"
Team:Illinois/MicF
From 2009.igem.org
MicF Target-GFP Fusion
Purpose: MicF will be fused to the target sequence from the OmpF gene to the GFP gene on a low-copy plasmid and transform this into E. coli cells along with a high-copy plasmid carrying the MicF gene. We expect to see translational repression of GFP by the small RNA MicF.
Protocol(s) Used: (links to protocols page)
Recipe(s) Used:
Primers Used:
- Forward MicF (sRNA gene) primer: (5') 5'p+GCTATCATCATTAACTTTATTTATTACCG
- Reverse Primer: (5') GTTTTTTCTAGAGGTAGCACAGAATAATGAAA
June 16
We used PCR to extract the sRNA gene: MicA and target sequence : ompA. from the e.coli chromosome. We then ran a gel to make sure that we had the right DNA fragments. Our results corresponded to our predictions.
June 17
We are completing a digestion of MicF and OmpF. Following the digestion we will incubate with Shrimp Alkanline Phosphatase and then run a gel to verify the digestion. We will then extract the DNA for the sRNA target sequence and sRNA gene.
