"
Team:Todai-Tokyo/Notebook/isoleucine
From 2009.igem.org
Revision as of 00:43, 20 October 2009 by M.Salvador (Talk | contribs)
| Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook | Protocols | Ethics |
|---|
# Clone the yqiT gene from ''Bacillus subtilis'' into a biobrick vector.
# Make constructs that express this gene constitutively and under the control of an inducible promoter.
==6/5== '''Constructs to be created:''' # yqiT
# ptetR-RBS-yqiT-dterm
# pAraC-RBS-yqiT-dterm
# pLacI-RBS-yqiT-dterm
'''Obtaining DNA:''' Resuspended DNA in the following wells with 10ul water: Plate 1 1D
[http://partsregistry.org/wiki/index.php/Part:BBa_R0080 AraC regulated promoter] Plate 1 12E
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 LacI regulated promoter] Plate 1 1H
[http://partsregistry.org/wiki/index.php/Part:BBa_B0030 Strong RBS] Plate 1 13B
[http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 TetR repressed POPS generator] Plate 2 24C
[http://partsregistry.org/wiki/index.php?title=Part:BBa_B0014 Double terminator] Transformed 1ul of each of the above into DH5a competent cells: '''Transformation''' *Mix 1ul of DNA with 100ul of competent cells on ice. *Leave on ice for 30 minutes. *Heat shock at 42°Cfor 45 seconds. *Leave on ice for 2 minutes. *Add 500ul of LB and incubate at 37°C for 1 hour. *Plate on LB-ampicillin plates. == 6/6 == No colonies grew from the 5 transformations of 6/5. == 6/7 == '''Creating a biobrick part out of yqiT''' '''Strategy''': PCR out the yqiT gene from the ''Bacillus subtilis'' genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert: Plate 1 16E (from 2007 iGEM distribution provided by Chiba University)
[http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 GFP generator] '''Overview:'''
# PCR yqiT gene from genome # purify DNA from the PCR product # digest GFP generator and purified PCR product by XbaI/PstI # gel-purify the digested vector (GFP generator without the insert i.e. empty) and the yqiT gene # ligate the above 2 fragments of DNA together # transform into ''E. coli'' and select for ampicillin resistance # check for transformation success using colony PCR by yqiT primers '''PCR of yqiT gene'''
The ''Bacillus subtilis'' genome was provided by Bacillus subtilis 168 The following primers were used to amplify an approx. 1500bp fragment from the ''Bacillus subtilis'' genome. yqiT EX: ccggaattctctaga'''atggaactttttaaatatatggaacgatacg'''(bold text is a sequence binding yqiT gene)
yqiT SP: ctgcagcggccgctactagta'''ttagcgacgacttaaaatatgttgg'''(bold text is a sequence binding yqiT gene) '''PCR protocol'''
The following was mixed in a PCR tube:
1ul 20uM yqiT EX primer
1ul 20uM yqiT SP primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.15ul ''Bacillus subtilis'' genome
0.5ul Pfu Ultra enzyme
13.85ul MilliQ
Performed PCR using the following program: 1. 95°C 2 minutes
2. 95°C 30 seconds
3. 50°C 30 seconds
4. 72°C 40 seconds
5. Repeat 2-4 23 times
6. 25°C forever
Purified PCR product using the Promega PCR purification kit. Ran on gel to visualize bands: [[Image:090607.1.jpg|200px]] PCR unsuccessful: will digest the GFP generator but cannot perform the ligation without the PCR product.
