Team:Freiburg bioware/Notebook/June

From 2009.igem.org

(Difference between revisions)
Line 92: Line 92:
<h3>3rd June 2009, 09:00- 13:30 o'clock; Christoph</h3>
<h3>3rd June 2009, 09:00- 13:30 o'clock; Christoph</h3>
Attendees: Christoph<br>
Attendees: Christoph<br>
-
*Inoculation of 2x3ml LB+Kan with a single colony of the two transformed strains (RV308+Tt and RV308+Aa). I only picked colonies from the 10μl plates. 12-16 hours growth over night.
+
<br>*Inoculation of 2x3ml LB+Kan with a single colony of the two transformed strains (RV308+Tt and RV308+Aa). I only picked colonies from the 10μl plates. 12-16 hours growth over night.
Had a discussion with Sven where we decidet to rather sequenz the plasmids, than to do a digestion and a gel.
Had a discussion with Sven where we decidet to rather sequenz the plasmids, than to do a digestion and a gel.
Line 107: Line 107:
Sent the order for the two Fok heterodimers to Mr. Gene<br>
Sent the order for the two Fok heterodimers to Mr. Gene<br>
The two sequences including the SacI/KpnI restriction and prefix and suffix sites are the following:<br>
The two sequences including the SacI/KpnI restriction and prefix and suffix sites are the following:<br>
-
*active FOK:<br>
+
<br>*active FOK:<br>
GAGCTC<br>
GAGCTC<br>
GAATTCGCGGCCGCTTCTAGATGGCCGGC<br>
GAATTCGCGGCCGCTTCTAGATGGCCGGC<br>
Line 120: Line 120:
ACCGGTTAATACTAGTAGCGGCCGCCTGCAG<br>
ACCGGTTAATACTAGTAGCGGCCGCCTGCAG<br>
GGTACC<br>
GGTACC<br>
-
*inactive FOK:<br>
+
<br>*inactive FOK:<br>
GAGCTC<br>
GAGCTC<br>
GAATTCGCGGCCGCTTCTAGATGGCCGGC<br>
GAATTCGCGGCCGCTTCTAGATGGCCGGC<br>
Line 138: Line 138:
the offer with the iGEM fitted prices was received and the order was finally accomplished<br>
the offer with the iGEM fitted prices was received and the order was finally accomplished<br>
data for ordering at mr. gene:<br>
data for ordering at mr. gene:<br>
-
*laborbook
+
<br>*laborbook
<h3>9th June 2009, 13:00-14:30 o'clock; Manuel</h3>
<h3>9th June 2009, 13:00-14:30 o'clock; Manuel</h3>
Attendees: Kristian, Sascha, Christoph, Manuel<br><br>
Attendees: Kristian, Sascha, Christoph, Manuel<br><br>
Talk about the next steps of the Argo-group:
Talk about the next steps of the Argo-group:
-
*kleine Übernachtkultur ansetzen, am nächsten Tag eine große Kultur animpfen, bis zu einer OD von 0,5 - 0,8 wachsen lassen, induzieren und nach ca. 4h sollte schon die ersten Expressionsprodukte nachweisbar sein.
+
<br>*kleine Übernachtkultur ansetzen, am nächsten Tag eine große Kultur animpfen, bis zu einer OD von 0,5 - 0,8 wachsen lassen, induzieren und nach ca. 4h sollte schon die ersten Expressionsprodukte nachweisbar sein.
-
*Aufschluss: sonifizieren oder Frenchpress, zentrifugieren, Ni-Säule.
+
<br>*Aufschluss: sonifizieren oder Frenchpress, zentrifugieren, Ni-Säule.
-
*noch nachzuprüfen: freie SH-Gruppen im Protein? evtl. Gefahr von Verklumpungen, vielleicht DTT zusetzen (sollte man nochmal nachlesen wie das für die Kristallisation gemacht wurde)
+
<br>*noch nachzuprüfen: freie SH-Gruppen im Protein? evtl. Gefahr von Verklumpungen, vielleicht DTT zusetzen (sollte man nochmal nachlesen wie das für die Kristallisation gemacht wurde)
-
*Datenblatt erstellen für das Argo-Protein (isoelektrischer Punkt, MW, ...usw)
+
<br>*Datenblatt erstellen für das Argo-Protein (isoelektrischer Punkt, MW, ...usw)
-
*Messmethoden um herauszufinden ob die DNA gebunden ist (ans Protein) und ob die Ziel-DNA geschnitten wurde. Kristian erwähnt die Fluoreszenz-Polarisation (Gerät vorhanden im Labor).
+
<br>*Messmethoden um herauszufinden ob die DNA gebunden ist (ans Protein) und ob die Ziel-DNA geschnitten wurde. Kristian erwähnt die Fluoreszenz-Polarisation (Gerät vorhanden im Labor).
-
*passende Zielsequenz in der M13-KE-Sequenz (NewEnglandBiolabs) finden. Am besten wäre wenn das Protein zwei Mal schneidet, es würde aber auch mit nur einer Schnittstelle gehen.
+
<br>*passende Zielsequenz in der M13-KE-Sequenz (NewEnglandBiolabs) finden. Am besten wäre wenn das Protein zwei Mal schneidet, es würde aber auch mit nur einer Schnittstelle gehen.
