Team:Warsaw/Glossary

From 2009.igem.org

Revision as of 09:06, 15 October 2009 by Smaegol (Talk | contribs)


Glossary

A

apoptosis

Apoptosis is a natural process of programmed cell death. Apoptosis can be induced by many factors and its function is to remove damaged and unnecessary cells from the organism. In our project we want to induce apoptosis of tumor cells, using p53 or bax proteins, both involved in control of this process
Overview of basic signal transduction pathways.
A section of mouse liver stained to show cells undergoing apoptosis (orange)

B

bax

Soluble form of bax protein
Bcl-2–associated X protein (bax) is a pro-apoptotic protein. Although it's found mainly in the cytosol, upon initiation of apoptosis it's shifted to organellar membranes. It's believed that bax is responsible for opening special channels in the mitochondrial outer membrane, causing release of pro-apoptotic factors like cytochrome c. These proteins subsequently assembly a multiprotein complex named apoptosome which activated special proteases called caspases which destine the cell to apoptosis.

C

cI

This protein is also known as the lambda repressor. cI is sole protein expressed in the lysogenic state of Lambda phage. It act as transcription inhibitor which binds to specific sites in phage genome. At low concentrations blocks the pR promoter (preventing cro production). At high concentrations downregulates its own production through OR3 binding
.

comparative modeling

These methods use previously solved structures as templates. This methodology is effective because of appearance only a limited set of tertiary structural motifs to which most proteins belong. These methods may be split into two groups:
Homology modeling is based on the assumption that two homologous proteins will share very similar structures. Because a protein's fold is more evolutionarily conserved than its amino acid sequence, a target sequence can be modeled with reasonable accuracy on a very distantly related template, provided that the relationship between target and template can be discerned through sequence alignment.
Protein threading analyse the amino acid sequence of an unknown structure against a database of solved structures. In each case, a scoring function is used to assess the compatibility of the sequence to the structure, thus yielding possible three-dimensional models.

cro

Cro repressor is a small dimeric protein which binds to specific sites on the DNA of bacteriophage lambda. Fragment of the phage DNA that is recognized by cro is known as cro-box. Recognition of specific DNA binding sites appears to occur via multiple hydrogen bonds between amino acid side chains of the protein and base pair atoms exposed within the major groove of DNA. Cro act as a transcription inhibitor which binds OR3, OR2 and OR1 sites. At low concentrations blocks the pRM promoter preventing cI production. At high concentrations downregulates its own production through OR2 and OR1 binding.
Cro is a very small protein composed of 61 aminoacids
Interaction between cro and DNA

cro-box

Cro-box is the particular fragment of phage lambda DNA which is recognized by aforementioned cro repressor. In our project we used artificial designed cro-box sequence:
 5' ATCTAGATACCTCTGGCGGTGATACTAGTGT 3'

cytochrome C oxidase

The enzyme cytochrome c oxidase or Complex IV is a large transmembrane protein complex found in bacteria and the mitochondrion. It is the last enzyme in the respiratory electron transport chain located in the mitochondrial (or bacterial) membrane. It receives an electron from each of four cytochrome c molecules, and transfers them to one oxygen molecule, converting molecular oxygen to two molecules of water. In the process, it binds and translocates four protons across the membrane, helping to establish a transmembrane proton concentration gradient which is crucial for the ATP synthase to synthesize ATP.
Cytochrome c oxidase complex. Each subunit is depicted using different color.
Subunit VII of the complex has signal pepting which has been used in our project

D

de novo modeling

De novo protein modelling methods attempt to build three-dimensional protein models based on physical principles. There are few possible procedures that are able to reconstruct folding pathway or apply some stochastic method to search native conformations. These procedures tend to require vast computational resources, and have thus only been carried out for small proteins.

E

endosome

Endosomes in mammalian cell
endosome is a membrane-bound compartment inside cells which is responsible for the sorting of ematerial previously endocytosed by the cell, before transport to lysosomes. This allows some material to be returned to the plasma membrane.

G

Green Fluorescent Protein

The green fluorescent protein (GFP) is protein which exhibits intensive green fluorescence when exposed to blue light. Although many other marine organisms have similar green fluorescent proteins, GFP traditionally refers to the protein first isolated from the jellyfish Aequorea victoria. The GFP from A. victoria has a major excitation peak at a wavelength of 395 nm and a minor one at 475 nm. Its emission peak is at 509 nm which is in the lower green portion of the visible spectrum. In the field of cell and molecular biology, the GFP gene is frequently used as a reporter of expression. Many different mutants of GFP have been engineered since their potential for widespread usage. The collection of the mutagenized forms include many color mutants.
Yellow fluorescent protein
Focus on the fluorescent center

