|
|
Line 408: |
Line 408: |
| </html> | | </html> |
| Yesterday, I have sent Pqrr4+B0034 (RBS) for sequencing with BBK CP F primers in order to verify the presence of Pqrr4+B0034. This construct will be used to construct our reporter circuit when the part with GFP+LVA tag arrives. | | Yesterday, I have sent Pqrr4+B0034 (RBS) for sequencing with BBK CP F primers in order to verify the presence of Pqrr4+B0034. This construct will be used to construct our reporter circuit when the part with GFP+LVA tag arrives. |
| + | <br> |
| <br> | | <br> |
| '''Legend''' | | '''Legend''' |
| <br> | | <br> |
- | Vector contamination | + | <font color="red">Vector contamination</font> |
| <Br> | | <Br> |
- | BBK Restriction sites | + | <font color="green">BBK Restriction sites</font> |
| <br> | | <br> |
- | Sequence of interest | + | <font color="yellow">Sequence of interest</font> |
| <br> | | <br> |
- | Scar | + | <font color="purple">Scar</font> |
| <br> | | <br> |
| <br> | | <br> |
| + | |
| + | <b>Sequence of Pqrr4+B0034 (RBS) C1</b> |
| + | |
| + | <font color="red">GGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG</font> |
| + | |
| + | <font color="green">GAATTCGCGGCCGCTTCTAGA</font><font color="yellow">GTATCAGCAAAAACACTACGGTGGATAATCAGTAAAACCATGAAACTAGAGCCCCGCACACTTGC |
| + | GGGGCTTTTTAATTTTGAATTTCTTTCTTATTAAAACGCCATTTTTCTGATAAATGTATTAGTAGCAATGCGCATGGTGGCATATT |
| + | TGCATCATTTTGCATTTTGCAAATGCGATTTGCAAAATGCGTGCTCAATAAAGCACCAATATGCATCAGGATCGAAGAAAAAAGGC |
| + | GTTTTTAAAAGTTGGCACGCATCGTGCTTTATACAGAT</font><font color="purple">ACTAGAG</font><font color="yellow">AAAGAGGAGAAA</font><font color="green">TACTAGTAGCGGCCGCTGCAG</font> |
| + | |
| + | <font color="red">TCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGC |
| + | TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCA |
| + | GGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA |
| + | CAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG |
| + | CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA |
| + | AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC |
| + | CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAGACACGACTTATCGCCACTG</font> |
| + | |
| + | <b>Sequence of Pqrr4+B0034 (RBS) C9</b> |
| + | |
| + | <font color="red">GGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG</font> |
| + | |
| + | <font color="green">GAATTCGCGGCCGCTTCTAGA</font><font color="yellow">GTATCAGCAAAAACACTACGGTGGATAATCAGTAAAACCATGAAACTAGAGCCCCGCACACTTGC |
| + | GGGGCTTTTTAATTTTGAATTTCTTTCTTATTAAAACGCCATTTTTCTGATAAATGTATTAGTAGCAATGCGCATGGTGGCATATT |
| + | TGCATCATTTTGCATTTTGCAAATGCGATTTGCAAAATGCGTGCTCAATAAAGCACCAATATGCATCAGGATCGAAGAAAAAAGGC |
| + | GTTTTTAAAAGTTGGCACGCATCGTGCTTTATACAGAT</font><font color="purple">ACTAGAG</font><font color="yellow">AAAGAGGAGAAA</font><font color="green">TACTAGTAGCGGCCGCTGCAG</font> |
| + | |
| + | <font color="red">TCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGC |
| + | TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCA |
| + | GGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA |
| + | CAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG |
| + | CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA |
| + | AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC |
| + | CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAGAC</font> |
| | | |
| | | |
|
CAROL
Checking Colony Growth on plates
- No single colonies were found on LB+Kan plates. The transformation was done by using XL Gold Ultracompetent cells and plasmid, pCS26+promoters (NEB Quick Ligase).
- Transformation of pBluescript into both XL Gold and Top 10 cells were successful. Cells grew on LB plates.
|
|
CHINMOYEE
Descriptive Title of What You're Doing
|
|
EMILY
Ethics Meeting with Dr. Wolbring
- Read two papers on Ethics: First a review paper by Keasling called Synthetic Biology for Synthetic Chemistry, which I didn't find super useful as it mostly just focused on defining Synthetic Biology and metabolic engineering. I also started to read Scenarios for the Future of Snthetic Biology by Stephen Aldrich, James Newcomb, and Robert Carlson. I didn't get too far in this, but it seemed slighly more useful, discussing who will play a role in shaping the field of Sythetic Biology.
- At 10:00 a.m. Mandy, Fahd, Stefan and I met with Dr. Wolbring to discuss ethics. It was an interesting meeting and he has given us a better idea of where to go from here. We discussed the write-up that we did for AIF and he agreed to send us a copy of it with his comments sometime today. He also showed us some interesting tools olnline that might help us. One of these was a program called uStream where you can record and broadcast videos and invite people to watch and comment. He suggested that this could be a powerful tool to discuss ethics with other teams and guest speakers. We really liked this idea as an alternative to our conference idea.
Sequencing of J13002-LuxOD47E-B0015
- Today I sent one of my colonies down for sequencing. I sent down J13002-LuxOD47E-B0015 colony 6 with the BBK Reverse Sequencing primer. I'm hoping that this result will come back tomorrow and the presence of the B0015 terminator will be verified in my contruct. If this is the case, then my circuit will be complete!
|
|
FAHD
Descriptive Title of What You're Doing
|
|
IMAN
Descriptive Title of What You're Doing
|
|
JAMIE
Descriptive Title of What You're Doing
|
|
JEREMY
Descriptive Title of What You're Doing
|
|
KATIE
Still in the Lab
A variable has been added to bacterial transformation so that once the quiz is complete, the object is aware of what DNA was taken up by the competent cells and it opens up the possibilities of using other types of DNA for the activity very easily.