<h3>12th June 2009, 17:00-19:30 o'clock; Laura</h3>
<h3>12th June 2009, 17:00-19:30 o'clock; Laura</h3>
Attendees: Kristian, Manuel, Caro, Hannes, Sarah, Laura<br><br>
Attendees: Kristian, Manuel, Caro, Hannes, Sarah, Laura<br><br>
Planning of the Fok-Expression vector: search for needed biobrick parts
Planning of the Fok-Expression vector: search for needed biobrick parts
-
*high copy plasmid backbone with ampicillin resistance: pSB1A3
+
<br>*high copy plasmid backbone with ampicillin resistance: pSB1A3
-
*Tetracyclin Repressor and Tet repressible promoter: BBa_Q04400
+
<br>*Tetracyclin Repressor and Tet repressible promoter: BBa_Q04400
-
*Ribosome binding site: BBa_B0030 (or synthesis by our own with two complementary oligos)
+
<br>*Ribosome binding site: BBa_B0030 (or synthesis by our own with two complementary oligos)
<h3>15th June 2009, 10:00-12:00 o'clock; Laura </h3>
<h3>15th June 2009, 10:00-12:00 o'clock; Laura </h3>
Attendees: Manu, Rüdiger, Julia, Gerrit, Max, Christoph, Imran, Sarah, Isabell, Caro, Hannes, Laura <br><br>
Attendees: Manu, Rüdiger, Julia, Gerrit, Max, Christoph, Imran, Sarah, Isabell, Caro, Hannes, Laura <br><br>
iGEM Deutschland e.V.<br>
iGEM Deutschland e.V.<br>
-
*editing of the articles of iGEM Deutschland e.V.  
+
<br>*editing of the articles of iGEM Deutschland e.V.  
- Caro: ask for the concrete meaning of "Wegfall seiner steuerbegünstigten Zwecke"<br>
- Caro: ask for the concrete meaning of "Wegfall seiner steuerbegünstigten Zwecke"<br>
- Julia: will already start the registration at the Registergericht<br>
- Julia: will already start the registration at the Registergericht<br>
Sponsoring<br>
Sponsoring<br>
-
*telephone call with Timo: letter is written; as soon as Kristian will have read it, it will be transmitted to the companys<br>
+
<br>*telephone call with Timo: letter is written; as soon as Kristian will have read it, it will be transmitted to the companys<br>
Labtalk<br>
Labtalk<br>
-
*distribution of the talks: iGEM in general (Manu), Fok (Hannes, Julia, Rüdiger), Agos (Christoph), Software (Caro will ask in email, also if they could help with the website)<br>
+
<br>*distribution of the talks: iGEM in general (Manu), Fok (Hannes, Julia, Rüdiger), Agos (Christoph), Software (Caro will ask in email, also if they could help with the website)<br>
Argonauts<br>
Argonauts<br>
-
*Christoph: post the sequences of GATC in the labjournal, ask for a new e. coli expressionvector and search for oligosequences that can be cut by agos
+
<br>*Christoph: post the sequences of GATC in the labjournal, ask for a new e. coli expressionvector and search for oligosequences that can be cut by agos
FOK/ Expressionvector
FOK/ Expressionvector
-
*as soon as Kristian will give his agreement we can start cloning the biobrick parts together
+
<br>*as soon as Kristian will give his agreement we can start cloning the biobrick parts together
Line 182: Line 182:
Group: <b>AGO</b> <br>
Group: <b>AGO</b> <br>
Attendees: Gerrit, Sarah, Hannes <br><br>
Attendees: Gerrit, Sarah, Hannes <br><br>
-
* BL21 de3 cells from yesterday didn't grow in LB+tet, because the BL21 cells from NOVAGEN don't have tet resistance.<br>
+
<br>* BL21 de3 cells from yesterday didn't grow in LB+tet, because the BL21 cells from NOVAGEN don't have tet resistance.<br>
-
* Somebody from the Fuchs lab was so generous to give us an Eppi with competent BL21 de3 cells.<br>
+
<br>* Somebody from the Fuchs lab was so generous to give us an Eppi with competent BL21 de3 cells.<br>
-
* We did a new transformation with the Aa and the Tt plasmid into BL21 de3 (1 plate BL21 de3 + Aa, 1 plate BL21 de3 + Tt, 1 control plate BL21 de3) and let them grow over night at 37°C on LB+kan plates<br>
+
<br>* We did a new transformation with the Aa and the Tt plasmid into BL21 de3 (1 plate BL21 de3 + Aa, 1 plate BL21 de3 + Tt, 1 control plate BL21 de3) and let them grow over night at 37°C on LB+kan plates<br>
