Team:KULeuven/Freezer
From 2009.igem.org
Contents |
Blue light receptor
part | plasmid | description | status | μl left | concentration | date |
---|---|---|---|---|---|---|
MC4100 | / | strain of E.coli | july 24 | |||
2171 | / | forward primer for K23800 | 90µl | 20μM | july 24 | |
2172 | / | reverse primer for K23800 | 90µl | 20μM | july 24 | |
2171 | / | forward primer for K238000 | 100μM | july 24 | ||
2172 | / | reverse primer for K238000 | 100μM | july 24 | ||
E0240 | pSB1A2 | GFP + rbs + terminator | purified | july 29 | ||
E0240 | pSB1A2 | GFP + rbs + terminator | restricted with EcoRI and XbaI | july 29 | ||
/ | BLR promoter region | restricted with EcoRI | july 29 | |||
K238000 | / | BLR promoter region | 4 microcentrifuge tubes | july 30 |
Key/antikey/lock
part | plasmid | description | status | μl left | concentration | date |
---|---|---|---|---|---|---|
/ | GFP with LVA tag | purified | july 28 | |||
/ | tetR promoter | purified | july 28 |
vanillin synthesis
part | plasmid | description | status | μl left | concentration | date |
---|---|---|---|---|---|---|
pSB1A2 | ech + rbs | put in competent cells | july 28 | |||
pSB1A2 | fcs + rbs | put in competent cells | july 28 |
vanillin receptor
part | plasmid | description | status | μl left | concentration | date |
---|
miscellaneous
part | plasmid | description | status | μl left | concentration | date |
---|---|---|---|---|---|---|
dNTP mix | ATP, GTP, TTP, CTP | 94 | 10μM | July 24 | ||
pSB1A2 | medium constitutieve promoter | July 23 | ||||
ampicilline |
Primers
Number | Name | Sequence | Length | Tm (°C) | Comments |
---|---|---|---|---|---|
2171 | BLR promoter fw | CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC | 46 | 52.4 | it has a catcat en prefix (not in Tm included) |
2172 | BLR promoter rv | CTGCAGCGGCCGCTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG | 51 | 52.1 | it has a suffix (not in Tm included) |