"
Team:Bologna/Project
From 2009.igem.org
| HOME | TEAM | PROJECT | SOFTWARE | MODELING | WET LAB | PARTS | HUMAN PRACTICE | JUDGING CRITERIA |
|---|
(Trans-Repressor of Expression)
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in E. coli, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device T-REX (Trans Repressor of Expression).
T-REX consists of two new BioBricks:
- CIS-repressing, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site (RBS);
- TRANS-repressor, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a RBS cover, released in two versions of different length (either 4 or 7 nucleotides).
The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (see Fig. 1, left panel). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS RNA duplex prevents ribosomes from binding to RBS on target mRNA, thus silencing protein synthesis. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (see Fig. 1, right panel)
CIS and TRAN Parts Design
To identify CIS-repressing and TRANS-repressor complementary parts, we developed BASER software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing);
b) have minimal unwanted interactions with genomic mRNA;
c) present a minimal probability of partial/shifted hybridization with complementary strands.
Here below are the CIS-repressing and TRANS-repressor sequences:
| CIS-repressing | |||
| Prefix | non-coding TRANS target | RBS | Suffix |
| GAATTCGCGGCCGCTTCTAGAG | AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC | AAAGAGGAGAAA | TACTAGTAGCGGCCGCTGCAG |
| TRANS-repressor (4) | |||
| Prefix | RBS cover | non-coding TRANS | Suffix |
| GAATTCGCGGCCGCTTCTAGAG | CTTT | GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT | TACTAGTAGCGGCCGCTGCAG |
| TRANS-repressor (7) | |||
| Prefix | RBS cover | non-coding TRANS | Suffix |
| GAATTCGCGGCCGCTTCTAGAG | CCTCTTT | GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT | TACTAGTAGCGGCCGCTGCAG |
More details about BASER and its functioning can be found in the software section.
Testing Circuit
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator.
If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.
Mathematical Model
In order to characterize the T-REX device, we developed a mathematical model of the parts and we simulated the response of the testing circuit. (LINK)
- é PARTE MODELLO***
Testing Circuit's Positive Control
To have a positive control, we designed a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle or for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.
Characterization???
Before realizing the whole Testing Circuit, we decided to characterize the constitutive parts with intermediate circuits. Data from this analysis were used to test the model of parts and to assign the model parameters.
pSB1A2 vs pSB3K3
- In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3:
 |  |
BBa_J23100 vs BBa_J23118
- In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:
 |  |
Presence vs Absence of LacI natural operator O2
- We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001
| |  |
Interaction of LacI repressor with its natural operator O2
- We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:
 |
