Team:Bologna/Project

From 2009.igem.org

(Difference between revisions)
Line 129: Line 129:
<font face="Calibri" font size="4" color="#000000">
<font face="Calibri" font size="4" color="#000000">
</html>
</html>
-
* In order to characterize the ratio between of the high copy number pSB1A2 and the low to medium copy number pSB3K3, we analyzed I13504 (wild type GFP) under J23118 promoter (1429):  
+
* In order to characterize the ratio between BBa_J23100 (strength 2547) and BBa_J23118 (strength 1429) promoters, we analyzed GFP (BBa_J04031) production on pSB1A2:
<br>
<br>
-
{|align="center"
 
-
|[[Image:1429GFP_openloop_hc.png|center|450 px]]
 
-
|[[Image:1429GFP_openloop_lc.png|center|450 px]]
 
-
|}
 
-
<center>
 
-
Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section] </center>
 
-
<br><br>
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
<br><br><br><br>
 
-
<br><br><br><br>
 
-
<br><br><br><br>
 
-
 
-
every part of the final device in order to obtain some information and values concerning the processes we were analyzing. All studies conducted by us can be found in detail in the [[Team:Bologna/Wetlab|Wetlab]] section.
 
-
<br><br>
 
-
 
-
 
-
 
-
 
-
* Then we analyzed the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization difference in strength of the two promoters] J23100 (2547) and J23118 (1429) studying the ratio of fluorescence. To do this we created these two circuits where the only different element was the promoter. Our goal was to find a ratio of fluorescence between the two circuits as close as possible to 1.78 (ratio between 2547 and 1429).
 
-
 
{|align="center"
{|align="center"
|[[Image:2547GFP_open_tag.png|center|450 px]]
|[[Image:2547GFP_open_tag.png|center|450 px]]
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]
|}
|}
-
 
+
<center>
 +
Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</center>
 +
<br>
 +
<br>
 +
<html>
 +
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b>
<br><br>
<br><br>
-
 
+
<font face="Calibri" font size="4" color="#000000">
-
* After that we needed to know if the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox presence of the Ox operator] could influence or not the production of GFP. We tested two open loop GFP circuits for each promoter, one with the operator Ox and another without. We wanted to obtain the same GFP production in the two circuits built with the promoter 2547 and in the two circuits built with the 1429 one.
+
</html>
 +
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We evaluate this on pSB1A2, using BBa_J04031 under the control of both BBa_J23118 and BBa_J23100, in presence and in absence of BBa_K079019:
 +
<br>
{|align="center"
{|align="center"
|[[Image:2547GFP_open_tag.png|center|450 px]]
|[[Image:2547GFP_open_tag.png|center|450 px]]
|[[Image:2547GFPOx_open_tag.png|center|450 px]]
|[[Image:2547GFPOx_open_tag.png|center|450 px]]
|}
|}
 +
<br><br>
{|align="center"
{|align="center"
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]
|[[Image:1429GFP_Ox_tag.png|center|450 px]]
|[[Image:1429GFP_Ox_tag.png|center|450 px]]
|}
|}
 +
<center>
 +
Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</center>
 +
<br>
 +
<br>
 +
<html>
 +
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b>
<br><br>
<br><br>
-
 
+
<font face="Calibri" font size="4" color="#000000">
-
* We started to assemble circuits with the simultaneous presence of GFP and LACI to assess their operation and their interaction with each other. The first one is a closed-loop configuration where GFP expression is auto-regulated by the synthesis of LACI repressor protein; we used different IPTG induction concentration to evaluate the LACI repression strength. The second is an open-loop configuration lacking the operator site, so we can determine if there is repression in absence of Ox operator.
+
</html>
-
</font>
+
* We studied interactions between LacI repressor and its natural operator O2, analyzing this two genetic circuits:
-
[[Image:LACi_GFP2_tag.png|center|750 px]]
+
{|align="center"
 +
|[[Image:LACi_GFP2_tag.png|center|750 px]]
 +
|}
 +
<br><br>
 +
{|align="center"
 +
|[[Image:openLACi_GFP_tag.png|center|750 px]]
 +
|}
 +
In the first circuit, we used different IPTG concentration in order to evaluate LacI repression strength. In the latter, we verified that LacI doesn't interfere with GFP production if its natural operator O2 is not present.
 +
<br><br>
 +
<center>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</center>
<br>
<br>
-
[[Image:openLACi_GFP_tag.png|center|750 px]]
+
</font>

Revision as of 15:47, 21 October 2009

ProvaBol2.png
HOME TEAM PROJECT SOFTWARE MODELING WET LAB PARTS HUMAN PRACTICE JUDGING CRITERIA


T-REX Project

 (Trans-Repressor of Expression)


The project aims to implement a protein synthesis regulation system in Escherichia coli that acts at translational level, regardless of the target gene. This "general-purpose" device allows a faster control of protein expression.