-
* We made a control to check whether the cells we got from Fuchs lab have tetracycline resistance (2ml Lb+tet inoculated with 1µl BL21 de3 --> 37°C over night)<br>
+
<br>* We made a control to check whether the cells we got from Fuchs lab have tetracycline resistance (2ml Lb+tet inoculated with 1µl BL21 de3 --> 37°C over night)<br>
-
* We also made about 15 new LB+Kan plates.<br><br>
+
<br>* We also made about 15 new LB+Kan plates.<br><br>
<h3>17th June 2009, 18:00-19:00 o'clock; Hannes </h3>
<h3>17th June 2009, 18:00-19:00 o'clock; Hannes </h3>
-
* Inoculation of 10ml LB (+kan) with:<br>
+
<br>* Inoculation of 10ml LB (+kan) with:<br>
1. RV308 + Aa (+kan)<br>
1. RV308 + Aa (+kan)<br>
2. RV308 + Tt (+kan)<br>
2. RV308 + Tt (+kan)<br>
Line 196: Line 196:
5. BL21 + Tt (+kan)<br>
5. BL21 + Tt (+kan)<br>
-> grow at 37°C over night in shaker -> test of protein expression tomorrow<br>
-> grow at 37°C over night in shaker -> test of protein expression tomorrow<br>
-
* Inoculation of 15ml LB with BL21 de3 -> make competent cells tomorrow<br>
+
<br>* Inoculation of 15ml LB with BL21 de3 -> make competent cells tomorrow<br>
-
* Test whether the BL21 de3 cells from the Fuchs lab have tet resistance was negative -> no tet resistance<br>
+
<br>* Test whether the BL21 de3 cells from the Fuchs lab have tet resistance was negative -> no tet resistance<br>
<h3>18th June 2009, 13:00-17:00 o'clock; Laura </h3>
<h3>18th June 2009, 13:00-17:00 o'clock; Laura </h3>
Planning of new expression vector
Planning of new expression vector
-
*search for standard expression vector in vectorbases: pET (Novagen), pASK (IBA), pQE (Qiagen), pMal (NEB), pGEX (GE)
+
<br>*search for standard expression vector in vectorbases: pET (Novagen), pASK (IBA), pQE (Qiagen), pMal (NEB), pGEX (GE)
->appropriate vector: pMAL-p5X with lacO/P, lacIq, Amp, no igem restriction sites in backbone, size: 5752bp<br>
->appropriate vector: pMAL-p5X with lacO/P, lacIq, Amp, no igem restriction sites in backbone, size: 5752bp<br>
->sequence: CCGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAAT
->sequence: CCGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAAT
Line 276: Line 276:
ACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAG
ACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAG
CCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGCCAGGACCCAACGCTGCCCGAAATT
CCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGCCAGGACCCAACGCTGCCCGAAATT
-
*planning of replacing MalE-gene by chloramphenicol construct adjacent to Freigem restriction sites:
+
<br>*planning of replacing MalE-gene by chloramphenicol construct adjacent to Freigem restriction sites:
->primer will be designed and ordered tomorrow to get the right construct out of the lab vector no 258<br>
->primer will be designed and ordered tomorrow to get the right construct out of the lab vector no 258<br>
<h3>18th June 2009, 11:00-16:00 o'clock; Hannes </h3>
<h3>18th June 2009, 11:00-16:00 o'clock; Hannes </h3>
Line 294: Line 294:
<h3>22th June 2009, 10:00-13:00, 16:00-17:00 o'clock; Laura & Caro</h3>
<h3>22th June 2009, 10:00-13:00, 16:00-17:00 o'clock; Laura & Caro</h3>
Design of primers:
Design of primers:
-
*forward primer:<br>
+
<br>*forward primer:<br>
GATCG (randomly chosen nucleotides to enable restriction by MfeI)-MfeI restriction site-following nucleotides of pMAL-p5x including shine dalgarno (AGGA) (position 1508-1518)-GAAA-XbaI restriction site-TG-NgoMIV-first 23 nucleotides of CAT gene (position in vector 258: 2721-2744)<br>
GATCG (randomly chosen nucleotides to enable restriction by MfeI)-MfeI restriction site-following nucleotides of pMAL-p5x including shine dalgarno (AGGA) (position 1508-1518)-GAAA-XbaI restriction site-TG-NgoMIV-first 23 nucleotides of CAT gene (position in vector 258: 2721-2744)<br>
<img src="https://static.igem.org/mediawiki/2009/8/86/Freiburg09_Primerforward.JPG" name="Primerforward" width="527" height="73" />
