Team:MoWestern Davidson/parts

From 2009.igem.org

(Difference between revisions)
(Parts)
(Parts)
Line 23: Line 23:
|Ser-CCAUC tRNA Suppressor (10-bp Anticodon) || [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] || RFP with CCAUC Addition<br />TetR with CCAUC Addition || [http://partsregistry.org/Part:BBa_K199009 BBa_K199009]<br />[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]||
|Ser-CCAUC tRNA Suppressor (10-bp Anticodon) || [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] || RFP with CCAUC Addition<br />TetR with CCAUC Addition || [http://partsregistry.org/Part:BBa_K199009 BBa_K199009]<br />[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]||
|-
|-
-
|Ser-CGGUC tRNA Suppressor || [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] || RFP with CGGUC Addition<br />TetR with CGGUC Addition || [http://partsregistry.org/Part:BBa_K199034 BBa_K199034]<br /> ||
+
|Ser-CGGUC tRNA Suppressor || [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] || RFP with CGGUC Addition<br />TetR with CGGUC Addition || [http://partsregistry.org/Part:BBa_K199034 BBa_K199034]<br />[http://partsregistry.org/Part:BBa_K199035 BBa_K199035] ||
|-
|-
|Ser-CUACC tRNA Suppressor || [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] || GFP with CUACC Addition || N/A ||
|Ser-CUACC tRNA Suppressor || [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] || GFP with CUACC Addition || N/A ||

Revision as of 15:53, 28 July 2009

Parts

TRNA parts5.png


tRNAs tRNA part number FSL Reporter Genes FSL part number
Ser-CCCUC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199000 BBa_K199000] RFP with CCCUC Addition
TetR with CCCUC Addition
[http://partsregistry.org/Part:BBa_K199011 BBa_K199011]
[http://partsregistry.org/Part:BBa_K199012 BBa_K199012]
Ser-CUAGU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199001 BBa_K199001] RFP with CUAGU Addition
TetR with CUAGU Addition
[http://partsregistry.org/Part:BBa_K199003 BBa_K199003]
[http://partsregistry.org/Part:BBa_K199004 BBa_K199004]
Ser-CCACU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199002 BBa_K199002] RFP with CCACU Addition
TetR with CCACU Addition
[http://partsregistry.org/Part:BBa_K199005 BBa_K199005]
[http://partsregistry.org/Part:BBa_K199006 BBa_K199006]
Ser-CCAUC tRNA Suppressor (9-bp Anticodon) [http://partsregistry.org/Part:BBa_K199007 BBa_K199007] RFP with CCAUC Addition
TetR with CCAUC Addition
[http://partsregistry.org/Part:BBa_K199009 BBa_K199009]
[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]
Ser-CCAUC tRNA Suppressor (10-bp Anticodon) [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] RFP with CCAUC Addition
TetR with CCAUC Addition
[http://partsregistry.org/Part:BBa_K199009 BBa_K199009]
[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]
Ser-CGGUC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] RFP with CGGUC Addition
TetR with CGGUC Addition
[http://partsregistry.org/Part:BBa_K199034 BBa_K199034]
[http://partsregistry.org/Part:BBa_K199035 BBa_K199035]
Ser-CUACC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] GFP with CUACC Addition N/A
Ser-AGGAC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199014 BBa_K199014] GFP with AGGAC Addition N/A
Ser-CCAAU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199047 BBa_K199047] GFP with CCAAU Addition N/A
Ser-CUAGC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199016 BBa_K199016] CAT with CUAGC Addition [http://partsregistry.org/Part:BBa_K199015 BBa_K199015]
Ser-CUACU tRNA Suppressor [http://partsregistry.org/Part:BBa_K199046 BBa_K199046] CAT with CUACU Addition N/A
Ser-CCACC tRNA Suppressor [http://partsregistry.org/Part:BBa_K199048 BBa_K199048] CAT with CCACC Addition N/A


Edits to Parts in the Registry

pLacIQ1 Promoter [http://partsregistry.org/Part:BBa_K091112 BBa_K091112]

The MWSU/Davdison iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:

TGTGTGGAATTGTGAGCGGATAACAATTTCACACA