'''Digestion'''
Digested purified PCR product and the GFP generator both with XbaI/PstI: '''yqiT'''
3ul PCR product
1ul High buffer
0.5ul XbaI
0.5ul PstI
5ul MilliQ
'''GFP generator'''
6ul DNA
2ul High buffer
1ul XbaI
1ul PstI
10ul MilliQ
Incubated mixtures at 37°C for 1 hour. Ran on gel to gel purify:
Lanes 1, 12:marker
Lanes 2, 5, 9:GFP
Lanes 3, 6, 10:yqiT
[[Image:090607.2.jpg|300px]] Cut out the second band from the bottom and dissolved the gel using the Promega gel purification kit to extract DNA from. This DNA is stored for later usage as the GFP generator X/P vector fragment. == 6/14 == Creating a biobrick part out of yqiT Strategy: PCR out the yqiT gene from the Bacillus subtilis genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert: Plate 1 1D (from 2009 iGEM distribution provided by Tokyo University) promoter (lacI regulated) Overview: PCR yqiT gene from genome gel-purify DNA from the PCR product digest lacI regulated promoter and purified PCR product by XbaI/PstI gel-purify the digested vector (lacI regulated promoter without the insert i.e. empty) and the yqiT gene ligate the above 2 fragments of DNA together transform into E. coli and select for ampicillin resistance check for transformation success using colony PCR by yqiT primers PCR of yqiT gene The Bacillus subtilis genome was provided by Bacillus subtilis 168 The following primers were used to amplify an approx. 1095bp fragment from the Bacillus subtilis genome. yqiT EX: ccggaattctctagaatggaactttttaaatatatggaacgatacg(bold text is a sequence binding yqiT gene) yqiT SP: ctgcagcggccgctactagtattagcgacgacttaaaatatgttgg(bold text is a sequence binding yqiT gene) PCR protocol The following was mixed in a PCR tube: 1ul 20uM yqiT EX primer 1ul 20uM yqiT SP primer 2ul 10X Pfu Ultra buffer 1.6ul dNTP mix 0.15ul Bacillus subtilis genome 0.5ul Pfu Ultra enzyme 13.75ul MilliQ Performed PCR using the following program: 1. 95°C 2 minutes 2. 95°C 30 seconds 3. 50°C 30 seconds 4. 72°C 40 seconds 5. Repeat 2-4 29 times 6. 25°C forever Purified PCR product using the Promega PCR purification kit. Ran on gel to gel purify: Lanes 1:marker 6ul Lanes 2:yqiT PCR product 10ul + 10xLoading Dye 2ul [[Image:090614.jpg]] PCR successful Ligation Ligated gel purified yqiT and vector with TaKaRa Solutions 1: lacI regulated promoter (vector) 2ul yqiT 8ul TaKaRa Solutions 1 6ul Incubated mixtures at 37°C for 10 minutes. Transformation == 6/21 == '''Creating a biobrick part out of yqiT''' '''Strategy''': PCR out the yqiT gene from the ''Bacillus subtilis'' genome using primers to attach the biobrick preffix/suffix and clone this into a biobrick vector. The vector utilized is the GFP generator which houses a sufficient-sized insert: Plate 1 1D (from 2009 iGEM distribution provided by Tokyo University)
[http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 promoter (lacI regulated)] '''Overview:'''