<img src="https://static.igem.org/mediawiki/2009/8/86/Freiburg09_Primerforward.JPG" name="Primerforward" width="527" height="73" />
<br>
<br>
-
*reverse primer:  
+
<br>*reverse primer:  
last nucleotides of CAT gene (position 3358-3374 in vector 258)-freigem restriction sites (AgeI, SpeI, NotI, PstI)-HindIII restriction site-CCCAT (randomly chosen nucleotides to enable restriction by HindIII)
last nucleotides of CAT gene (position 3358-3374 in vector 258)-freigem restriction sites (AgeI, SpeI, NotI, PstI)-HindIII restriction site-CCCAT (randomly chosen nucleotides to enable restriction by HindIII)
[[Image: Primerreverse.jpg|none|thumb|400x400px]]<br>
[[Image: Primerreverse.jpg|none|thumb|400x400px]]<br>
Line 306: Line 306:
<h3>24 th June 2009, 12.30-13:00 o'clock;Caro</h3>
<h3>24 th June 2009, 12.30-13:00 o'clock;Caro</h3>
Order of primers (Sigma)  
Order of primers (Sigma)  
-
*forward primer:GATCGCAATTGACCAACAAGGAGAAATCTAGATGGCCGGCGAGAAAAAAATCACTGGATATACC
+
<br>*forward primer:GATCGCAATTGACCAACAAGGAGAAATCTAGATGGCCGGCGAGAAAAAAATCACTGGATATACC
-
*reverse primer:TACCCAAGCTTCTGCAGGCGGCCGCTACTAGTATTAACCGGTCGCCCCGCCCTGCCAC
+
<br>*reverse primer:TACCCAAGCTTCTGCAGGCGGCCGCTACTAGTATTAACCGGTCGCCCCGCCCTGCCAC
Sequences will be added
Sequences will be added
<br><br>
<br><br>
Line 316: Line 316:
Freigem Tatlk main topics:<br><br>
Freigem Tatlk main topics:<br><br>
-
* work-plan of summer
+
<br>* work-plan of summer
-
* Everybody should indicate his dates in an online calander
+
<br>* Everybody should indicate his dates in an online calander
-
* Every week a Lab Talk is now fixed every friday at 10 o´clock in the lab
+
<br>* Every week a Lab Talk is now fixed every friday at 10 o´clock in the lab
<h3>26th June 2009, 10:00-16:00 Hannes</h3>
<h3>26th June 2009, 10:00-16:00 Hannes</h3>
Line 339: Line 339:
<h3>26.06.09, 9:00-17:30 Manuel, Isabell,Sarah, Laura</h3>
<h3>26.06.09, 9:00-17:30 Manuel, Isabell,Sarah, Laura</h3>
-
*PCR with labvector 258 and CAT primer, wrong buffer concentration -> no bands on analytical agarose gel -> PCR repeated with right concentration (Sven will put them in the -20°C freezer)
+
<br>*PCR with labvector 258 and CAT primer, wrong buffer concentration -> no bands on analytical agarose gel -> PCR repeated with right concentration (Sven will put them in the -20°C freezer)
-
*Inoculation of pMAL vector in XL1 blue, inactive and active FOK in XL1 blue, Ago Aa in BL21 gold de3, Ago Tt and Aa in T7 Express Iq -> put them in 37°C room   
+
<br>*Inoculation of pMAL vector in XL1 blue, inactive and active FOK in XL1 blue, Ago Aa in BL21 gold de3, Ago Tt and Aa in T7 Express Iq -> put them in 37°C room   
-
*we now have our own Taq Polymerase and buffer, Phusion Polymerase and buffer, 100 bp DNA ladder, 1 kb DNA ladder and loading dye (all in the freezer except loading dye, which is stored at the bench)
+
<br>*we now have our own Taq Polymerase and buffer, Phusion Polymerase and buffer, 100 bp DNA ladder, 1 kb DNA ladder and loading dye (all in the freezer except loading dye, which is stored at the bench)
<h3>30.06.09, 9:00-18:30 Manuel, Hannes, Julia, Caro</h3>
<h3>30.06.09, 9:00-18:30 Manuel, Hannes, Julia, Caro</h3>
-
* PCR with labvector 258 and CAT primer repeated with changed PCR- Buffer concentration-> didnt work.
+
<br>* PCR with labvector 258 and CAT primer repeated with changed PCR- Buffer concentration-> didnt work.
-
* Repeated with DMSO -> also didnt work!
+
<br>* Repeated with DMSO -> also didnt work!
-
* AGO: Plasmidprep of FOKI active , FOKI unactive and pMAL vector-> -20° C
+
<br>* AGO: Plasmidprep of FOKI active , FOKI unactive and pMAL vector-> -20° C
-
* Protein Expression of T7+Aa, T7+Tt and BL21+Aa, samples after 1, 2 and 4 hours-> SDS- page-> Coomassie staining, destain over night
+
<br>* Protein Expression of T7+Aa, T7+Tt and BL21+Aa, samples after 1, 2 and 4 hours-> SDS- page-> Coomassie staining, destain over night
-
* Inoculation of 100ml LB+Kan with T7+Aa and T7+Tt
+
<br>* Inoculation of 100ml LB+Kan with T7+Aa and T7+Tt

