http://2009.igem.org/wiki/index.php?title=Special:Contributions/Elisa.passini&feed=atom&limit=50&target=Elisa.passini&year=&month=2009.igem.org - User contributions [en]2024-03-29T11:11:49ZFrom 2009.igem.orgMediaWiki 1.16.5http://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:49:11Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1).<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. <br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig.6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br><br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
<br />
<br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
[[Image:table2547.png|center|thumbnail|500 px|<center><font size="4">Table 5 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To have a positive control of the testing circuit, we characterized another circuit (Fig. 12) that simulates the behaviour of testing circuit when the T-REX device is idle for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br />
[[Image:LACi_GFP2_tag_02.png|center|thumbnail|800 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 13) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.13 - Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.14).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.14 - Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 15 and 16, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|<center><font size="4">Fig.15 - Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.</font></center>]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|<center><font size="4">Fig.16 - Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.</font></center>]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|<center><font size="4">Fig. 17 - Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase</font></center>]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 17; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b>Model Prediction of Testing Circuit</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To test T-REX device, we developed the genetic circuit (Fig. 18) <br />
[[Image:Circuit2OK.jpg|center|800px|thumb|<center><font size="4">Fig.18 - Testing Circuit</font></center>]]<br />
<br><br />
After identification of model parametres, the GFP levels as a function of TRANS/CIS affinity was predicted by simulating the whole test circuit (Fig. 19)<br />
[[Image:cistrans.jpg|center|600px|thumb|<center><font size="4">Fig.19 - Model prediction of testing circuit GFP level</font></center>]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:47:44Z<p>Elisa.passini: /* Model Prediction of Testing Circuit */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1).<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. <br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig.6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br><br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
<br />
<br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
[[Image:table2547.png|center|thumbnail|500 px|<center><font size="4">Table 5 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To have a positive control of the testing circuit, we characterized another circuit (Fig. 12) that simulates the behaviour of testing circuit when the T-REX device is idle for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br />
[[Image:LACi_GFP2_tag_02.png|center|thumbnail|800 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 13) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.13 - Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.14).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.14 - Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 15 and 16, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|<center><font size="4">Fig.15 - Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.</center></font>]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|<center><font size="4">Fig.16 - Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.</font></center>]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|<center><font size="4">Fig. 17 - Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase</font></center>]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 17; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b>Model Prediction of Testing Circuit</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To test T-REX device, we developed the genetic circuit (Fig. 18) <br />
[[Image:Circuit2OK.jpg|center|800px|thumb|<center><font size="4">Fig.18 - Testing Circuit</font></center>]]<br />
<br><br />
After identification of model parametres, the GFP levels as a function of TRANS/CIS affinity was predicted by simulating the whole test circuit (Fig. 19)<br />
[[Image:cistrans.jpg|center|600px|thumb|<center><font size="4">Fig.19 - Model prediction of testing circuit GFP level</font></center>]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:47:10Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1).<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. <br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig.6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br><br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
<br />
<br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
[[Image:table2547.png|center|thumbnail|500 px|<center><font size="4">Table 5 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To have a positive control of the testing circuit, we characterized another circuit (Fig. 12) that simulates the behaviour of testing circuit when the T-REX device is idle for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br />
[[Image:LACi_GFP2_tag_02.png|center|thumbnail|800 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 13) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.13 - Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.14).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.14 - Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 15 and 16, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|<center><font size="4">Fig.15 - Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.</center></font>]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|<center><font size="4">Fig.16 - Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.</font></center>]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|<center><font size="4">Fig. 17 - Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase</font></center>]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 17; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b>Model Prediction of Testing Circuit</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To test T-REX device, we developed the genetic circuit (Fig. 18) <br />
[[Image:Circuit2OK.jpg|center|600px|thumb|<center><font size="4">Fig.18 - Testing Circuit</font></center>]]<br />
<br><br />
After identification of model parametres, the GFP levels as a function of TRANS/CIS affinity was predicted by simulating the whole test circuit (Fig. 19)<br />
[[Image:cistrans.jpg|center|600px|thumb|<center><font size="4">Fig.19 - Model prediction of testing circuit GFP level</font></center>]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:43:42Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1).<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. <br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig.6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br><br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
<br />
<br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
|[[Image:table2547.png|center|thumbnail|385 px|<center><font size="4">Table 5 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
As shown in Table 5, <br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To have a positive control of the testing circuit, we characterized another circuit (Fig. 12) that simulates the behaviour of testing circuit when the T-REX device is idle for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br />
|[[Image:LACi_GFP2_tag_02.png|center|thumbnail|385 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 13) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.13 - Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.14).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.14 - Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 15 and 16, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|<center><font size="4">Fig.15 - Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.</center></font>]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|<center><font size="4">Fig.16 - Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.</center></font>]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|<center><font size="4">Fig. 17 - Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase</center></font>]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 17; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b>Model Prediction of Testing Circuit</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To test T-REX device, we developed the genetic circuit (Fig. 18) <br />
