Team:MoWestern Davidson/parts
From 2009.igem.org
(Difference between revisions)
(→Anything) |
(→Edits to Parts in the Registry) |
||
Line 24: | Line 24: | ||
===Edits to Parts in the Registry=== | ===Edits to Parts in the Registry=== | ||
+ | |||
+ | pLacIQ1 Promoter BB | ||
+ | |||
+ | The MWSU/Davdison iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion: | ||
+ | |||
+ | TGTGTGGAATTGTGAGCGGATAACAATTTCACACA |
Revision as of 14:42, 28 July 2009
Parts
tRNAs | tRNA part number | FSL Reporter Genes | FSL part number | |
---|---|---|---|---|
Ser-CCCUC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199000 BBa_K199000] | RFP with CCCUC Addition | [http://partsregistry.org/Part:BBa_K199011 BBa_K199011] | |
Ser-CUAGU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199001 BBa_K199001] | RFP with CUAGU Addition | [http://partsregistry.org/Part:BBa_K199003 BBa_K199003] | |
Ser-CCACU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199002 BBa_K199002] | RFP with CCACU Addition | [http://partsregistry.org/Part:BBa_K199005 BBa_K199005] | |
Ser-CCAUC tRNA Suppressor (9-bp Anticodon) | [http://partsregistry.org/Part:BBa_K199007 BBa_K199007] | RFP with CCAUC Addition | [http://partsregistry.org/Part:BBa_K199009 BBa_K199009] |
Edits to Parts in the Registry
pLacIQ1 Promoter BB
The MWSU/Davdison iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
TGTGTGGAATTGTGAGCGGATAACAATTTCACACA