Revision as of 09:08, 8 October 2009

FREiGEM 2009


2th June 2009, 10:00- 13:30 o'clock; Gerrit

Attendees: Caro, Gerrit

Transformation was done with RV and the two vectors (pET SUMO/ pET28a). We made a control plate as well, also we made two plates per vector (500μl and 10μl of cell suspension). Plates are grown over night at 37°C. Inoculation in LB+antibiotic will be done from Christoph.

3rd June 2009, 09:00- 13:30 o'clock; Christoph

Attendees: Christoph

*Inoculation of 2x3ml LB+Kan with a single colony of the two transformed strains (RV308+Tt and RV308+Aa). I only picked colonies from the 10μl plates. 12-16 hours growth over night. Had a discussion with Sven where we decidet to rather sequenz the plasmids, than to do a digestion and a gel. I send a sample of both plasmids to GATC to sequenz them. I decidet to use their standard promotors T7 and pRSET-RT as they were flanking the inserts of both plasmids (and they are for free ;).

4th June 2009, 13:30- 14:30 o'clock; Christoph

Attendees: Christoph
Made gycerol stocks from the cultures. Sequenzes also arrived, I`ll post them later. Laborjournal#24th april 12:30 - 18:00 o'clock Manuel

8th June 2009, 11:30-12:30 o'clock; Laura

Sent the order for the two Fok heterodimers to Mr. Gene
The two sequences including the SacI/KpnI restriction and prefix and suffix sites are the following:

*active FOK:
GAGCTC
GAATTCGCGGCCGCTTCTAGATGGCCGGC
AAATCTGAACTGGAGGAGAAAAAATCCGAGCTGCGCCACAAACTGAAATATGTGCCTCACGAGTATATCGAACTGATCGA GATCGCCCGTAATAGTACCCAAGACCGTATCCTGGAAATGAAAGTGATGGAGTTCTTCATGAAAGTCTATGGCTATCGTG GCAAACATCTGGGTGGTAGCCGTAAACCTGATGGTGCCATTTATACCGTTGGTTCCCCGATCGATTATGGCGTTATCGTT GATACCAAAGCCTATAGCGGGGGTTATAACCTGCCAATTGGTCAGGCTGATGAGATGCAGCGTTATGTGAAAGAGAACCA GACTCGTAACAAACACATCAACCCGAACGAATGGTGGAAAGTGTATCCGTCAAGCGTTACAGAGTTCAAATTCCTGTTCG TGAGCGGCCATTTTAAAGGCAACTATAAAGCACAGCTGACCCGTCTGAACCATAAAACCAATAGCAATGGCGCCGTTCTG TCAGTAGAAGAGCTGCTGATTGGCGGTGAAATGATCAAAGCCGGGACCCTGACACTGGAAGAAGTTCGCCGTAAATTCAA CAATGGGGAGATCAATTTT
ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
GGTACC

*inactive FOK:
GAGCTC
GAATTCGCGGCCGCTTCTAGATGGCCGGC
AAATCTGAACTGGAGGAGAAAAAATCCGAGCTGCGCCACAAACTGAAATATGTGCCTCACGAGTATATCGAACTGATCGA GATCGCCCGTAATAGTACCCAAGACCGTATCCTGGAAATGAAAGTGATGGAGTTCTTCATGAAAGTCTATGGCTATCGTG GCAAACATCTGGGTGGTAGCCGTAAACCAGCAGGTGCCATTTATACCGTTGGTTCCCCGATCGATTATGGCGTTATCGTG GCCACAAAAGCGTATTCTGGCGGTTATAATCTGCCGATTGGTCAGGCTGATGAGATGGAACGTTATGTGGAAGAGAATCA GACCCGTAACAAACATCTGAACCCGAACGAATGGTGGAAAGTGTATCCGTCAAGTGTCACCGAGTTCAAATTTCTGTTCG TGAGCGGCCACTTTAAAGGCAACTATAAAGCCCAGCTGACTCGTCTGAACCATATCACCAATAGCAATGGGGCAGTGCTG AGTGTTGAGGAACTGCTGATCGGTGGAGAAATGATCAAAGCAGGCACCCTGACTCTGGAAGAAGTTCGCCGTAAATTCAA CAATGGCGAGATCAATTTT
ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
GGTACC