[[Image:Circuit2OK.jpg|center|600px|thumb|<center><font size="4">Fig.18 - Testing Circuit</center></font>]]<br />
<br><br />
After identification of model parametres, the GFP levels as a function of TRANS/CIS affinity was predicted by simulating the whole test circuit (Fig. 19)<br />
[[Image:cistrans.jpg|center|600px|thumb|<center><font size="4">Fig.19 - Model prediction of testing circuit GFP level</center></font>]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:42:46Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1).<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. <br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig.6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br><br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
<br />
<br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
|[[Image:table2547.png|center|thumbnail|385 px|<center><font size="4">Table 5 - Fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
As shown in Table 5, <br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To have a positive control of the testing circuit, we characterized another circuit (Fig. 12) that simulates the behaviour of testing circuit when the T-REX device is idle for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br />
|[[Image:LACi_GFP2_tag_02.png|center|thumbnail|385 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 13) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.13 - Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.14).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.14 - Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 15 and 16, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|<center><font size="4">Fig.15 - Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.</center></font>]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|<center><font size="4">Fig.16 - Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.</center></font>]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|<center><font size="4">Fig. 17 - Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase</center></font>]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 17; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b>Model Prediction of Testing Circuit</b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* To test T-REX device, we developed the genetic circuit (Fig. 18) <br />
[[Image:Fluorescenza1.png|center|600px|thumb|<center><font size="4">Fig.18 - Testing Circuit</center></font>]]<br />
<br><br />
After identification of model parametres, the GFP levels as a function of TRANS/CIS affinity was predicted by simulating the whole test circuit (Fig. 19)<br />
[[Image:cistrans.jpg|center|600px|thumb|<center><font size="4">Fig.19 - Model prediction of testing circuit GFP level</center></font>]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/Human_Practice/ResultsTeam:Bologna/Human Practice/Results2009-10-22T03:32:08Z<p>Elisa.passini: </p>
<hr />
<div>{{template:BolognaTemplate}}<br />
<br />
<br />
= Survey Results =<br />
<font size="5"><br />
'''438 people''' answered to our survey!<br><br>'''</font><br />
<font size="3"><br />
Here below is shown a brief summary of the results<br><br />
</font><br />
<br />
== <font size="4">'''Part I'''</font> ==<br />
<font size="3"><br />
The first part aims to collect some information about our interviewed:<br><br><br />
</font><br />
{|align="center"<br />
|[[Image:torta1.png|500px|thumb|left|<b>1) Age </b>]]<br />
|[[Image:torta2.png|500px|thumb|right|<b>2) Gender</b>]]<br />
|}<br />
{|align="center"<br />
|[[Image:torta3.png|500px|thumb|left|<b>3) Degree</b>]]<br />
|[[Image:torta4.png|500px|thumb|right|<b>4) Interests</b>]]<br />
|}<br />
[[Image:torta5.png|500px|thumb|center|<b>5) Location</b>]]<br />
<br />
[https://2009.igem.org/Team:Bologna/Human_Practice/Results ''Up'']<br />
<br />
== <font size="4">'''Part II: Synthetic Biology'''</font> ==<br />
<font size="3"><br />
The second part aims to collect some information about Synthetic Biology in general:<br><br><br />
</font><br />
<br />
{|align="center"<br />
|[[Image:torta6.png|500px|thumb|left|<b>6) Have you ever heard of Synthetic Biology before? </b>]]<br />
|[[Image:torta7.png|500px|thumb|right|<b>7) Are you curious about it?</b>]]<br />
|}<br />
{|align="center"<br />
|[[Image:torta8.png|500px|thumb|left|<b>8) Do you think is proper to use and eventually modify microrganisms (bacteria, yeasts) to produce something usefull to mankind?</b>]]<br />
|[[Image:torta9.png|500px|thumb|right|<b>9) Would you agree with a future extension toward more complex living beings, as animals or plants?</b>]]<br />
|}<br />
{|align="center"<br />
|[[Image:torta10.png|500px|thumb|left|<b>10) Does the idea of living beings as "programmable machine" worry you?</b>]]<br />
|[[Image:torta11.png|500px|thumb|right|<b>11) Could a deeper knowledge increase your confindence in Synthetic Biology?</b>]]<br />
|}<br />
[https://2009.igem.org/Team:Bologna/Human_Practice/Results ''Up'']<br />
<br />
== <font size="4">'''Part III: Implications of Synthetic Biology'''</font> ==<br />
<font size="3"><br />
The third part aims to collect some information about ethical implications of Synthetic Biology:<br><br><br />
</font><br />
<br />
{|align="center"<br />
|[[Image:torta12.png|500px|thumb|left|<b>12) Do you think right that the procedures to make synthetic biological systems and devices are open source?</b>]]<br />
|[[Image:torta13.png|500px|thumb|right|<b>13) Are collective benefits a "right aim" for genetically modifying organisms?</b>]]<br />
|}<br />
{|align="center"<br />
|[[Image:torta14.png|500px|thumb|left|<b>14) Do you think that an economic value can be assigned to products realized with living materials?</b>]]<br />
|[[Image:torta15c.png|500px|thumb|right|<b>15) Are organisms fabricated in laboratory different from the ones existing in nature?</b>]]<br />
|}<br />
{|align="center"<br />
|[[Image:torta16.png|500px|thumb|left|<b>16) Do you agree with public funding of Synthetic Biology research?</b>]]<br />
|[[Image:torta17.png|500px|thumb|right|<b>17) Should Universities offer courses of Synthetic Biology?</b>]]<br />
|}<br />
[https://2009.igem.org/Team:Bologna/Human_Practice/Results ''Up'']<br />
<br />
== <font size="4">'''Part IV: iGEM and the UniBO iGEM Team 2009'''</font> ==<br />
<font size="3"><br />
The last part aims to collect some information about ethical implications of our project and about our team in general:<br><br><br />
</font><br />
<br />
{|align="center"<br />
|[[Image:torta18.png|500px|thumb|left|<b>18) Do you agree with University of Bologna partecipation to this international competition?</b>]]<br />
|[[Image:torta19.png|500px|thumb|right|<b>19) UniBO iGEM Team 2009's project aims to realize a protein synthesis regulation system in Escherichia coli that is independent from regulated protein and acts at translational level, to make the control action faster. Does that seem important to you?</b>]]<br />
|}<br />
{|align="center"<br />
|[[Image:torta20.png|500px|thumb|left|<b>20) Do you think this project has ethical implications? </b>]]<br />
|[[Image:torta21.png|500px|thumb|right|<b>21) Do you think this project involves risks for humans or the environment?</b>]]<br />
|}<br />
[[Image:torta22.png|500px|thumb|center|<b>22) What do you think about what we are doing?</b>]]<br />
<br />
[https://2009.igem.org/Team:Bologna/Human_Practice/Results ''Up'']<br />
<br />
<font size="3"><br />
The survey ended with the open question: <b>Now that you have completed this survey, what are your impressions?</b><br />
</font><br />
<br><br><br />
Most of the comments revealed a general lack of knowledge of Synthetic Biology, since many people hadn't ever heard of this subject before the survey. Despite this, most people expressed curiosity about Synthetic Biology in general and especially in iGEM. Since the respondents were mostly from Italy, they were very happy for University of Bologna <br />
partecipation to iGEM and very excited for our project. As for the ethical implications, most of people recognized the importance of a responsible and conscious use of Synthetic Biology:<br />
<br><br><br />
<font size="5"><center><br />
<b>''Remember: with great power comes great responsibility.''<br />
</b></center><br />
<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Human_Practice/Results ''Up'']</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:24:06Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1).<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. <br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br><br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
<br />
<br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* To have a positive control of the testing circuit, we characterized another circuit (Fig. 12) that simulates the behaviour of testing circuit when the T-REX device is idle for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br />
