plate 2 24C
[http://partsregistry.org/wiki/index.php?title=Part:BBa_B0014 Double terminator]

Transformed 1ul of each of the above into DH5a competent cells:

Transformation

  • Mix 1ul of DNA with 100ul of competent cells on ice.
  • Leave on ice for 30 minutes.
  • Heat shock at 42℃ for 45 seconds.
  • Leave on ice for 2 minutes.
  • Add 500ul of LB and incubate at 37℃ for 1 hour.
  • Plate on LB-ampicillin plates.


6/6

No colonies grew from the 5 transformations of 6/5.


6/7

Creating a biobrick part out of yqiT

Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:


Plate 1 16E (from 2007 iGEM distribution provided by Chiba University)
[http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 GFP generator]


Overview:

  1. PCR yqiT gene from genome
  2. purify DNA from the PCR product
  3. digest GFP generator and purified PCR product by XbaI/PstI
  4. gel-purify the digested vector (GFP generator without the insert i.e. empty) and the yqiT gene
  5. ligate the above 2 fragments of DNA together
  6. transform into E. coli and select for ampicillin resistance
  7. check for transformation success using colony PCR by yqiT primers


PCR of yqiT gene
The Bacillus subtilis genome was provided by Bacillus subtilis 168


The following primers were used to amplify an approx. 1500bp fragment from the Bacillus subtilis genome.

yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene)
yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene)

PCR protocol
The following was mixed in a PCR tube:
1ul 20uM yqiT EX primer
1ul 20uM yqiT SP primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.15ul Bacillus subtilis genome
0.5ul Pfu Ultra enzyme
13.85ul MilliQ

Performed PCR using the following program:

1. 95℃ 2 minutes
2. 95℃ 30 seconds
3. 50℃ 30 seconds
4. 72℃ 40 seconds
5. Repeat 2-4 23 times
6. 25℃ ∞

Purified PCR product using the Promega PCR purification kit.

Ran on gel to visualize bands:

090607.1.jpg

PCR unsuccessful: will digest the GFP generator but cannot perform the ligation without the PCR product.



Digestion
Digested purified PCR product and the GFP generator both with XbaI/PstI:

yqiT
3ul PCR product
1ul High buffer
0.5ul XbaI
0.5ul PstI
5ul MilliQ

GFP generator
6ul DNA
2ul High buffer
1ul XbaI
1ul PstI
10ul MilliQ

Incubated mixtures at 37℃ for 1 hour.

Ran on gel to gel purify:
Lanes 1, 12:marker
Lanes 2, 5, 9:GFP
Lanes 3, 6, 10:yqiT


090607.2.jpg


Cut out the second band from the bottom and dissolved the gel using the Promega gel purification kit to extract DNA from.

This DNA is stored for later usage as the GFP generator X/P vector fragment.


6/14

Creating a biobrick part out of yqiT

Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:


Plate 1 1D (from 2009 iGEM distribution provided by Tokyo University) promoter (lacI regulated)


Overview:


PCR yqiT gene from genome

gel-purify DNA from the PCR product

digest lacI regulated promoter and purified PCR product by XbaI/PstI

gel-purify the digested vector (lacI regulated promoter without the insert i.e. empty) and the yqiT gene

ligate the above 2 fragments of DNA together

transform into E. coli and select for ampicillin resistance

check for transformation success using colony PCR by yqiT primers

PCR of yqiT gene The Bacillus subtilis genome was provided by Bacillus subtilis 168


The following primers were used to amplify an approx. 1095bp fragment from the Bacillus subtilis genome.

yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene)

yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene)

PCR protocol

The following was mixed in a PCR tube:

1ul 20uM yqiT EX primer

1ul 20uM yqiT SP primer

2ul 10X Pfu Ultra buffer

1.6ul dNTP mix

0.15ul Bacillus subtilis genome

0.5ul Pfu Ultra enzyme

13.75ul MilliQ


Performed PCR using the following program:


1. 95℃ 2 minutes

2. 95℃ 30 seconds

3. 50℃ 30 seconds

4. 72℃ 40 seconds

5. Repeat 2-4 29 times

6. 25℃ ∞


Purified PCR product using the Promega PCR purification kit.

Ran on gel to gel purify:

Lanes 1:marker 6ul

Lanes 2:yqiT PCR product 10ul + 10xLoading Dye 2ul


090614.jpg


PCR successful


Ligation

Ligated gel purified yqiT and vector with TaKaRa Solutions 1:


lacI regulated promoter (vector) 2ul

yqiT 8ul

TaKaRa Solutions 1 6ul


Incubated mixtures at 37℃ for 10 minutes.


Transformation

6/21

Creating a biobrick part out of yqiT

Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert:


Plate 1 1D (from 2009 iGEM distribution provided by Tokyo University)
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 promoter (lacI regulated)]


Overview:

  1. PCR yqiT gene from genome
  2. gel-purify DNA from the PCR product
  3. digest lacI regulated promoter and purified PCR product by XbaI/PstI
  4. gel-purify the digested vector (lacI regulated promoter without the insert i.e. empty) and the yqiT gene
  5. ligate the above 2 fragments of DNA together
  6. transform into E. coli and select for ampicillin resistance
  7. check for transformation success using colony PCR by yqiT primers


PCR of yqiT gene
The Bacillus subtilis genome was provided by Bacillus subtilis 168


The following primers were used to amplify an approx. 1095bp fragment from the Bacillus subtilis genome.

yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene)
yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene)

PCR protocol
The following was mixed in a PCR tube:
1ul 20uM yqiT EX primer
1ul 20uM yqiT SP primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.15ul Bacillus subtilis genome
0.5ul Pfu Ultra enzyme
13.75ul MilliQ

Performed PCR using the following program:

1. 95℃ 2 minutes
2. 95℃ 30 seconds
3. 50℃ 30 seconds
4. 72℃ 40 seconds
5. Repeat 2-4 29 times
6. 25℃ ∞

Purified PCR product using the Promega PCR purification kit.

Ran on gel to gel purify:
Lanes 6:marker 6ul
Lanes 2, 4:yqiT PCR product 10ul + 10xLoading Dye 2ul

090621 1.jpg

PCR successful



Digestion
Digested purified PCR product and the lacI regulated promoter both with XbaI/PstI:

yqiT
3ul PCR product
1ul High buffer
0.5ul XbaI
0.5ul PstI
5ul MilliQ

lacI regulated promoter
4ul DNA
4ul High buffer
2ul XbaI
2ul PstI
28ul MilliQ

Incubated mixtures at 37℃ for 1 hour.

Ran on gel to gel purify:
Lanes 3:marker 6ul
Lanes 2, 5:lacI regulated promoter 40ul + 10xLoading Dye 8ul
Lanes 1, 4:yqiT 10ul + 10xLoading Dye 2ul


090621 2.jpg

Cut out the band and dissolved the gel using the Promega gel purification kit to extract DNA from.

Ligation
Ligated gel purified yqiT and vector with TaKaRa Solutions 1:

lacI regulated promoter (vector) 0.5ul
yqiT 5.5ul
TaKaRa Solutions 1 4ul

Incubated mixtures at 37℃ for 10 minutes.

Transformation


Home The Team The Project Parts Submitted to the Registry Modeling Notebook