9th June 2009, 10:00-11:00 o'clock; Laura

the sequence of the vector of mr. gene, pMA, was checked to exclude the iGEM restriction sites
the offer with the iGEM fitted prices was received and the order was finally accomplished
data for ordering at mr. gene:

*laborbook

9th June 2009, 13:00-14:30 o'clock; Manuel

Attendees: Kristian, Sascha, Christoph, Manuel

Talk about the next steps of the Argo-group:
*kleine Übernachtkultur ansetzen, am nächsten Tag eine große Kultur animpfen, bis zu einer OD von 0,5 - 0,8 wachsen lassen, induzieren und nach ca. 4h sollte schon die ersten Expressionsprodukte nachweisbar sein.
*Aufschluss: sonifizieren oder Frenchpress, zentrifugieren, Ni-Säule.
*noch nachzuprüfen: freie SH-Gruppen im Protein? evtl. Gefahr von Verklumpungen, vielleicht DTT zusetzen (sollte man nochmal nachlesen wie das für die Kristallisation gemacht wurde)
*Datenblatt erstellen für das Argo-Protein (isoelektrischer Punkt, MW, ...usw)
*Messmethoden um herauszufinden ob die DNA gebunden ist (ans Protein) und ob die Ziel-DNA geschnitten wurde. Kristian erwähnt die Fluoreszenz-Polarisation (Gerät vorhanden im Labor).
*passende Zielsequenz in der M13-KE-Sequenz (NewEnglandBiolabs) finden. Am besten wäre wenn das Protein zwei Mal schneidet, es würde aber auch mit nur einer Schnittstelle gehen.

12th June 2009, 17:00-19:30 o'clock; Laura

Attendees: Kristian, Manuel, Caro, Hannes, Sarah, Laura

Planning of the Fok-Expression vector: search for needed biobrick parts
*high copy plasmid backbone with ampicillin resistance: pSB1A3
*Tetracyclin Repressor and Tet repressible promoter: BBa_Q04400
*Ribosome binding site: BBa_B0030 (or synthesis by our own with two complementary oligos)

15th June 2009, 10:00-12:00 o'clock; Laura

Attendees: Manu, Rüdiger, Julia, Gerrit, Max, Christoph, Imran, Sarah, Isabell, Caro, Hannes, Laura

iGEM Deutschland e.V.

*editing of the articles of iGEM Deutschland e.V. - Caro: ask for the concrete meaning of "Wegfall seiner steuerbegünstigten Zwecke"
- Julia: will already start the registration at the Registergericht
Sponsoring

*telephone call with Timo: letter is written; as soon as Kristian will have read it, it will be transmitted to the companys
Labtalk

*distribution of the talks: iGEM in general (Manu), Fok (Hannes, Julia, Rüdiger), Agos (Christoph), Software (Caro will ask in email, also if they could help with the website)
Argonauts

*Christoph: post the sequences of GATC in the labjournal, ask for a new e. coli expressionvector and search for oligosequences that can be cut by agos FOK/ Expressionvector
*as soon as Kristian will give his agreement we can start cloning the biobrick parts together

15th June 2009, 17:00-18:30 o'clock; Julia

I set up the competent BL21 de3 Gold cells with tetracyclin and another sample with BL21 gold (no de3)and put them into the 37° C room over night.

16th June 2009, 09:30-13:00 o'clock; Hannes,Gerrit, Sarah

Group: AGO
Attendees: Gerrit, Sarah, Hannes


* BL21 de3 cells from yesterday didn't grow in LB+tet, because the BL21 cells from NOVAGEN don't have tet resistance.

* Somebody from the Fuchs lab was so generous to give us an Eppi with competent BL21 de3 cells.

* We did a new transformation with the Aa and the Tt plasmid into BL21 de3 (1 plate BL21 de3 + Aa, 1 plate BL21 de3 + Tt, 1 control plate BL21 de3) and let them grow over night at 37°C on LB+kan plates

* We made a control to check whether the cells we got from Fuchs lab have tetracycline resistance (2ml Lb+tet inoculated with 1µl BL21 de3 --> 37°C over night)

* We also made about 15 new LB+Kan plates.