|[[Image:LACi_GFP2_tag_02.png|center|thumbnail|385 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 13) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.13 - Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.14).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.14 - Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 15 and 16, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.15 - Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.16 - Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig. 17 - Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 17; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:17:40Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1).<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. <br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br><br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
<br />
<br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We analyzed :<br />
<br><br />
|[[Image:LACi_GFP2_tag_02.png|center|thumbnail|385 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 1) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.1. Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.2).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.2. Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 3 and 4, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.3. Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.4. Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig.5. Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 5; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:08:49Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We analyzed then BBa_K201001 with BBa_K201002:<br />
<br><br />
|[[Image:LACi_GFP2_tag_02.png|center|thumbnail|385 px|<center><font size="4">Figura 12 - BBa_K201001 with BBa_K201002</font></center>]]<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 1) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.1. Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.2).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.2. Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 3 and 4, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.3. Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.4. Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig.5. Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 5; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T03:03:44Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 2b - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 3 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 4) and fluorescence level (Fig. 5) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 6.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.4 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.5 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.6 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 6). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 7): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 7a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 7b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 9 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|400px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 10b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figura 11a - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|<center><font size="4">Figura 11b - BBa_K201001 bacterial cells</font></center>]]<br />
|}<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 1) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.1. Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.2).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.2. Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 3 and 4, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.3. Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.4. Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig.5. Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 5; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:57:26Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2 - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 3 - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 4 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 5) and fluorescence level (Fig. 6) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 7.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|<center>Fig.5 - Growth curve</center>]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|<center>Fig.6 - Fluorescence</center>]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|<center>Fig.7 - Fluorescence curve over OD</center>]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 7). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 8): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font size="4">Figure 8a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font size="4">Figure 8b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 9a - BBa_K201003 on pSB1A2 bacterial cells</font></center>]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|<center><font size="4">Figure 9b - BBa_K201003 on pSB3K3 bacterial cells</font></center>]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
[[Image:plasmidi.png|center|thumbnail|700px|<center><font size="4">Table 3 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:boxplotplasmidi.png|center|thumbnail|700px|<center><font size="4">Figure 10 - Box Plot of Table 3 data</font></center>]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px<center><font size="4">Table 4 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br><br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 1) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.1. Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.2).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.2. Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 3 and 4, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.3. Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.4. Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig.5. Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 5; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:49:21Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 1):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 1a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 1b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 2 - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 3 - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 4 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 5) and fluorescence level (Fig. 6) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 7.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|Fig.5 - Growth curve]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|Fig.6 - Fluorescence]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|Fig.7 - Fluorescence curve over OD]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 7). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 1) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.1. Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.2).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.2. Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 3 and 4, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.3. Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.4. Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig.5. Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 5; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:45:52Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 2):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 2a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 2b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500/gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 3 - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 4 - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 5 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 3) and fluorescence level (Fig. 4) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 5.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|Fig.3 - Growth curve]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|Fig.4 - Fluorescence]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|Fig.5 - Fluorescence curve over OD]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 5). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br><br />
=<font face="Calibri" font size="5" color="#000000"><b>LacI induction response</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 1) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.1. Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.2).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.2. Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 3 and 4, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.3. Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.4. Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig.5. Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 5; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:43:50Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 2):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 2a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 2b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500/gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 3 - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 4 - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 5 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 3) and fluorescence level (Fig. 4) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 5.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|Fig.3 - Growth curve]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|Fig.4 - Fluorescence]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|Fig.5 - Fluorescence curve over OD]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 5). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br><br />