The device was named T-Rex (Trans Repressor of Expression). It consists of two new BioBricks:

  • CIS-repressing, to be assembled upstream of the target protein coding sequence; it contains a ribosomal binding site; (RBS)

  • TRANS-repressor, to be placed under the control of a different promoter; it is complementary to the CIS-repressing, and contains a RBS cover in two versions of different length (4 and 7 nucleotides).
    The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.

Transcription of the target gene produces a mRNA strand, starting with the Cis element, which is translated into proteins by ribosome. Trans’ promoter induction produces a transcript that binds with the Cis part. The RNA duplex prevents ribosome from binding to RBS, repressing protein synthesis. Thus, the TRANS-repressor amount regulates the gene mRNA translation rate.


Project3b.png



The Parts

We choose to use 50bp non-coding sequences as CIS-repressing and TRANS-repressor complementary parts, and we developed a bioinformatic tool (BASER) to design them, in order to minimize unwanted interactions with genomic mRNA, reduce the probability of intra-molecular annealing and of partial/shifted hybridization.


CIS-repressing
Prefix non-coding TRANS target RBS Suffix
GAATTCGCGGCCGCTTCTAGAG AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC AAAGAGGAGAAA TACTAGTAGCGGCCGCTGCAG


TRANS-repressor (4)
Prefix RBS cover non-coding TRANS Suffix
GAATTCGCGGCCGCTTCTAGAG CTTT GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT TACTAGTAGCGGCCGCTGCAG


TRANS-repressor (7)
Prefix RBS cover non-coding TRANS Suffix
GAATTCGCGGCCGCTTCTAGAG CCTCTTT GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT TACTAGTAGCGGCCGCTGCAG



The Genetic Circuits

In order to test and characterize our T-REX device, we developed the following genetic circuit:

Circuit2.jpg



The circuit above represents the ON configuration of our T-Rex device: TRANS-repressor is constitutively expressed and CIS-repressing is assembled upstream the LacI gene (BBa_C0012), while the reporter protein GFP (BBa_J04031) is assembled under the control of another promoter, regulated by LacI natural operator O2.
CIS-repressing and TRANS-repressor mRNAs bind together, preventing LacI translation and allowing GFP production.
Using some IPTG, the repression action of T-Rex become easily, because the concentration of free LacI in the cells is reduced.

To prove T-Rex repression, GFP production level must be compared with the level produced by the OFF configuration of our T-Rex device, that is the same circuit in absence of TRANS-repressor:

OffCircuit tag.png



In this second case, LacI is regularly translated and, binding with its O2 natural operator, it blocks GFP production.
We choose to use a low copy number plasmid and a weak promoter (J23118) for the CIS-repressing/LacI production, and a high copy number plasmid and a strong promoter (J23100) for the TRANS-repressing, to make reporter production's variations easily to be detected.



Before realizing the whole T-Rex device, we decided to perform some preliminary tests, in order to characterize every single BioBrick involved in it.

pSB1A2 vs pSB3K3

  • In order to characterize the difference between the high copy number pSB1A2 and the low to medium copy number pSB3K3 plasmids, we analyzed production of BBa_I13504 (wild type GFP) under BBa_J23118 promoter (1429):


1429GFP openloop hc.png
1429GFP openloop lc.png
Results can be found in the wet-lab section



BBa_J23100 vs BBa_J23118

  • In order to characterize the ratio between BBa_J23100 (strength 2547) and BBa_J23118 (strength 1429) promoters, we analyzed GFP (BBa_J04031) production on pSB1A2:


2547GFP open tag.png
1429GFP openloop hc tag.png
Results can be found in the wet-lab section



Presence vs Absence of LacI natural operator O2

  • We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We evaluate this on pSB1A2, using BBa_J04031 under the control of both BBa_J23118 and BBa_J23100, in presence and in absence of BBa_K079019:


2547GFP open tag.png
2547GFPOx open tag.png



1429GFP openloop hc tag.png
1429GFP Ox tag.png
Results can be found in the wet-lab section



Interaction of LacI repressor with its natural operator O2

  • We studied interactions between LacI repressor and its natural operator O2, analyzing this two genetic circuits:
LACi GFP2 tag.png



OpenLACi GFP tag.png

In the first circuit, we used different IPTG concentration in order to evaluate LacI repression strength. In the latter, we verified that LacI doesn't interfere with GFP production if its natural operator O2 is not present.

Results can be found in the wet-lab section

Retrieved from "http://2009.igem.org/Team:Bologna/Project"