17th June 2009, 18:00-19:00 o'clock; Hannes


* Inoculation of 10ml LB (+kan) with:
1. RV308 + Aa (+kan)
2. RV308 + Tt (+kan)
3. RV308 control (no kan added)
4. BL21 + Aa (+kan)
5. BL21 + Tt (+kan)
-> grow at 37°C over night in shaker -> test of protein expression tomorrow

* Inoculation of 15ml LB with BL21 de3 -> make competent cells tomorrow

* Test whether the BL21 de3 cells from the Fuchs lab have tet resistance was negative -> no tet resistance

18th June 2009, 13:00-17:00 o'clock; Laura

Planning of new expression vector
*search for standard expression vector in vectorbases: pET (Novagen), pASK (IBA), pQE (Qiagen), pMal (NEB), pGEX (GE) ->appropriate vector: pMAL-p5X with lacO/P, lacIq, Amp, no igem restriction sites in backbone, size: 5752bp
->sequence: CCGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAAT GTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGC CAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCAC AACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTC GCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTG TAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCA TTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATT TTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGG CCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAG CGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACT GCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGA TATTTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTC GCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCC GTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAAT GCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTAAGTTAGCTCACTCATTAG GCACAATTCTCATGTTTGACAGCTTATCATCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCT GTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTT GCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGA ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCCAGTCCGTTTAGGTGTTTTCACGAGCAATTGACCAACAAGGACC ATAGATTATGAAAATAAAAACAGGTGCACGCATCCTCGCATTATCCGCATTAACGACGATGATGTTTTCCGCCTCGGCTC TCGCCAAAATCGAAGAAGGTAAACTGGTAATCTGGATTAACGGCGATAAAGGCTATAACGGTCTCGCTGAAGTCGGTAAG AAATTCGAGAAAGATACCGGAATTAAAGTCACCGTTGAGCATCCGGATAAACTGGAAGAGAAATTCCCACAGGTTGCGGC AACTGGCGATGGCCCTGACATTATCTTCTGGGCACACGACCGCTTTGGTGGCTACGCTCAATCTGGCCTGTTGGCTGAAA TCACCCCGGACAAAGCGTTCCAGGACAAGCTGTATCCGTTTACCTGGGATGCCGTACGTTACAACGGCAAGCTGATTGCT TACCCGATCGCTGTTGAAGCGTTATCGCTGATTTATAACAAAGATCTGCTGCCGAACCCGCCAAAAACCTGGGAAGAGAT CCCGGCGCTGGATAAAGAACTGAAAGCGAAAGGTAAGAGCGCGCTGATGTTCAACCTGCAAGAACCGTACTTCACCTGGC CGCTGATTGCTGCTGACGGGGGTTATGCGTTCAAGTATGAAAACGGCAAGTACGACATTAAAGACGTGGGCGTGGATAAC GCTGGCGCGAAAGCGGGTCTGACCTTCCTGGTTGACCTGATTAAAAACAAACACATGAATGCAGACACCGATTACTCCAT CGCAGAAGCTGCCTTTAATAAAGGCGAAACAGCGATGACCATCAACGGCCCGTGGGCATGGTCCAACATCGACACCAGCA AAGTGAATTATGGTGTAACGGTACTGCCGACCTTCAAGGGTCAACCATCCAAACCGTTCGTTGGCGTGCTGAGCGCAGGT ATTAACGCCGCCAGTCCGAACAAAGAGCTGGCAAAAGAGTTCCTCGAAAACTATCTGCTGACTGATGAAGGTCTGGAAGC GGTTAATAAAGACAAACCGCTGGGTGCCGTAGCGCTGAAGTCTTACGAGGAAGAGTTGGTGAAAGATCCGCGTATTGCCG CCACTATGGAAAACGCCCAGAAAGGTGAAATCATGCCGAACATCCCGCAGATGTCCGCTTTCTGGTATGCCGTGCGTACT GCGGTGATCAACGCCGCCAGCGGTCGTCAGACTGTCGATGAAGCCCTGAAAGACGCGCAGACTAATTCGAGCTCGAACAA CAACAACAATAACAATAACAACAACCTCGGGATCGAGGGAAGGATTTCACATATGTCCATGGGCGGCCGCGATATCGTCG ACGGATCCGAATTCCCTGCAGGTAATTAAATAAGCTTCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTT TTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGG CCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCT TTTTGCGTTTCTACAAACTCTTTCGGTCCGTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAAT AACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTT TTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGC ACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTCCCAATGA TGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCACATA CACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATT ATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAA CCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAAC GACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGC TTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCT GGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCC TCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGC CTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTCCTTAGGACTGAGCGTC AACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACC ACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGC AGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTC GCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTT ACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAAC TGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGC AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCA CCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTT TACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGA GCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATAAGGTGCACTGTGACTGGGTCATG GCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCT CATCAGCGTGGTCGTGCAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTT AATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGG ATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCC GGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGC CAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGT GCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAG ACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAG CCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGCCAGGACCCAACGCTGCCCGAAATT
*planning of replacing MalE-gene by chloramphenicol construct adjacent to Freigem restriction sites: ->primer will be designed and ordered tomorrow to get the right construct out of the lab vector no 258

18th June 2009, 11:00-16:00 o'clock; Hannes

Attendees: Sascha, Hannes, Christoph Protein expression of AGO (Tt and Aa) with transformed BL21 de3 and RV308
We took samples after 1,2 and 4 hours after induction with 1mM IPTG
Samples were frozen at -20°C over night to run the SDS gel the next day.