Dh5alpha cells were co-transformed with the [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] on a high copy number plasmid (pSB1A2) and BBa_K201002 on a low copy number plasmid (pSB3K3). To characterize this device and its sensitivity to the inducer, we studied both the static and the dynamic response to IPTG induction.<br />
<br />
'''Static response'''<br />
Dh5alpha were inoculated in 5 ml of M9 medium with 0, 10, 20, 40, 60, 80, 100 uM IPTG, respectively. After O/N growth at 37° (about 12 h) samples were collected and slides prepared for microscope analysis. Acquired images were analyzed with the [https://2009.igem.org/Team:Bologna/Software VIFluoR software]. To obtain a significant representation of bacterial fluorescence, it was necessary to acquire several images, each one reporting a sufficient number of bacterial cells (n=60). VIFluoR operates image segmentation and then recognises the bacterial cells, yielding the mean fluorescence per bacterium as the output. The experimental data (Fig. 1) were used to identify, by the [https://2009.igem.org/Team:Bologna/Modeling mathematical model], the operator binding affinity for the repressor LacI '''(K= 1.7 nM)'''. <br />
<br><br />
<br />
[[Image:static_induction_figure.jpg|center|600px|thumb|Fig.1. Experimental data (blue lines) of the static induction after 0, 10, 20, 40, 60, 80, 100 uM IPTG induction. Data were fitted by the model (green line) to identify the operator-repressor binding affinity ('''K= 1.7 nM''')]]<br />
<br />
After parameter identification, we computed by the model the static control curve for the LacI repressed GFP generator (LacI inverter) (Fig.2).<br />
<br />
<br />
[[Image:LacI_GFP.jpg|center|600px|thumb|Fig.2. Model prediction of promoter repression by Lac I.]]<br />
<br />
<br />
'''Dynamic response'''<br />
Dh5alpha cells were inoculated in the morning (9 a.m.) in 5 ml of M9 medium with no IPTG. After daily growth (about 8 h) the culture was diluted to an OD=0.1. To perform the induction analysis, the culture was splitted in two. A half was induced with 100 uM IPTG and the other was grown in control medium. 200 ul of each sample were used to fill plate wells (6 wells each). Cells were grown into a fluorimeter (Tecan M200) O/N (about 12h) at 37°. OD and fluorescence were sampled every 15 min (Fig. 3 and 4, respectively). <br />
<br />
[[Image:OD1.png|center|600px|thumb|Fig.3. Growth curve for the uninduced (black line) and induced (100 uM IPTG, light blue line)system.]]<br />
[[Image:Fluorescenza1.png|center|600px|thumb|Fig.4. Absolute fluorescence curve for the uninduced (black line) and induced (light blue, 100 uM IPTG)system.]]<br />
[[Image:induction_figure.jpg|center|600px|thumb|Fig.5. Model fitting of the experimental data. Experimental data (black lines) were fitted by the model considering a constant (blue line) or a varying (green line) amount of RNA polymerase]]<br />
<br />
Experimental data of the fluorescence/OD ratio (Fig. 5; blue symbols) were compared to model predictions obtained either considering a constant (purple line) or progressively increasing (green line) amount of RNA polymerase. A good fitting can only be obtained if RNA polymerase available for transcription increases up to 30fold with respect to the initial value. This is consistent with the required activation of the major sigma subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8).</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:42:23Z<p>Elisa.passini: /* pSB1A2 vs pSB3K3 */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 2):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 2a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 2b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500/gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 3 - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 4 - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 5 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 3) and fluorescence level (Fig. 4) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 5.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|Fig.3 - Growth curve]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|Fig.4 - Fluorescence]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|Fig.5 - Fluorescence curve over OD]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 5). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.<br />
The BBa_K201003 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:36:23Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 2):<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font size="4">Figure 2a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font size="4">Figure 2b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
{|align="center"<br />
|[[Image:2500/gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|<center><font size="4">Figure 3 - BBa_K079032 bacterial cells</font></center>]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|<center><font size="4">Figure 4 - BBa_K079031 bacterial cells</font></center>]]<br />
|}<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|<center><font size="4">Table 1 - Promoter fluorescence ratio after microscope analysis</font></center>]]<br />
[[Image:promotori.png|center|thumbnail|600px|<center><font size="4">Figure 5 - Box Plot of Table 1 data</font></center>]]<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed: <br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|<center><font size="4">Table 2 - Promoter fluorescence ratio after fluorimeter analysis</font></center>]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 3) and fluorescence level (Fig. 4) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 5.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|Fig.3 - Growth curve]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|Fig.4 - Fluorescence]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|Fig.5 - Fluorescence curve over OD]]<br />
<br><br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 5). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br />
<br />
<br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br />
''To test the ratio between the production of a high copy number plasmid (pSB1A2) and a low copy number one (pSB3K3), we assembled two circuits. The open loop GFP circuits are realized with a BBa_J23118 promoter and the standard biobrick I13504. From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.''<br />
PSB1A2 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
Finally, images were elaborated with the fluorescence visualization software and these are the results:<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:24:38Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
=<font size="5" color="#000000"><b>Testing Circuit</b>=<br />
<br><br />
<font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<font size="4">Before realizing the whole Testing Circuit, we decided to characterize its constitutive parts with intermediate circuits. </font><br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 2):<br />
<br><br />
<br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 2a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 2b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|Table 1 - Promoter fluorescence ratio after microscope analysis]]<br />
<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed:<br />
<br />
<br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|Table 2 - Promoter fluorescence ratio after fluorimeter analysis]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 3) and fluorescence level (Fig. 4) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 5.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|Fig.3 - Growth curve]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|Fig.4 - Fluorescence]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|Fig.5 - Fluorescence curve over OD]]<br />
<br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 5). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23100 (2547)]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23118 (1429)]]<br />
|}<br />
[[Image:promotori.png|center|thumbnail|600px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br />
<br />
<br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br />
''To test the ratio between the production of a high copy number plasmid (pSB1A2) and a low copy number one (pSB3K3), we assembled two circuits. The open loop GFP circuits are realized with a BBa_J23118 promoter and the standard biobrick I13504. From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.''<br />