# PCR yqiT gene from genome # gel-purify DNA from the PCR product # digest lacI regulated promoter and purified PCR product by XbaI/PstI # gel-purify the digested vector (lacI regulated promoter without the insert i.e. empty) and the yqiT gene # ligate the above 2 fragments of DNA together # transform into ''E. coli'' and select for ampicillin resistance # check for transformation success using colony PCR by yqiT primers '''PCR of yqiT gene'''
The ''Bacillus subtilis'' genome was provided by Bacillus subtilis 168 The following primers were used to amplify an approx. 1095bp fragment from the ''Bacillus subtilis'' genome. yqiT EX: ccggaattctctaga'''atggaactttttaaatatatggaacgatacg'''(bold text is a sequence binding yqiT gene)
yqiT SP: ctgcagcggccgctactagta'''ttagcgacgacttaaaatatgttgg'''(bold text is a sequence binding yqiT gene) '''PCR protocol'''
The following was mixed in a PCR tube:
1ul 20uM yqiT EX primer
1ul 20uM yqiT SP primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.15ul ''Bacillus subtilis'' genome
0.5ul Pfu Ultra enzyme
13.75ul MilliQ
Performed PCR using the following program: 1. 95°C 2 minutes
2. 95°C 30 seconds
3. 50°C 30 seconds
4. 72°C 40 seconds
5. Repeat 2-4 29 times
6. 25°C forever
Purified PCR product using the Promega PCR purification kit. Ran on gel to gel purify:
Lanes 6:marker 6ul
Lanes 2, 4:yqiT PCR product 10ul + 10xLoading Dye 2ul
[[Image:090621_1.jpg|200px]] PCR successful
'''Digestion'''
Digested purified PCR product and the lacI regulated promoter both with XbaI/PstI: '''yqiT'''
3ul PCR product
1ul High buffer
0.5ul XbaI
0.5ul PstI
5ul MilliQ
'''lacI regulated promoter'''
4ul DNA
4ul High buffer
2ul XbaI
2ul PstI
28ul MilliQ
Incubated mixtures at 37°C for 1 hour. Ran on gel to gel purify:
Lanes 3:marker 6ul
Lanes 2, 5:lacI regulated promoter 40ul + 10xLoading Dye 8ul
Lanes 1, 4:yqiT 10ul + 10xLoading Dye 2ul
[[Image:090621_2.jpg|200px]] Cut out the band and dissolved the gel using the Promega gel purification kit to extract DNA from. '''Ligation'''
Ligated gel purified yqiT and vector with TaKaRa Solutions 1:
lacI regulated promoter (vector) 0.5ul
yqiT 5.5ul
TaKaRa Solutions 1 4ul
Incubated mixtures at 37°C for 10 minutes. '''Transformation'''
== 7/5 == '''TA cloning of YqiT'''
PCR of YqiT
0.25ul Takara ExTaq
5ul 10xExTaq Buffer
4ul dNTPmix
0.5ul ''Bacillus subtilis'' genome
0.5ul 5'primer(It is the same sequence as that on 6/21)
0.5ul 3'primer(It is the same sequence as that on 6/21)
up to 50ul MilliQ Performed PCR using the following program: 1. 94°C 2 minutes
2. 94°C 30 seconds
3. 52°C 80 seconds
4. 72°C 60 seconds
5. Repeat 2-4 29 times
6. 25°C forever
lane1:marker
lane2~5:YqiT
[[Image:PCR090705.jpg]]
PCR successful!
But we couldn't do ligation because TA cloning kit was not left.
We purified PCR products and put them in -20°C. == 7/19 == YqiT colony PCR
put a small amount of single colony into each tube with 5ul MilliQ water
￬
95°C 5min
￬
PCR reaction
1ul 10×buffer
0.8ul 2.5mMdNTP
0.08ul Ex-Taq
0.1ul 5’-primer
0.1ul 3’-primer
2.92ul MilliQ water
￬
added the PCR reaction to each tube.
￬
Performed PCR using the following program:
1. 95°C 2min
2. 95°C 30sec
3. 52°C 30sec
4. 72.5°C 80sec
5. repeat 2-4 29times
6. 25°C forever
PCR successful!
added a small amount of colony number 2 and 3 to each test tube with 4ml LB broth.
cultured them over night.
=='''7/20'''== Miniprep of E.coli cells containing YqiT gene with Promega, Wizard Plus SV Miniprep DNA Purification System =='''7/27'''== sequencing YqiT by BIG DYE
1.8ul 5xB.D.3.1.buffer
0.4ul B.D.3.1.
