"
Team:DTU Denmark/notebookuserfusion
From 2009.igem.org
| Line 190: | Line 190: | ||
<font size="3"><b>Construction of biobrick <a href="http://partsregistry.org/Part:BBa_K194003">BBa_K194003 </a> and yeast plasmid containing biobrick BBa_K194003 for demonstration.</b></font><br> | <font size="3"><b>Construction of biobrick <a href="http://partsregistry.org/Part:BBa_K194003">BBa_K194003 </a> and yeast plasmid containing biobrick BBa_K194003 for demonstration.</b></font><br> | ||
| - | <p align="justify"> | + | <p align="justify"> Two complentary oligoes were ordered so that they could anneal forming the biobrick BBa_K194003 holding a PacI restriction site flanked by two Nt.BbvCI-sites and with XbaI and SpeI sites in the end for upholding the biobrick standard.</p><br> |
| + | |||
| + | <p align="justify">TCTAGAGGCTGAGGGTTTAATTAAGACCTCAGCGCAGTGGTGCGATCGCGACACTGCTACTAGT AGATCTCCGACTCCCAAATTAATTCTGGAGTCGCGTCACCACGCTAGCGCTGTGACGATGATCA </p><br> | ||
| + | |||
| + | <p align="justify"> The two primers were warmed up to 95 °C on PCR machine and slowly cooled down with 5°C every 5 minutes until it reached 25°C for the two primers to anneal correctly. Then the double stranded oligo was digested with XbaI and SpeI o/n (over night). In the morning the oligo was warmed up to 95 °C again and cooled down as former described. This method was chosen to denature the restriction enzyme before ligation as the oligoes would have been lost in a standard DNA purification. | ||
| + | The oligo was inserted into two different plasmids:</p><br> | ||
| + | |||
| + | <p align="justify">1. <a href="https://www.lablife.org/ct?f=c&a=showvecinfo&vectorid=3289">pRS416 </a>: in-house yeast plasmid with URA marker that we wished to use to demonstrate that Biobrick <a href="http://partsregistry.org/Part:BBa_K194002">BBa_K194002</a> worked in yeast. | ||
| + | 2. <a href="http://partsregistry.org/Part:pSB1A2">pSB1A2</a>: a iGEM plasmid what would be used to send the biobrick to MIT as we cannot send pRS416 with the biobrick due to intellectual property issues.</p><br> | ||
| + | |||
| + | <p align="justify"> | ||
| + | The two plasmids were digested seperately using two enzymes, XbaI (20U) and SpeI (10U). The mixtures were incubated at 37 °C for eight hours after which more enzyme was added to ensure maximum digestion. After an additional two hours of incubation the digested plasmids were dephosphorilised to prevent reanealing during ligation. This was achieved by an <a href="http://www.neb.com/nebecomm/products/productM0289.asp">Antartic Phosphatase treatment</a> (25 U). The DNA was <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890370"> gel-purified</a> and the resulting concentration was determined using fluorometrics (<a href="http://www.invitrogen.com/site/us/en/home/brands/Product-Brand/Qubit.html">The Qubit Quantitation PlatformTM</a> from invitrogen). <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890368">The ligation</a> was performed using T4-DNA ligase using a 3:1 ratio of fragment to vector and 9 ng DNA in total at a volume of 20 µl according to the manufactors recommendations. The actual ligation was carried out on a PCR machine for 1½ hours shifting the temperature from 10 °C to 30 °C at 30 second intervals as desribed by [1]. The final product was finally <a href="https://2009.igem.org/Team:DTU_Denmark/protocols#_Toc243890372"> chemically transformed </a> into competent E coli cells. | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | </p><br> | ||
| + | |||
| + | <p align="justify"> </p><br> | ||
| + | |||
Revision as of 18:46, 21 October 2009
| Home | The Team | The Project | Parts submitted | Modelling | Notebook |
|
Activities relating to our two sub-projects: - The Redoxilator - The USERTM assembly standard - Biobricks - Protocols |
Day-to-day activities Activities relating to the USERTM fusion assembly standard Construction of biobrick BBa_K194003 and yeast plasmid containing biobrick BBa_K194003 for demonstration. Two complentary oligoes were ordered so that they could anneal forming the biobrick BBa_K194003 holding a PacI restriction site flanked by two Nt.BbvCI-sites and with XbaI and SpeI sites in the end for upholding the biobrick standard. TCTAGAGGCTGAGGGTTTAATTAAGACCTCAGCGCAGTGGTGCGATCGCGACACTGCTACTAGT AGATCTCCGACTCCCAAATTAATTCTGGAGTCGCGTCACCACGCTAGCGCTGTGACGATGATCA The two primers were warmed up to 95 °C on PCR machine and slowly cooled down with 5°C every 5 minutes until it reached 25°C for the two primers to anneal correctly. Then the double stranded oligo was digested with XbaI and SpeI o/n (over night). In the morning the oligo was warmed up to 95 °C again and cooled down as former described. This method was chosen to denature the restriction enzyme before ligation as the oligoes would have been lost in a standard DNA purification. The oligo was inserted into two different plasmids: 1. pRS416 : in-house yeast plasmid with URA marker that we wished to use to demonstrate that Biobrick BBa_K194002 worked in yeast. 2. pSB1A2: a iGEM plasmid what would be used to send the biobrick to MIT as we cannot send pRS416 with the biobrick due to intellectual property issues. The two plasmids were digested seperately using two enzymes, XbaI (20U) and SpeI (10U). The mixtures were incubated at 37 °C for eight hours after which more enzyme was added to ensure maximum digestion. After an additional two hours of incubation the digested plasmids were dephosphorilised to prevent reanealing during ligation. This was achieved by an Antartic Phosphatase treatment (25 U). The DNA was gel-purified and the resulting concentration was determined using fluorometrics (The Qubit Quantitation PlatformTM from invitrogen). The ligation was performed using T4-DNA ligase using a 3:1 ratio of fragment to vector and 9 ng DNA in total at a volume of 20 µl according to the manufactors recommendations. The actual ligation was carried out on a PCR machine for 1½ hours shifting the temperature from 10 °C to 30 °C at 30 second intervals as desribed by [1]. The final product was finally chemically transformed into competent E coli cells.
October 3rd Primer design software: Server uplink and HTML interface implemented. September 23rd Primer design software: Work on article commenced. September 22nd Primer design software: Data structure finalized. September 14th Primer design software: Statistical tests program performance. September 12th Primer design software: Preliminary data tests performed. September 4th Primer design software: Graphical output format settled. September 1st Primer design software: TM adjustment algorithm implemented. August 24th Primer design software: Fusion tail sorting algorithm pseudo code complete. August 22nd Primer design software: Work on fusion tail sorting algorithm. July 15th Primer design software: General program parameters determined. July 10th Primer design software: Preliminary meeting on primer design software. |
Work process Our team works parallel in smaller sub-teams. Some of us work hard in the lab, while others are in the process of developing software and the in silico model of the Redoxilator system. However, we constantly keep each other updated, and meet often to exchange ideas and take turns at the different tasks, thus exhausting all of our combined knowledge in every aspect of this project. |
| Comments or questions to the team? Please Email us -- Comments of questions to webmaster? Please Email us |