PSB1A2 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
Finally, images were elaborated with the fluorescence visualization software and these are the results:<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T02:20:53Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
=<font size="5" color="#000000"><b>Testing Circuit</b>=<br />
<br><br />
<font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<font size="4">Before realizing the whole Testing Circuit, we decided to characterize its constitutive parts with intermediate circuits. </font><br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2 (Fig. 2):<br />
<br><br />
<br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 2a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 2b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
<br />
<br><br />
Dh5alpha cells transformed with BBa_K079032 and BBa_K079031 were inoculated in M9 medium O/N. The day after, samples of bacterial cells in the stationary phase were collected and slide prepared for image acquisition with the optical microscope. Images were then analyzed with the VIFluoR software to analyse bacterial fluorescence. Mean fluorescence per bacterium was 51.3± 8.3 a.u. for BBa_K079032 and 43.7±10.4 a.u. for BBa_K079031. Fluorescence ratio BBa_K079032/ BBa_K079031 was 1.20±0.4 (Table 1).<br />
<br />
[[Image:TabellaPromotori3.png|center|400px |thumb|Table 1 - Promoter fluorescence ratio after microscope analysis]]<br />
<br />
The same sample were collected for fluorescence analysis with the Tecan M200 fluorimeter (Table 2) and the fluorescence ratio was confirmed:<br />
<br />
<br />
[[Image:TabellaPromotoriGrafico2.png|center|400px |thumb|Table 2 - Promoter fluorescence ratio after fluorimeter analysis]]<br />
<br />
Dilutions from the O/N grown cultures were then obtained (OD = 0.1) and cell let to grow a 37 °C in a Tecan spectrofluorimeter. Both optical density (OD; Fig. 3) and fluorescence level (Fig. 4) were analized during 12 h. Fluorescence/OD ratio is shown over time in Fig. 5.<br />
<br />
[[Image:GrowthCurve1.png|center|600px |thumb|Fig.3 - Growth curve]]<br />
[[Image:FluorescenceCurveAbsolute1.png|center|600px |thumb|Fig.4 - Fluorescence]]<br />
[[Image:FluorescenceCurveOverOD1.png|center|600px |thumb|Fig.5 - Fluorescence curve over OD]]<br />
<br />
At the equilibrium once again fluorescence/OD BBa_K079032/ BBa_K079031 ratio was about 1.20 (Fig. 5). A relevant experimental result is the roughly 30fold increase in the fluorescence signal from the single bacterial cell occurring during the time course. A possible explanation of this observation could rely on the required activation of the major s subunit of RNA polymerase for transcription of most of the genes expressed in the exponential growth phase (Jishage M, Ishihama A. Proc Natl Acad Sci USA 1998; 95: 4953–8. See reference section). Too low fluorescence per cell at the beginning of the monitoring, possibly too close to the lower threshold of the fluorimeter, may also explain why BBa_K079032/ BBa_K079031 ratio was clearly apparent only after 8 hrs in culture.<br />
<br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23100 (2547)]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23118 (1429)]]<br />
|}<br />
[[Image:boxplot.tif|center|thumbnail|600px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br />
<br />
<br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<br />
''To test the ratio between the production of a high copy number plasmid (pSB1A2) and a low copy number one (pSB3K3), we assembled two circuits. The open loop GFP circuits are realized with a BBa_J23118 promoter and the standard biobrick I13504. From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.''<br />
PSB1A2 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
Finally, images were elaborated with the fluorescence visualization software and these are the results:<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-22T02:05:41Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>CIS and TRAN Parts Design</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br />
The CIS-repressing sequence is assembled upstream of <i>lac</i> I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) simulating the behavior of the testing circuit (Fig. 2) when the T-REX device is idle either in the absence of TRANS-repressor or when that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br />
The Testing Circuit's Positive Control is constituted by intermediate parts that were experimentally characterized. Details of this characterization are available in the [https://2009.igem.org/Team:Bologna/Wetlab wet-lab] section.<br />
<br><br />
<br><br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to characterize the T-REX device, we developed a [https://2009.igem.org/Team:Bologna/Modeling mathematical model] of the whole circuit and all its subparts (Fig. 4)<br />
[[Image:ModelSandro.png|center|900px|thumb|<center>Figure 4 - Simulink Model</center>]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-22T02:04:28Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>CIS and TRAN Parts Design</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br />
The CIS-repressing sequence is assembled upstream of <i>lac</i> I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) simulating the behavior of the testing circuit (Fig. 2) when the T-REX device is idle either in the absence of TRANS-repressor or when that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br />
<br><br />
The Testing Circuit's Positive Control is constituted by intermediate parts that were experimentally characterized. Details of this characterization are available in the [https://2009.igem.org/Team:Bologna/Wetlab wet-lab] section.<br />
<br><br />
<br><br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to characterize the T-REX device, we developed a [https://2009.igem.org/Team:Bologna/Modeling mathematical model] of the whole circuit and all its subparts (Fig. 4)<br />
[[Image:ModelSandro.png|center|900px|thumb|<center>Figure 4 - Simulink Model</center>]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-22T01:56:55Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>CIS and TRAN Parts Design</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br />
The CIS-repressing sequence is assembled upstream of <i>lac</i> I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) simulating the behavior of the testing circuit (Fig. 2) when the T-REX device is idle either in the absence of TRANS-repressor or when that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br />
<br><br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to characterize the T-REX device, we developed a mathematical model of the parts and we simulated the response of the testing circuit. (LINK)<br />
***é PARTE MODELLO***</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-22T01:51:29Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>CIS and TRAN Parts Design</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br />
The CIS-repressing sequence is assembled upstream of <i>lac</i> I (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supplied to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<br />
In order to characterize the T-REX device, we developed a mathematical model of the parts and we simulated the response of the testing circuit. (LINK)<br />
***é PARTE MODELLO***<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) simulating the behavior of the testing circuit (Fig. 2) when the T-REX device is idle either in the absence of TRANS-repressor or when that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br />
<br></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-22T01:49:09Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br><br />
=<font size="5" color="#000000"><b>Testing Circuit</b>=<br />
<br><br><br />
<font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<font size="4">Before realizing the whole Testing Circuit, we decided to characterize its constitutive parts with intermediate circuits. </font><br />
<br><br />
<br><br />
=<font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b>=<br />
<br><br><br />
<font size="4" color="#000000"><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3 (Fig. 4): <br />
<br />
''To test the ratio between the production of a high copy number plasmid (pSB1A2) and a low copy number one (pSB3K3), we assembled two circuits. The open loop GFP circuits are realized with a BBa_J23118 promoter and the standard biobrick I13504. From the Registry of Standard Biological Parts we knew that pSB1A2 is a high copy number plasmid while pSB3K3 is a low copy one, so the theoretical ratio between their copy number should be at least 10, but the highest value that we reached with the spectrofluorimeter was about 3,3.''<br />
<br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
PSB1A2 with a high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the acquisition of images of fluorescent bacteria. <br />