6.3ul MilliQ water
1ul plasmid(0.15ug/ul)
0.5ul 5'or3'primer(3.2pmol/ul)
￬
PCR Program
1.96°C 2min
2.96°C 10sec
3.55°C 5sec
4.60°C 3min
5.go to 2.29times
6.25°C forever
￬
add 0.5ul PHOSPHATASE ALKALINE shrimp
￬
37°C 1hr incubate
￬
add 1ul 3MNaOAc
￬
add 25ul EtOH
￬
20000xg 4°C 10min centrifugation
￬
put off supernatant
￬
dry tubes
￬
add 15ul HiDi
￬
put them in the sequence machine
=='''7/30~8/2'''== sequence YqiT by BigDye
unsuccessful
=='''8/3'''== sequence YqiT by BigDye
successful
=='''8/7~9'''== '''Digestion'''
insert YqiT gene into a terminator of iGEM parts
'''terminator'''
double terminator Miniprep., using Promega kit
plate1 23L
=='''8/12~14'''== PCR of YqiT for restriction enzyme fragmentation and infusion
'''PCR protocol'''
The following was mixed in a PCR tube:
0.2ul 100uM yqiT EX primer/yqiT infusion 5'primer
0.2ul 100uM yqiT SP primer/yqiT infusion 3'primer
2ul 10X Pfu Ultra buffer
1.6ul dNTP mix
0.2ul plasmid containing YqiT gene(that sequence matches YqiT gene of Batillus genome)
0.5ul Pfu Ultra enzyme
15.3ul MilliQ
Performed PCR using the following program: 1. 95°C 2 minutes
2. 95°C 30 seconds
3. 55°C 30 seconds
4. 72.5°C 30 seconds
5. Repeat 2-4 29 times
6. 25°C forever
restriction enzyme fragmentation of double terminator by XbaI
1ug plasmid
10ul BSA
10ul 10xM buffer
2.5ul XbaI
up to 100ul MilliQ water
37°C over night
restriction enzyme fragmentation of double terminator by EcoRI
1ug plasmid
10ul 10xH buffer
2.5ul EcoRI
up to 100ul MilliQ water
37°C over night
restriction enzyme fragmentation of YqiT gene by SpeI
1ug DNA
10ul 10xH buffer
2.5ul SpeI
up to 100ul MilliQ water
37°C over night
restriction enzyme fragmentation of YqiT gene by EcoRI
1ug DNA
10ul 10xH buffer
2.5ul EcoRI
up to 100ul MilliQ water
37°C over night
=='''8/15,16'''== ligate YqiT and double terminator
=='''August'''== Aim
'''We decided to use YqiT as a reporter of dioxin!'''
So, we began to create this construct
1.-XRE-Gal1 promoter-yqiT-
2.-Ahr-←Gal1promoter/Gal10 promoter→-Arnt-
*PCR of yqiT and insert it in iGEM parts(plate 1-7D:Gal1 promoter)
Performed PCR using the following program:
1. 95°C 2 minutes
2. 95°C 30 seconds
3. 55°C 30 seconds
4. 72.5°C 30 seconds
5. Repeat 2-4 29 times
6. 25°C forever
*cut YqiT off with EcoRI and SpeI
*cut P1-7D off with EcoRI and XbaI
*ligate the upper two DNA
=='''September'''== *read the sequence of Gal1 promoter+yqiT
→the result conforms with NCBI datebase
*insert XRE in P1-7D including yqiT using infusion kit(clonthech)
---- '''Aim'''
TA cloning of Ahr, Arnt and gal1/10 promoter
*PCR of Ahr and Arnt for TA cloning(Ex-taq , Funakoshi)
template:human Ahr cDNA and human Arnt cDNA
1,95°C 2min
2,95°C 30sec
3,55°C 30sec
4,72.5°C 1.5min
5,go°C to 2, 29times
6,25°C forever
=='''October'''='em *PCR of gal1/10 promoter (Ex-taq , Funakoshi)
template:S.serevisiae genome DNA
1,95°C 2min
2,95°C 30sec
3,55°C 30sec
4,72.5°C1min
5,go°C to 2, 29times
6,25°C forever
*TA cloning of Ahr, Arnt and gal1/10 promoter
ligate PCR product and T bector
￬
put each plasmid into different E.coli
￬
Miniprep of them by using Promega kit
￬
read each sequence in order to check whether there is plasmids including Ahr, Arnt or gal1/10 promoter
---- '''Aim'''
*check YqiT expression
Using iGEM parts, create the construct that produces YqiT steadily or reguratory
P2-10F-YqiT-double terminator
P2-16E-YqiT-double terminator
P1-22A-YqiT-double terminator
P1-21B-YqiT-double terminator
cut YqiT-double terminator off with XbaI and PstI
cut P2-10F, P2-16E, P1-22A and P1-21B off with SpeI and PstI
￬
ligate YqiT-double terminator and iGEM part
￬
put each plasmid into different E.coli
￬
Miniprep of them by using Promega kit
￬
read each sequence in order to check whether there is plasmids including the construct
{{:Team:Todai-Tokyo/Template}}