19th June 2009, 16:00-20:00 o'clock; Laura & Caro

Attendees: Caro, Laura, Kristian
Further planning of the primer for ab vector no 258 and looking up Shine Dalgarno sequences in literature

19th June 2009, 10:00-16:00 o'clock; Hannes

Attendees: Hannes, Sascha
- We made aobut 7 SDS gels with HOEFER mighty small system.
- SDS-page with samples from yesterday. (picture from Sascha)

22th June 2009, 10:00-13:00, 16:00-17:00 o'clock; Laura & Caro

Design of primers:
*forward primer:
GATCG (randomly chosen nucleotides to enable restriction by MfeI)-MfeI restriction site-following nucleotides of pMAL-p5x including shine dalgarno (AGGA) (position 1508-1518)-GAAA-XbaI restriction site-TG-NgoMIV-first 23 nucleotides of CAT gene (position in vector 258: 2721-2744)


*reverse primer: last nucleotides of CAT gene (position 3358-3374 in vector 258)-freigem restriction sites (AgeI, SpeI, NotI, PstI)-HindIII restriction site-CCCAT (randomly chosen nucleotides to enable restriction by HindIII) [[Image: Primerreverse.jpg|none|thumb|400x400px]]
Order of vector pMAL-p5x and strain T7 Express Iq Competent E. coli at NEB (#C3016).

24 th June 2009, 12.30-13:00 o'clock;Caro

Order of primers (Sigma)
*forward primer:GATCGCAATTGACCAACAAGGAGAAATCTAGATGGCCGGCGAGAAAAAAATCACTGGATATACC
*reverse primer:TACCCAAGCTTCTGCAGGCGGCCGCTACTAGTATTAACCGGTCGCCCCGCCCTGCCAC Sequences will be added

25 th June 2009, 17-18 o'clock;Caro

Attendees:Manu, Laura, Kristian, Hannes, Anika, Timo, Gerrit, and others

Freigem Tatlk main topics:


* work-plan of summer
* Everybody should indicate his dates in an online calander
* Every week a Lab Talk is now fixed every friday at 10 o´clock in the lab

26th June 2009, 10:00-16:00 Hannes

Attendees: Gerrit, Manuel, Hannes
- Transformation of Aa and Tt into BL21 gold de3 and T7 Express Iq #C3016 -> plate out on LB+Kan, 37°C over night.
- Transformation of FokI inactive and active into XL1 blue -> plate out on LB+Amp, 37°C over night.
- We also made about 10 LB+amp plates
- primer arrived (Prfwd_CAT_iGEMRS;Prrev_CAT_iGEMRS) -> -20°C - Transformation of pMAL-p5x-Vektor into XL1 blue -> plate out on LB+Amp, 37°C over night.
DALI structure alignment with FokI # Query: mol1A # No: Chain Z rmsd lali nres %id PDB Description 1: 1fok-A 38.7 0.0 193 568 100 MOLECULE: PROTEIN (FOKI RESTRICTION ENDONUCLEAS); 2: 2fok-A 32.0 0.6 193 558 100 MOLECULE: FOKI RESTRICTION ENDONUCLEASE; 3: 2fok-B 27.3 0.6 193 560 100 MOLECULE: FOKI RESTRICTION ENDONUCLEASE; 4: 2p14-A 12.5 2.8 143 186 10 MOLECULE: HETERODIMERIC RESTRICTION ENDONUCLEASE R.BSPD6I

26.06.09, 9:00-17:30 Manuel, Isabell,Sarah, Laura


*PCR with labvector 258 and CAT primer, wrong buffer concentration -> no bands on analytical agarose gel -> PCR repeated with right concentration (Sven will put them in the -20°C freezer)
*Inoculation of pMAL vector in XL1 blue, inactive and active FOK in XL1 blue, Ago Aa in BL21 gold de3, Ago Tt and Aa in T7 Express Iq -> put them in 37°C room
*we now have our own Taq Polymerase and buffer, Phusion Polymerase and buffer, 100 bp DNA ladder, 1 kb DNA ladder and loading dye (all in the freezer except loading dye, which is stored at the bench)

30.06.09, 9:00-18:30 Manuel, Hannes, Julia, Caro


* PCR with labvector 258 and CAT primer repeated with changed PCR- Buffer concentration-> didnt work.
* Repeated with DMSO -> also didnt work!
* AGO: Plasmidprep of FOKI active , FOKI unactive and pMAL vector-> -20° C
* Protein Expression of T7+Aa, T7+Tt and BL21+Aa, samples after 1, 2 and 4 hours-> SDS- page-> Coomassie staining, destain over night
* Inoculation of 100ml LB+Kan with T7+Aa and T7+Tt