<br><br />
Finally, images were elaborated with the fluorescence visualization software and these are the results:<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
[[Image:boxplot_plas.png|center|thumbnail|700px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:plasmidiGrafico2.png|center|thumbnail|700px]]<br />
<br><br />
<br />
=<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 5a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 5b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
<br><br />
To do this we transformed those constructs in bacterial cells; we picked up a colony from each plate and we inoculated it in M9 medium. After growing all night at 37°C we took a milliliter of each sample and we measured their optical density; than we prepared slides for the fluorescence bacteria images acquisition, following the same steps of the previous test. <br />
The images, acquired during some repetitions of the test, was elaborated with the fluorescence visualization software (VIFluoR) giving out those results:<br />
</font><br />
<font size="3"><br />
From the registry of standard parts we learnt that the strengths of J23100 and J23118 are respectively 2547 and 1429, so the ratio between them is about 1.78. Experimentally we have achieved the value of 1.2; for this reason we can say that this prove has gone well.<br />
<br><br><br />
</font><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23100 (2547)]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23118 (1429)]]<br />
|}<br />
[[Image:boxplot.png|center|thumbnail|600px|Box Plot of bacterium fluorescence. Max and minimum values are indicated by the horizontal bars.]]<br />
[[Image:tabellaPromotoriGrafico2.png|center|thumbnail|600px]]<br />
<br />
<br><br />
<br><br />
=<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI O2 natural operator</b>=<br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the GFP expression level of BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br />
Following the steps of the previous tests we obtained those results:<br />
<br><br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Absence of O2]]<br />
|[[Image:2547gfpy100cgn170esp1v3.png|center|thumbnail|385 px|Presence of O2]]<br />
|}<br />
<br><br></div>Elisa.passinihttp://2009.igem.org/File:Algebricalconstrain2.jpgFile:Algebricalconstrain2.jpg2009-10-22T01:21:31Z<p>Elisa.passini: uploaded a new version of "Image:Algebricalconstrain2.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:Constants3.jpgFile:Constants3.jpg2009-10-22T01:21:02Z<p>Elisa.passini: uploaded a new version of "Image:Constants3.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:Constantsvalue.jpgFile:Constantsvalue.jpg2009-10-22T01:20:13Z<p>Elisa.passini: uploaded a new version of "Image:Constantsvalue.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:Algebricalconstrain2.jpgFile:Algebricalconstrain2.jpg2009-10-22T01:14:39Z<p>Elisa.passini: uploaded a new version of "Image:Algebricalconstrain2.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:Constants3.jpgFile:Constants3.jpg2009-10-22T01:14:10Z<p>Elisa.passini: uploaded a new version of "Image:Constants3.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2009-10-22T01:09:05Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br />
<br />
<html><center> <br />
<font face="Dom Casual" font size="3" color="#000000"><i><b>"The theory is when you know everything and nothing works. Practice is when everything works and nobody knows why. We have put together the theory and practice: there is nothing that works ... and nobody knows why."</b><br />
</i></font> <br />
<br><br> <br />
<font face="Times New Roman" font size="4"><i> A. Einstein </i></font> <br />
</center></html><br />
<br><br><br />
<br />
= Introduction =<br />
<font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</font><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br><br />
<br />
= Mathematical Model =<br />
<br><font size="4"><br />
The mathematical model is based on the law of mass action, and the processes involved in gene expression, that is transcription and translation, are considered similar to enzymathic reactions.<br><br />
In this context, RNA polymerase and ribosome perform enzymes' role, while gene promoter and RBS sequence act as substrates.<br />
<br> The interaction between enzyme and substrate leads to the formation of a complex, yielding to the final product: mRNA for the RNA polymerase - promoter complex and ribosome - RBS sequence complex.<br />
</font><br />
<br><br><br />
<br />
</font><br />
<br><br><br><br />
==Reactions==<br />
Here below are shown all the reactions occurring the circuit (Fig. 1 and Fig. 2).<br />
<br><br />
[[Image:Modello1.png|center|940px||thumb|Figure 1: GFP transcription and GFP translation (left); LacI transcription, LacI translation and LacI dimerization (right) ]]<br><br />
{|align="center"<br />
|[[Image:Pag3.jpg|450px|thumb|Figure 2: Other Chemical Reactions]]<br />
|[[Image:Trans-reactions2.jpg|450px|thumb|Figure 3. Trans-Reactions]]<br />
|}<br />
Symbol definitions are listed in Table 1<br />
[[Image:Tabella.jpg|center|500px|thumb|Table 1. Legend]]<br />
<br />
==Differential Equations==<br />
Differential equations, that describes the project, are obtained appling the law of mass action at the reactions above. <br />
[[Image:Differentialequations3.jpg|940px||thumb| Figure 3. Differential Equations]]<br />
[[Image:Transequations2.jpg|center||540px||thumb| Figure 4. Differential Equations]]<br />
[[Image:constantsvalue.jpg|center|800px|thumb|Table 2. ]]<br />
[[Image:Constants3.jpg|center|500px||thumb|Figure 5: Equilibrium Constants]]<br />
[[Image:Algebricalconstrain2.jpg|center|650px||thumb|Figure 6: Algebraic Constrains]]<br />
<br />
=Simulations=<br />
[[Image:ModelSandro.png|center|650px||thumb|Figure 8: Simulink Model]]</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2009-10-22T01:08:26Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br />
<br />
<html><center> <br />
<font face="Dom Casual" font size="3" color="#000000"><i><b>"The theory is when you know everything and nothing works. Practice is when everything works and nobody knows why. We have put together the theory and practice: there is nothing that works ... and nobody knows why."</b><br />
</i></font> <br />
<br><br> <br />
<font face="Times New Roman" font size="4"><i> A. Einstein </i></font> <br />
</center></html><br />
<br><br><br />
<br />
= Introduction =<br />
<font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</font><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br><br />
<br />
= Mathematical Model =<br />
<br><font size="4"><br />
The mathematical model is based on the law of mass action, and the processes involved in gene expression, that is transcription and translation, are considered similar to enzymathic reactions.<br><br />
In this context, RNA polymerase and ribosome perform enzymes' role, while gene promoter and RBS sequence act as substrates.<br />
<br> The interaction between enzyme and substrate leads to the formation of a complex, yielding to the final product: mRNA for the RNA polymerase - promoter complex and ribosome - RBS sequence complex.<br />
</font><br />
<br><br><br />
<br />
</font><br />
<br><br><br><br />
==Reactions==<br />
Here below are shown all the reactions occurring the circuit (Fig. 1 and Fig. 2).<br />
<br><br />
[[Image:Modello1.png|center|940px||thumb|Figure 1: GFP transcription and GFP translation (left); LacI transcription, LacI translation and LacI dimerization (right) ]]<br><br />
{|align="center"<br />
|[[Image:Pag3.jpg|450px|thumb|Figure 2: Other Chemical Reactions]]<br />
|[[Image:Trans-reactions2.jpg|450px|thumb|Figure 3. Trans-Reactions]]<br />
|}<br />
Symbol definitions are listed in Table 1<br />
[[Image:Tabella.jpg|center|500px|thumb|Table 1. Legend]]<br />
<br />
==Differential Equations==<br />
Differential equations, that describes the project, are obtained appling the law of mass action at the reactions above. <br />
[[Image:Differentialequations3.jpg|940px||thumb| Figure 3. Differential Equations]]<br />
[[Image:Transequations2.jpg|center||540px||thumb| Figure 4. Differential Equations]]<br />
[[Image:constantsvalue.jpg|center|1000px|thumb|Table 2. ]]<br />
[[Image:Constants3.jpg|center|500px||thumb|Figure 5: Equilibrium Constants]]<br />
[[Image:Algebricalconstrain2.jpg|center|650px||thumb|Figure 6: Algebraic Constrains]]<br />
<br />
=Simulations=<br />
[[Image:ModelSandro.png|center|650px||thumb|Figure 8: Simulink Model]]</div>Elisa.passinihttp://2009.igem.org/File:Constantsvalue.jpgFile:Constantsvalue.jpg2009-10-22T01:06:51Z<p>Elisa.passini: uploaded a new version of "Image:Constantsvalue.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2009-10-22T01:03:51Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br />
<br />
<html><center> <br />
<font face="Dom Casual" font size="3" color="#000000"><i><b>"The theory is when you know everything and nothing works. Practice is when everything works and nobody knows why. We have put together the theory and practice: there is nothing that works ... and nobody knows why."</b><br />
