http://2009.igem.org/wiki/index.php?title=Special:Contributions/Emilio&feed=atom&limit=50&target=Emilio&year=&month=2009.igem.org - User contributions [en]2024-03-29T00:04:17ZFrom 2009.igem.orgMediaWiki 1.16.5http://2009.igem.org/Team:Valencia/All_DefinitionsTeam:Valencia/All Definitions2009-10-22T03:50:48Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 25000px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-250px; left:10px; width:700px; color:black; font-size:11pt; font-family: Verdana"><br />
==''All Definitions'''==<br />
<br><br />
In our suvey we asked for the definition of Synthetic Biology, and we received lots of answers:<br />
<br />
*Synthetic Biology aims to use a combination of engineering principles and biological knowledge to design and construct standard parts, devices and systems, and re-design existing biological systems, for purposeful and efficient functionality.<br />
<br />
*design new biological part or system by applying engineering strategy<br />
<br />
*Synthetic biology is a new approach to biology, which aims at synthesizing and engineer components and biological systems to new or re-engineering existing biological elements in order to create systems performing useful functions.<br />
<br />
*Engineering biological systems according to an idea of bio-blue prints, making standardization of biology possible.<br />
<br />
*The use of an engineering approach to molecular biology with the object of creating new life forms that will have a practical application<br />
<br />
*Application of engineering principles and methodology on biological systems in order to change them or create new ones to fulfill some purpose<br />
<br />
*Using engineering principles as a standardised way of designing biological devices<br />
<br />
*"yes i can :D hum... say just that it's a concept of 'engineered biology' using the industrial tool in biology : standards, concept and so on."<br />
<br />
*A mixture of Science and Engineering. The building of live machines.<br />
<br />
*The synthetic biology is the engineering of live: the synthesis of complex systems based on the biology, and which perform functions don't existing in the nature.<br />
<br />
*Application of engineering principles (modularity, abstraction) to rationalize the art of genetic modification, increasing the complexity of systems that can be designed and constructed reliably.<br />
<br />
*The application of engineering principles to creating biological machines, based on gene regulatory networks.<br />
<br />
*Using design and engineering principles to create biological devices.<br />
<br />
*building of new systems using engineering and sciences<br />
<br />
*synthetic biology is for me the combination between modern bioscience and engineering. Thereby creating new organisms and or biomolecules which are not existing in live,<br />
<br />
*A ground up approach to genetic engineering in which parts encoding primitive biological functions are combined in model organisms to elicit new and useful biological behavior.<br />
<br />
*Designing and engineering new biological parts and systems using natural biology in a creative way.<br />
<br />
*The design, creation and testing of artificial biological systems using an engineering approach.<br />
<br />
*It is a process which involves engineering/building/designing artificial in order to create a biological systems or functions<br />
<br />
*Application of engineerings and design approaches to the construction of novel biological functionalities.<br />
<br />
*A new discipline that aims to design new organisms or add new functionality to already available organisms using modular components<br />
<br />
*Creating new functionalities or immitating naturally occuring functionalities in biological sytems by building up genetic regulatory networks from standardized compounds.<br />
<br />
*Engineering and constructing of new biological functions in a biological system.<br />
<br />
*New view on synthetic biology, try to engineer biology, life.<br />
<br />
*the design of standard parts that does not exist yet or reconstruct other parts it is engineering<br />
<br />
*engineering of biological components and systems that do not exist in today's society<br />
<br />
*Synthetic Biology is a term used for a wide variety of developing technologies and ideas that bridge the divide be science, engineering and technology. Mainly this is focused around 're-building' already existing organisms in order to make them more effiient etc. as well as creating new organisms.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*A discipline in bio-engineering, with emphasis on building genetic elements that encode biological functions in a modular fashion.<br />
<br />
*taking naturally occurring systems or functions and applying them for a function that they are not naturally doing by taking an engineering approach.<br />
<br />
*Modular approach to biology by constructing/synthesizing genetic networks or life forms via genetic engineering techniques.<br />
<br />
*Taking biological engineering concepts and expanding them to be abstracted and standardized to ease the 'programming' of biology.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Applying engineering principles to biology in an attempt to work towards standarization, abstraction and acceleration.<br />
<br />
*Building new organisms through the combined use of biology and engineering.<br />
<br />
*using engineering, biology and bio-engineering to design new systems with a variety of applications, in a modular and controlled way<br />
