"
EPF-Lausanne/6 July 2009
From 2009.igem.org
(→06.07.09) |
(→06.07.09) |
||
| Line 12: | Line 12: | ||
| - | 06.07.09 | + | ===06.07.09=== |
| - | + | ||
Four forward primers were designed to amplify: | Four forward primers were designed to amplify: | ||
| - | 1.Promoter T7, RBS, CBP and LOVTAP: | + | <br> 1.Promoter T7, RBS, CBP and LOVTAP: |
| - | + | :gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg | |
| - | + | 2.RBS, CBP and LOVTAP: | |
| - | + | :gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag | |
| - | 2.RBS, CBP and LOVTAP: | + | 3.CBP and LOVTAP: |
| - | + | :gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag | |
| - | + | 4.LOVTAP: | |
| - | + | :gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac | |
| - | 3.CBP and LOVTAP: | + | One reverse primer were designed: |
| - | + | :gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc | |
| - | + | ||
| - | + | ||
| - | 4.LOVTAP: | + | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | One reverse primer were designed: | + | |
| - | + | ||
| - | + | ||
| - | The recipient IGEM part have been chosen: BBa_B0010, well 13D in the received kit plate 1 | + | The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1 |
Revision as of 15:35, 27 July 2009
06.07.09
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
LOVTAP is in a plasmid called pCal-n (see picture below):
Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
06.07.09
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