</i></font> <br />
<br><br> <br />
<font face="Times New Roman" font size="4"><i> A. Einstein </i></font> <br />
</center></html><br />
<br><br><br />
<br />
= Introduction =<br />
<font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</font><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br><br />
<br />
= Mathematical Model =<br />
<br><font size="4"><br />
The mathematical model is based on the law of mass action, and the processes involved in gene expression, that is transcription and translation, are considered similar to enzymathic reactions.<br><br />
In this context, RNA polymerase and ribosome perform enzymes' role, while gene promoter and RBS sequence act as substrates.<br />
<br> The interaction between enzyme and substrate leads to the formation of a complex, yielding to the final product: mRNA for the RNA polymerase - promoter complex and ribosome - RBS sequence complex.<br />
</font><br />
<br><br><br />
<br />
</font><br />
<br><br><br><br />
==Reactions==<br />
Here below are shown all the reactions occurring the circuit (Fig. 1 and Fig. 2).<br />
<br><br />
[[Image:Modello1.png|center|940px||thumb|Figure 1: GFP transcription and GFP translation (left); LacI transcription, LacI translation and LacI dimerization (right) ]]<br><br />
{|align="center"<br />
|[[Image:Pag3.jpg|450px|thumb|Figure 2: Other Chemical Reactions]]<br />
|[[Image:Trans-reactions2.jpg|450px|thumb|Figure 3. Trans-Reactions]]<br />
|}<br />
Symbol definition is listed in Table 1<br />
[[Image:Tabella.jpg|center|500px|thumb|Table 1. Legend]]<br />
<br />
==Differential Equations==<br />
Differential equations, that describes the project, are obtained appling the law of mass action at the reactions above. <br />
[[Image:Differentialequations3.jpg|940px||thumb| Figure 3. Differential Equations]]<br />
[[Image:Transequations2.jpg|center||540px||thumb| Figure 4. Differential Equations]]<br />
[[Image:constantsvalue.jpg|center|800px|thumb|Table 2. ]]<br />
[[Image:Constants3.jpg|center|500px||thumb|Figure 5: Equilibrium Constants]]<br />
[[Image:Algebricalconstrain2.jpg|center|650px||thumb|Figure 6: Algebraic Constrains]]<br />
<br />
=Simulations=<br />
[[Image:ModelSandro.png|center|650px||thumb|Figure 8: Simulink Model]]</div>Elisa.passinihttp://2009.igem.org/File:Tabella.jpgFile:Tabella.jpg2009-10-22T01:00:24Z<p>Elisa.passini: uploaded a new version of "Image:Tabella.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:Constantsvalue.jpgFile:Constantsvalue.jpg2009-10-22T00:59:39Z<p>Elisa.passini: uploaded a new version of "Image:Constantsvalue.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:424px-Constantsvalue.jpgFile:424px-Constantsvalue.jpg2009-10-22T00:57:41Z<p>Elisa.passini: uploaded a new version of "Image:424px-Constantsvalue.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:614px-Tabella.jpgFile:614px-Tabella.jpg2009-10-22T00:57:11Z<p>Elisa.passini: uploaded a new version of "Image:614px-Tabella.jpg"</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:614px-Tabella.jpgFile:614px-Tabella.jpg2009-10-22T00:55:09Z<p>Elisa.passini: </p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:424px-Constantsvalue.jpgFile:424px-Constantsvalue.jpg2009-10-22T00:54:46Z<p>Elisa.passini: </p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:Pag1.gifFile:Pag1.gif2009-10-22T00:36:05Z<p>Elisa.passini: </p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2009-10-22T00:29:46Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br />
<br />
<html><center> <br />
<font face="Dom Casual" font size="3" color="#000000"><i><b>"The theory is when you know everything and nothing works. Practice is when everything works and nobody knows why. We have put together the theory and practice: there is nothing that works ... and nobody knows why."</b><br />
</i></font> <br />
<br><br> <br />
<font face="Times New Roman" font size="4"><i> A. Einstein </i></font> <br />
</center></html><br />
<br><br><br />
<br />
= Introduction =<br />
<font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</font><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br><br />
<br />
= Mathematical Model =<br />
<br><font size="4"><br />
The mathematical model is based on the law of mass action, and the processes involved in gene expression, that is transcription and translation, are considered similar to enzymathic reactions.<br><br />
In this context, RNA polymerase and ribosome perform enzymes' role, while gene promoter and RBS sequence act as substrates.<br />
<br> The interaction between enzyme and substrate leads to the formation of a complex, yielding to the final product: mRNA for the RNA polymerase - promoter complex and ribosome - RBS sequence complex.<br />
</font><br />
<br><br><br />
<br />
=Reactions=<br />
Here below are shown all the reactions occurring the circuit (Fig. 1 and Fig. 2).<br />
<br><br />
[[Image:Modello1.png|center|940px||thumb|Figure 1: GFP transcription and translation (left); LacI transcription, translation and dimerization (right) ]]<br><br />
{|align="center"<br />
|[[Image:Pag3.jpg|450px|thumb|Figure 2: Other Chemical Reactions]]<br />
|[[Image:Trans-reactions2.jpg|450px|thumb|Figure 3: Trans-Reactions]]<br />
|}<br />
<br />
=Differential Equations=<br />
Differential equations, that describes the project, are obtained appling the law of mass action at the reactions above. <br />
[[Image:Differentialequations3.jpg|940px||thumb| Figure 4. Differential Equations]]<br />
[[Image:Transequations2.jpg|center||540px||thumb| Figure 5. Differential Equations]]<br />
[[Image:Constants3.jpg|center|500px||thumb|Figure 6: Equilibrium Constants]]<br />
[[Image:Algebricalconstrain2.jpg|center|650px||thumb|Figure 7: Algebraic Constrains]]<br />
<br />
=Simulations=<br />
[[Image:ModelSandro.png|center|650px||thumb|Figure 8: Simulink Model]]</div>Elisa.passinihttp://2009.igem.org/File:ModelSandro.pngFile:ModelSandro.png2009-10-22T00:25:58Z<p>Elisa.passini: </p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ModelingTeam:Bologna/Modeling2009-10-22T00:25:20Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br />
<br />
<html><center> <br />
<font face="Dom Casual" font size="3" color="#000000"><i><b>"The theory is when you know everything and nothing works. Practice is when everything works and nobody knows why. We have put together the theory and practice: there is nothing that works ... and nobody knows why."</b><br />
</i></font> <br />
<br><br> <br />
<font face="Times New Roman" font size="4"><i> A. Einstein </i></font> <br />
</center></html><br />
<br><br><br />
<br />
= Introduction =<br />
<font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig. 1):<br />
</font><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 1 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br><br />
<br />
= Mathematical Model =<br />
<br><font size="4"><br />
The mathematical model is based on the law of mass action, and the processes involved in gene expression, that is transcription and translation, are considered similar to enzymathic reactions.<br><br />
In this context, RNA polymerase and ribosome perform enzymes' role, while gene promoter and RBS sequence act as substrates.<br />
<br> The interaction between enzyme and substrate leads to the formation of a complex, yielding to the final product: mRNA for the RNA polymerase - promoter complex and ribosome - RBS sequence complex.<br />
</font><br />
<br><br><br />
<br />
=Reactions=<br />
Here below are shown all the reactions occurring the circuit (Fig. 1 and Fig. 2).<br />
<br><br />
[[Image:Modello1.png|center|940px||thumb|Figure 1: GFP transcription and translation (left); LacI transcription, translation and dimerization (right) ]]<br><br />
{|align="center"<br />
|[[Image:Pag3.jpg|450px|thumb|Figure 2: Other Chemical Reactions]]<br />
|[[Image:Trans-reactions2.jpg|450px|thumb|Figure 3: Trans-Reactions]]<br />
|}<br />
<br />
=Differential Equations=<br />
Differential equations, that describes the project, are obtained appling the law of mass action at the reactions above. <br />
[[Image:Differentialequations3.jpg|940px||thumb| Figure 4. Differential Equations]]<br />
[[Image:Transequations2.jpg|center||540px||thumb| Figure 5. Differential Equations]]<br />
[[Image:Constants3.jpg|center|500px||thumb|Figure 6: Equilibrium Constants]]<br />
[[Image:Algebricalconstrain2.jpg|center|650px||thumb|Figure 7: Algebraic Constrains]]<br />
<br />
=Simulations=</div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T23:57:04Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br />
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<br />
In order to characterize the T-REX device, we developed a mathematical model of the testing circuit. (LINK)<br />
***é PARTE MODELLO***<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle or for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br />
<br><br />
<font face="Calibri" font size="5" color="#000000"><b>Characterization???</b></font><br />
<br><br><br />