I traced through the entire notecard reader script and I now believe I have a firm grasp about what is happening as the program runs. The dataserver event basically is triggered when there is data being handled at different times, so it will check that the data being handled is a line of the notecard and if it is it will add the string of data to a temporary variable. Then it keeps track of the number of lines read in order to request the next line of the notecard, which requires the number. So now I am confident with the use of this script, which lessens my guilt for implementing it.
I was able to edit and add to notecards that Mandy will read when she has time, which include:
- What is DNA?
- What is RNA?
- Translation
- Restriction Digest
- Ligation
I have also started a display for DNA replication for the base of the spiral when I take some time away from working on the virtual lab, which involves animating a lot of objects to represent the enzymes involved as well as all the pieces that will have to be rezzed to make a complementary strand of DNA. The difficulties I will encounter will probably be with having all objects moving at the right times and where they will have to travel.
I have discovered that my restriction digest activity does more that it has to, which is not a bad thing. So people can just play around if they want to ligate promoter and rbs together for practice or it could be walked through in the instructions. The notecard reader has been implemented in the third and final construction site and tomorrow after group meeting I would like to obtain the names of all the materials required so I can finish renaming the general materials for the activity.
|
|
KEVIN
1. Modelling
Have reviewed all the characteristics that were discussed last time and today wrote a detailed overview of why/how we would implement it, with the rest of the modeling team.
2. Yesterday's Sequencing results
Yesterday, I have sent Pqrr4+B0034 (RBS) for sequencing with BBK CP F primers in order to verify the presence of Pqrr4+B0034. This construct will be used to construct our reporter circuit when the part with GFP+LVA tag arrives.
Legend
Vector contamination
BBK Restriction sites
Sequence of interest
Scar
Sequence of Pqrr4+B0034 (RBS) C1
GGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG
GAATTCGCGGCCGCTTCTAGAGTATCAGCAAAAACACTACGGTGGATAATCAGTAAAACCATGAAACTAGAGCCCCGCACACTTGC
GGGGCTTTTTAATTTTGAATTTCTTTCTTATTAAAACGCCATTTTTCTGATAAATGTATTAGTAGCAATGCGCATGGTGGCATATT
TGCATCATTTTGCATTTTGCAAATGCGATTTGCAAAATGCGTGCTCAATAAAGCACCAATATGCATCAGGATCGAAGAAAAAAGGC
GTTTTTAAAAGTTGGCACGCATCGTGCTTTATACAGATACTAGAGAAAGAGGAGAAATACTAGTAGCGGCCGCTGCAG
TCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGC
TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCA
GGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA
CAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG
CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA
AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC
CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAGACACGACTTATCGCCACTG
Sequence of Pqrr4+B0034 (RBS) C9
GGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTG
GAATTCGCGGCCGCTTCTAGAGTATCAGCAAAAACACTACGGTGGATAATCAGTAAAACCATGAAACTAGAGCCCCGCACACTTGC
GGGGCTTTTTAATTTTGAATTTCTTTCTTATTAAAACGCCATTTTTCTGATAAATGTATTAGTAGCAATGCGCATGGTGGCATATT
TGCATCATTTTGCATTTTGCAAATGCGATTTGCAAAATGCGTGCTCAATAAAGCACCAATATGCATCAGGATCGAAGAAAAAAGGC
GTTTTTAAAAGTTGGCACGCATCGTGCTTTATACAGATACTAGAGAAAGAGGAGAAATACTAGTAGCGGCCGCTGCAG
TCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGC
TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCA
GGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA
CAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG
CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA
AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC
CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAGAC
|
|
MANDY
Descriptive Title of What You're Doing
|
|
PATRICK
Descriptive Title of What You're Doing
|
|
PRIMA
Descriptive Title of What You're Doing
|
|
STEFAN
Ethics with Dr. Wolbring
Today was spent having some ethics discussion with Dr. Wolbring. We
talked about synthetic biology being different for Kiesling, Ventor
and Endy. For example, Ventor wants to build an organism from the
bottom up, while Kiesling is more interested in metabolic engineering.
Dr. Wolbring suggested we should keep in mind the economic viability
of our project. What is the reason we are doing this project? Is there
something that is more effective and cheaper than our system for
destroying and preventing biofilm formation? He said the teams don't
really take these things into account and some other things about iGEM
that I didn't really agree with because I feel iGEM is not meant for
useful applications and a product that will sell. We're
undergraduates, I don't think groundbreaking discoveries should be
expected. Anyway, he did offer some help in suggesting some ways we
can go beyond the paper (see Fahd's email).
For Second Life, I fixed up the eukaryotic cell today. I then met with
Max Chatnoir, creator of genome island in order to show her my
endoplasmic reticulum (the Second Life one not one in my body). I did
this because I feel it is important to keep my contacts updated and
also she was having trouble creating one herself. She was super
impressed and I also sent pictures of the lab and synthetic kingdom.
She is excited for the unveiling of our island. Then, she mentioned
that we should join SciLands, a collection of science based islands
that are grouped together in Second Life and Mandy took a look at the
application and we thought this would be an excellent idea.
Tomorrow will consist of the ethics (or lab?) meeting and also the
super secret announcement for Sonja. After that, I will most likely be
continuing my work in the Synthetic Kingdom by brainstorming some more
ideas for engineered cells.
|
|
VICKI
Descriptive Title of What You're Doing
|