Team:MoWestern Davidson/parts
From 2009.igem.org
(Difference between revisions)
(→Parts) |
(→Parts) |
||
Line 23: | Line 23: | ||
|<span style="color:#006400"> '''CCAUC tRNA Suppressor (10-bp Anticodon)''' </span> || [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] || <span style="color:#006400"> RFP with CCAUC Addition </span><br /> <span style="color:#006400"> TetR with CCAUC Addition </span> || [http://partsregistry.org/Part:BBa_K199009 BBa_K199009]<br />[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]|| | |<span style="color:#006400"> '''CCAUC tRNA Suppressor (10-bp Anticodon)''' </span> || [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] || <span style="color:#006400"> RFP with CCAUC Addition </span><br /> <span style="color:#006400"> TetR with CCAUC Addition </span> || [http://partsregistry.org/Part:BBa_K199009 BBa_K199009]<br />[http://partsregistry.org/Part:BBa_K199010 BBa_K199010]|| | ||
|- | |- | ||
- | |<span style="color:#006400"> '''CGGUC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] || | + | |<span style="color:#006400"> '''CGGUC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] || <span style="color:#006400"> RFP with CGGUC Addition </span><br /> <span style="color:#006400"> TetR with CGGUC Addition </span> || [http://partsregistry.org/Part:BBa_K199034 BBa_K199034]<br />[http://partsregistry.org/Part:BBa_K199035 BBa_K199035] || |
|- | |- | ||
- | |<span style="color:#006400"> '''CUACC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] || <span style="color:#006400"> GFP with CUACC Addition </span> | + | |<span style="color:#006400"> '''CUACC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] || <span style="color:#006400"> <span style="color:#006400"> GFP with CUACC Addition </span> || N/A || |
|- | |- | ||
- | |<span style="color:#006400"> '''AGGAC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199014 BBa_K199014] || GFP with AGGAC Addition || N/A || | + | |<span style="color:#006400"> '''AGGAC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199014 BBa_K199014] || <span style="color:#006400"> GFP with AGGAC Addition </span> || N/A || |
|- | |- | ||
- | |<span style="color:#006400"> '''CCAAU tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199047 BBa_K199047] || GFP with CCAAU Addition || N/A || | + | |<span style="color:#006400"> '''CCAAU tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199047 BBa_K199047] || <span style="color:#006400"> GFP with CCAAU Addition </span> || N/A || |
|- | |- | ||
- | |<span style="color:#006400"> '''CUAGC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199016 BBa_K199016] || CAT with CUAGC Addition || [http://partsregistry.org/Part:BBa_K199015 BBa_K199015] || | + | |<span style="color:#006400"> '''CUAGC tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199016 BBa_K199016] || <span style="color:#006400"> '''CCACC tRNA Suppressor''' </span> CAT with CUAGC Addition || [http://partsregistry.org/Part:BBa_K199015 BBa_K199015] || |
|- | |- | ||
|<span style="color:#006400"> '''CUACU tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199046 BBa_K199046] || CAT with CUACU Addition || N/A || | |<span style="color:#006400"> '''CUACU tRNA Suppressor''' </span> || [http://partsregistry.org/Part:BBa_K199046 BBa_K199046] || CAT with CUACU Addition || N/A || | ||
Line 38: | Line 38: | ||
|} | |} | ||
+ | |||
</center> | </center> | ||
Revision as of 21:31, 28 July 2009
Contents |
Parts
tRNAs | tRNA part number | FSL Reporter Genes | FSL part number | |
---|---|---|---|---|
CCCUC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199000 BBa_K199000] | RFP with CCCUC Addition TetR with CCCUC Addition | [http://partsregistry.org/Part:BBa_K199011 BBa_K199011] [http://partsregistry.org/Part:BBa_K199012 BBa_K199012] | |
CUAGU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199001 BBa_K199001] | RFP with CUAGU Addition TetR with CUAGU Addition | [http://partsregistry.org/Part:BBa_K199003 BBa_K199003] [http://partsregistry.org/Part:BBa_K199004 BBa_K199004] | |
CCACU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199002 BBa_K199002] | RFP with CCACU Addition TetR with CCACU Addition | [http://partsregistry.org/Part:BBa_K199005 BBa_K199005] [http://partsregistry.org/Part:BBa_K199006 BBa_K199006] | |
CCAUC tRNA Suppressor (9-bp Anticodon) | [http://partsregistry.org/Part:BBa_K199007 BBa_K199007] | RFP with CCAUC Addition TetR with CCAUC Addition | [http://partsregistry.org/Part:BBa_K199009 BBa_K199009] [http://partsregistry.org/Part:BBa_K199010 BBa_K199010] | |
CCAUC tRNA Suppressor (10-bp Anticodon) | [http://partsregistry.org/Part:BBa_K199008 BBa_K199008] | RFP with CCAUC Addition TetR with CCAUC Addition | [http://partsregistry.org/Part:BBa_K199009 BBa_K199009] [http://partsregistry.org/Part:BBa_K199010 BBa_K199010] | |
CGGUC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199028 BBa_K199028] | RFP with CGGUC Addition TetR with CGGUC Addition | [http://partsregistry.org/Part:BBa_K199034 BBa_K199034] [http://partsregistry.org/Part:BBa_K199035 BBa_K199035] | |
CUACC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199045 BBa_K199045] | GFP with CUACC Addition | N/A | |
AGGAC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199014 BBa_K199014] | GFP with AGGAC Addition | N/A | |
CCAAU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199047 BBa_K199047] | GFP with CCAAU Addition | N/A | |
CUAGC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199016 BBa_K199016] | CCACC tRNA Suppressor CAT with CUAGC Addition | [http://partsregistry.org/Part:BBa_K199015 BBa_K199015] | |
CUACU tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199046 BBa_K199046] | CAT with CUACU Addition | N/A | |
CCACC tRNA Suppressor | [http://partsregistry.org/Part:BBa_K199048 BBa_K199048] | CAT with CCACC Addition | N/A |
</center>
Improvement of Pre-Existing Parts in the Registry
pLacIQ1 Promoter [http://partsregistry.org/Part:BBa_K091112 BBa_K091112]
The MWSU/Davidson iGEM 2009 team sequenced this promoter after obtaining gel verification results indicating that the part was too large. The team found that there was a 35 bp insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
TGTGTGGAATTGTGAGCGGATAACAATTTCACACA