Team:KULeuven/Freezer

From 2009.igem.org

(Difference between revisions)
Line 90: Line 90:
|-
|-
|ampicilline||||||||||||
|ampicilline||||||||||||
-
|}
 
-
 
-
= Primers =
 
-
{| class="Generic"
 
-
! class='top' | Number
 
-
! class='top' | Name
 
-
! class='top' | Sequence
 
-
! class='top' | Length
 
-
! class='top' | Tm (°C)
 
-
! class='top' | Comments
 
-
|-
 
-
|2171||BLR promoter fw||CATCAT GAATTCGCGGCCGCTTCTAGAG  TTT GAC AGG TTC GTC GTC||46||52.4||it has a catcat en prefix (not in Tm included)
 
-
|-
 
-
|2172||BLR promoter rv||CTGCAGCGGCCGCTACTAGTA  CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG||51||52.1||it has a suffix (not in Tm included)
 
|}
|}

Revision as of 11:10, 31 July 2009

Contents

Blue light receptor

part plasmid description status μl left concentration date
MC4100 / strain of E.coli july 24
2171 / forward primer for K23800 90µl 20μM july 24
2172 / reverse primer for K23800 90µl 20μM july 24
2171 / forward primer for K238000 100μM july 24
2172 / reverse primer for K238000 100μM july 24
E0240pSB1A2GFP + rbs + terminatorpurifiedjuly 29
E0240pSB1A2GFP + rbs + terminatorrestricted with EcoRI and XbaIjuly 29
/BLR promoter regionrestricted with EcoRIjuly 29
K238000/BLR promoter region4 microcentrifuge tubesjuly 30

Key/antikey/lock

part plasmid description status μl left concentration date
/GFP with LVA tagpurifiedjuly 28
/tetR promoter purifiedjuly 28

vanillin synthesis

part plasmid description status μl left concentration date
pSB1A2ech + rbsput in competent cellsjuly 28
pSB1A2fcs + rbsput in competent cellsjuly 28

vanillin receptor

part plasmid description status μl left concentration date

miscellaneous

part plasmid description status μl left concentration date
dNTP mixATP, GTP, TTP, CTP9410μMJuly 24
pSB1A2medium constitutieve promoterJuly 23
ampicilline