I

integrins

Integrins are cellular receptors that mediate attachment between a cell and the tissues surrounding it, which may be other cells or the extracellular matrix (ECM). They are also involved in cell signaling and thereby define cellular shape, mobility, and regulate the cell cycle. Many types of integrin exist, and some cells have multiple types of integrins on their surface. Integrins are of vital importance to all animals and have been found in each investigated animal plylum. Several integrin types are recognized by invasins, bacterial surface proteins which are responsible for entrance of bacterium into the cell.
Integrin β 1 which is recognized by invasin.
Fragment of integrin β V structure.

internalin

Internalins are surface proteins found on Listeria monocytogenes. There are two diiferent forms of these proteins, InlA and InlB. Both of them are used by the bacteria to invade mammalian cells via cadherins transmembrane proteins which exist on the cellular membrane. The exact role of these proteins and their invasiveness in vivo is in not yet completely understood. In cultured cells, InlA is necessary to facilitate Listeria entry into human epithelial cells. However InlB is necessary for bacterial cell internalisation in several other cell types, including hepatocytes and fibroblasts.
Structure of internalin B
Internalin B (orange) interacting with cadherin E (violet)


invasin

Structure of invasin from Yersinia pseudotuberculosis
Invasin is one of proteins crucial for pathogenic features of enteropathogenic bacteria like Yersinia sp. or Salmonella sp. Invasin interacts with integrins, receptors occuring on the surface of eukariotic cell membrane, what triggers signalling cascade leading to endocytosis of whole pathogenic bacteria.
"Head domain" responsible for interaction with integrins

L

lacI

Dimer of LacI with IPTG molecules (white)
LacI protein bound to DNA
The lac repressor is a bacterial DNA-binding protein which inhibits the expression of genes which encode proteins involved in the metabolism of lactose. It is active in the absence of lactose, ensuring that the bacterium only invests its resources for the synthesis of proteins required for the uptake and metabolism of lactose when this saccharide is found in the environment. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.

listeriolysin

Pore formed by 12 molecules of hemolysin
Structure of hemolysin which is close related to listeriolysin
Listeriolysin O (LLO) is a pore-forming protein from Listeria monocytogenes which belong to hemolysin family.The protein is selectively activated within the acidic phagosomes (average pH ~ 5.9) of cells that have phagocytosed L. monocytogenes. After LLO lyses the phagosome, the bacterium escapes into the cytosol, where it can grow intracellularly. Upon release from the phagosome, the toxin has reduced activity in the more basic cytosol.

M

mgtc gene promoter

This is one of the Salmonella typhimurium PhoP-dependent promoters. MgtC gene is a virulence factor in Salmonella typhimurium that is required for growth at low-Mg2+ concentrations and intramacrophage survival

mitochondrial diseases

Regions of the mtDNA connected to particular disorders
Mitochondrial diseases are a group of disorders relating to the interrupted function of the mitochondrion. They are comprise those disorders that affect the function of the proteins in the mitochondria or are due to mitochondrial DNA damage. Mitochondrial diseases take on unique characteristics both because of the way the diseases are often inherited and because mitochondria are pivotal to cell survivability. The subclass of these diseases that have neuromuscular disease symptoms are often referred to as a mitochondrial myopathy.

P

p53

structure of monomeric p53 protein
Dimeric form of p53 interacting with DNA
p53 is a protein well-known for people interested in cancer. p53 is a tumor suppressor and main factor involved in control of cell-cycle, mutated in more than half of tumors. Some data shows that presence of p53 in mitochondria is able to induce apoptosis.

phoP/PhoQ

PhoP/PhoQ is a two-component regulatory system which controls the virulence of Salmonella typhimurium. Under conditions of low pH and/or low metal ions concentration PhoP activates promoters responsible for virulence and survival of Salmonella within macrophages, like the promoter of mgtc gene. Whole system will be used to control bacteria escape from endosome

T

Type I secretion system

Type I secretion system (TOSS) is a simple system, which consists of only three protein subunits: the ABC protein, membrane fusion protein (MFP), and outer membrane protein (OMP). Type I secretion system transports molecules of various size, from ions, drugs to even large proteins. The best characterized proteins secret via TOSS are the RTX toxins and the lipases. Type I secretion is also involved in export of non-proteinaceous substrates like cyclic β-glucans and polysaccharides. Many secreted proteins are particularly important in bacterial pathogenesis.
Tetrameric ABC protein
ABC protein binding site and ATP molecule (white)

TetR

TetR is an abbreviation of a family of bacterial transcriptional regulators which control the expression of genes responsible for resistance against tetracycline. Tetracyclines are amid of the most commonly used antibiotics and many gram-negative bacteria have developed mechanism of resistance against these antibiotics. The most abundant mechanism involved a membrane-associated proteins which exports tetracycline out of the bacterial membrane before it may act within the cell.
TetR protein with tetracycline molecule (silver)
TetR protein bound to single-stranded DNA