<br />
*Synthetic Biology is the practice of combining well defined components to create engineered nanomachines with novel properties that the components alone would not have had.<br />
<br />
*Build novel biological systems which don't exist in nature by joining several standard parts together.<br />
<br />
*It is a field where we engineer biological components into different system which are not present in the nature.<br />
<br />
*An engineering approach to biology, with the goal of designing and implementing new cellular behaviors<br />
<br />
*Synthetic Biology is an art of engineering new biological systems that don’t exist in nature.<br />
<br />
*Enginering organisms to perform a new function<br />
<br />
*Life created from standard components to perform well-defined tasks.<br />
<br />
*The merging of biology and engineering disciplines, generally characterized by forward engineering de novo biological constructs rather than reverse engineering existing biological entities and systems.<br />
<br />
*Synthetic Biology is a growing field concerned with the integration of biology and engineering to design biological machines from standard biological parts.<br />
<br />
*Using engineering and science techniques to create novel biological systems<br />
<br />
*Brings ideas from engineering and biology together to allow for the creation of 'new' synthetic biological entities<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Is science which combines biology and engineering in order to combine new systems that are able of making new products or functions.<br />
<br />
*Use engineering and biology to design and creat a new life<br />
<br />
*Engineering cells to complete a new function<br />
<br />
*A combination of the natural sciences and engineering techniques to achieve novel biological systems.<br />
<br />
*Synthetic Biology combines chemical, biological and engineering sciences to (re)create biological systems with novel (engineered) functions<br />
<br />
*Engineering biology in a standardized way.<br />
<br />
*Synthetic Biology is an emerging field that aims to combine principles from biology and engineering so as to engineer biological systems to perform novel tasks.<br />
<br />
*Synthetic biology attempts to standardize biological practices with the ultimate goal of engineering biological systems.<br />
<br />
*The application of Engineering principles to Biology. Synthetic Biology builds on the foundation laid out by Molecular Biology (including Restriction Enzymes, PCR and Sequencing) by adding synthesis, standardization and abstraction.<br />
<br />
*Creating synthetic organism/systems/parts using standard parts<br />
<br />
*Synthetic Biology is an area that combines science and engineering in order to design and build new biological systems using standard elements.<br />
<br />
*Using principles of bioscience, engineering, mathematics and other related sciences to modify bacteria so that the bacteria will be able to fulfill a bunch of specialized functions.<br />
<br />
*joining the power of life sciences and engineering in order to get novel biological systems/functions<br />
<br />
*Engineering of biological lifeforms at the genetic level with the desired result of new behaviour or metabolism that is not considered to be part of their natural function.<br />
<br />
*An area of science where biological sciences and engineering are combined to build or create biological structures from scratch.<br />
<br />
*The amalgamation of the fields of mathematics, engineering, life sciences, biology, chemistry and everything in between to come up with novel ways of creating microbes to do things for us.<br />
<br />
*Abstracting biology concepts with an engineering framework to introduce standards into the field. Like lego.<br />
<br />
*Using standardized biological parts for new devices and systems or to re-design natural systems from standardized parts<br />
<br />
*Synthethic biology is a rapidly evolving research area that combines science and engineering in order to design, synthesize, and analyze novel biological functions and systems.<br />
<br />
*Synthetic biology is the powerful interface between biology, engineering, and computer science. It has great potential for the development, creation, and thorough understanding of novel biological systems.<br />
<br />
*Synthetic Biology defines a combination of Life Sciene and Engineering. It's goal is to create new biological systems and to improve the understanding of complex pathways by experimental and computational work.<br />
<br />
*Synthetic biology is a new discipline of life sciences focused on bringing engineering into biology. It uses engineering concepts like modeling and standardization to create biological devices with new capabilities that do not exist in nature.<br />
<br />
*The development of new life from the bottom up.<br />
<br />
*The systematization and re-arrangement of life as we know it today to have new functions, making it engineerable.<br />
<br />
*A new interdisciplinary field, that involves the design, construction and standardization of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Synthetic biology applies fundamental engineering concepts like standardization and abstraction to biology in order to allow reliable design of biological devices and systems.<br />
<br />
*The use of engineering principles to model, design and use modular units of biology to construct new biological devices.<br />
<br />