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3: <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 5a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 5b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px|thumb|<center><font face="Calibri" font size="4">Figure 7 - interactions between LacI repressor and its natural operator O2</font></center>]]<br />
|}<br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T23:55:44Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br />
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<br />
In order to characterize the T-REX device, we developed a mathematical model of the testing circuit. (LINK)<br />
***é PARTE MODELLO***<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle or for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br />
<br><br />
<font face="Calibri" font size="5" color="#000000"><b>Characterization???</b></font><br />
<br><br><br />
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3: <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4a - BBa_K201003 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 4b - BBa_K201003 on pSB3K3</font></center>]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 5a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 5b - BBa_K079031 on pSB1A2</font></center>]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6a - BBa_K079032 on pSB1A2</font></center>]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px|thumb|<center><font face="Calibri" font size="4">Figure 6b - BBa_K201001 on pSB1A2</font></center>]]<br />
|}<br />
<br><br><br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px|thumb|<center><font face="Calibri" font size="4">Figure 7 - interactions between LacI repressor and its natural operator O2</font></center>]]<br />
|}<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T23:29:28Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br />
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<br />
In order to characterize the T-REX device, we developed a mathematical model of the testing circuit. (LINK)<br />
***é PARTE MODELLO***<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle or for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br />
<br><br />
<font face="Calibri" font size="5" color="#000000"><b>Characterization???</b></font><br />
<br><br><br />
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3: <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px]]<br />
|}<br />
<br><br><br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px]]<br />
|}<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T23:25:25Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<br />
<html><br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA functionality</center>]]<br />
<br><br><br />
<br />
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br />
<font face="Calibri" font size="5" color="#000000"><b>Mathematical Model</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
<br />
In order to characterize the T-REX device, we developed a mathematical model of the testing circuit. (LINK)<br />
***é PARTE MODELLO***<br />
<br />
<br />
<br><br><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit's Positive Control</b></font><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
To have a positive control, we designed a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle or for the absence of TRANS-repressor or in case that TRANS-repressor mRNA is unable to silence LacI translation.<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900px|thumb|<center>Figure 3 - Testing Circuit's Positive Control</center>]]<br />
<br><br><br />
<br><br />
<br><br />
<font face="Calibri" font size="5" color="#000000"><b>Characterization???</b></font><br />
<br><br />
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3: <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px]]<br />
|}<br />
<br><br><br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px]]<br />
|}<br />
<br><br><br />
<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Elisa.passinihttp://2009.igem.org/File:OffCircuit1.pngFile:OffCircuit1.png2009-10-21T23:11:12Z<p>Elisa.passini: </p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T23:09:59Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<br />
<html><br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Testing Circuit</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA affinity</center>]]<br />
<br><br><br />
<br />
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
To have a positive control we characterized a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle for the absence of TRANS-repressor or in the case of TRANS-repressor mRNA unable to silencing LacI translation.<br />
<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900pxthumb|<center>Figure 3 - Genetic Circuit of Fig. 2 in absence of TRANS-repressor</center>]]<br />
<br><br><br />
In this case, LacI is regularly translated and, binding with its O2 natural operator, represses GFP production.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3: <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px]]<br />
|}<br />
<br><br><br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px]]<br />
|}<br />
<br><br><br />
<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Elisa.passinihttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T23:08:24Z<p>Elisa.passini: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<br />
<html><br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>The Genetic Circuits</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig. 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit to test CIS and TRANS' mRNA affinity</center>]]<br />
<br><br><br />
<br />
The CIS-repressing sequence is assembled upstream of LacI (BBa_C0012), therefore the synthesis of LacI should be silenced/damped by the constitutively transcribed TRANS-repressor mRNA. To detect silencing of LacI, due to the action of T-REX, we realized a new inverter (BBa_K201001) consisting of a promoter regulated by LacI (BBa_K201008) and a GFP reporter (BBa_J04031).<br><br />
We expect that a TRANS-repressor oligoribonucleotide with high affinity to CIS-repressing mRNA, inhibits the translation of LacI and then determines a maximally expressed GFP. Otherwise, in case of low TRANS/CIS affinity one should expect partially (or completely) repressed GFP expression.<br><br />
To maximize the probability to silence the CIS transcript and switch on the GFP, we decided to use a high copy number (HCN) plasmid (pSB1A2) for the TRANS-repressor and a low copy number (LCN) plasmid (pSB3K3) for the LacI generator. <br>If the GFP inverter is unable to reveal the LacI reduction due to T-REX action, because of a high level of the free LacI concentration, IPTG can be supply to reduce free LacI. In fact, the sensitivity of the GFP inverter to LacI variations depends on free LacI concentration. Using IPTG is thus possible to set actual LacI value in the region where the inverter has the highest sensitivity.<br />
<br><br><br />
To have a positive control we characterized a circuit (Fig. 3) that simulates the behavior of the testing circuit (Fig. 2) when the T-REX device is idle for the absence of TRANS-repressor or in the case of TRANS-repressor mRNA unable to silencing LacI translation.<br />
<br />
<br><br><br />
[[Image:OffCircuit1.png|center|900pxthumb|<center>Figure 3 - Genetic Circuit of Fig. 2 in absence of TRANS-repressor</center>]]<br />
<br><br><br />
In this case, LacI is regularly translated and, binding with its O2 natural operator, represses GFP production.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
Before realizing the whole T-REX device, we decided to analyze the intermediate circuits, in order to assign the model parameters.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between the high copy number the low to medium copy number plasmids, we analyzed the BBa_K201003 GFP production both on pSB1A2 and pSB3K3: <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to identify the ratio between BBa_J23100 and BBa_J23118 promoters, we analyzed the BBa_K079031 and BBa_K079032 GFP production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We compare then the expression level from BBa_K079032 and BBa_K201001<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px]]<br />
|}<br />
<br><br><br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, using different IPTG concentration in order to evaluate LacI repression strengthanalyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px]]<br />
|}<br />
<br><br><br />
<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Elisa.passinihttp://2009.igem.org/File:OffCircuit_tag.pngFile:OffCircuit tag.png2009-10-21T23:04:06Z<p>Elisa.passini: uploaded a new version of "Image:OffCircuit tag.png": Reverted to version as of 16:06, 21 October 2009</p>
<hr />
<div></div>Elisa.passinihttp://2009.igem.org/File:OffCircuit_tag.pngFile:OffCircuit tag.png2009-10-21T23:03:18Z<p>Elisa.passini: uploaded a new version of "Image:OffCircuit tag.png"</p>
<hr />
<div></div>Elisa.passini