*It is an extension of the field of gennetic enginereing which applies enginereing principles to standardise and simplify biological systems and make new ones<br />
<br />
*To engineer the bacteria which have some new functions by introducing genes which are normalized as parts<br />
<br />
*The application of engineering principles and processes to genetic manipulation, with a focus on furthering our understanding of biological systems by the mimicry of, and creation of orthogonal alternatives to, those systems via abstraction and characterisation of their component devices and parts<br />
<br />
*Systems biology studies complex biological systems as integrated wholes, using tools of modeling, simulation, and comparison to experiment.<br />
<br />
*trying to save the world<br />
<br />
*Letting your brain think up new and exciting posebilities for challeging problems you are confronted with.<br />
<br />
*The syntethic biology is a technique used by engeneers to modulate living systems. The goal is to use existing technics and to jungle with them to create new processes<br />
<br />
*Design, construction and assembly of biological parts.<br />
<br />
*an electronically transformed guy<br />
<br />
*A field in which bacterial computers or functional gene based systems are constructed for the benefit of science<br />
<br />
*Synthetic Biology (SB) is at the interface of Engineering and Molecular Biology. The basis of SB is that a cell can be broken down into hierarchies and viewed as a combination of functional elements, just like any machine, allowing construction of complex biological systems from first principles.<br />
<br />
*engineering of artificial biological systems with the use of synthetic components in living organisms<br />
<br />
*Synthetic biology is the manipulation of organic material to make new organic material. For example, it is currently mostly applied in DNA, where plasmids for bacteria are made artificially and applied to bacteria to perform certain functions<br />
<br />
*adding features to an existent bio-system like adding new methods using a Operative System to boot it up<br />
<br />
*Design of different things with biological elements<br />
<br />
*genetic engineering under precise control.<br />
<br />
*Using new technologies and combining tecnology with biology.<br />
<br />
*An interdisciplinar field of science concentrated on developing a biological systems.<br />
<br />
*Yes, in my mind I think it means use bacteria and some other kinds of living things like that to produce the products we want. Often people need to do some genetic engineering to make the bacteria produce the certain products.<br />
<br />
*In just a few words I would define synthetic biology as a field op bioengineering with natural an artificial components.<br />
<br />
*Designing and engineering novel activities de novo using existing chassis or building novel chassis<br />
<br />
*the design and creation of devices in a living cell<br />
<br />
*I guess you could say there are two approaches: 1) the making of (and thereby defining) life from scratch. 2) reverse engineering known lifeforms to make it more easy to engineer.<br />
<br />
*Engineering with DNA<br />
<br />
*Rational genetic engineering.<br />
<br />
*extensive genetic engineering of organisms<br />
<br />
*Engineering the DNA circuits, design and implement specific functions, global and network-oriented approach<br />
<br />
*un ingénierie du vivant.<br />
<br />
*Naturally occuring organisms that have been genetically altered.<br />
<br />
*Creating functions by directed evolution<br />
<br />
*brainstorming<br />
<br />
*Modularising Components of Bacteria and DNA to allow simple organisisms to be used in an engineering context<br />
<br />
*genetic engineering---make the proper organism to produce the product of interest<br />
<br />
*Using highly artificial molecular-biological tools in biological systems for some research-related application.<br />
<br />
*Taking individual molecular processes and compiling them to complete a task different than normally used<br />
<br />
*international genetically engineering machine<br />
<br />
*to use genes or DNA moleculars to construct some functional part.<br />
<br />
*The use of a biological system to replace a classical engineered system<br />
<br />
*Genetic alterations in organisms, typically bacterial, resulting in a change, such as a biological process for industrial or other type of application<br />
<br />
*using synthetic approach to do biology<br />
<br />
*The synthesis and modification of biological systems on a genetic level.<br />
<br />
*Constructing biological parts.<br />
<br />
*Synthetic biology is the principle of applying genetic modification to achieve an alternation of certain organic functions.<br />
<br />
*The application of biological and biochemical techniques for the develop and engineering of classically designed systems and tools from biological parts (i.e. nucleic acids, protiens, lipids and carbohydrates).<br />
<br />
*The systematic study of the effects and uses of inserting useful artificially engineered gene sequences into living cells.<br />
<br />
*The use of biological elements in genetic engineering to create a system which is useful in solving complex and important problems.<br />
<br />
*Treating bacteria as machines and genetically modifying them for novel applications.<br />
<br />
*design of existing, natural biological systems for useful purposes<br />
<br />
*To assemble DNA parts and transform it into the module to express certain function.<br />
<br />
*Modifying genes in organisms to perform a specific function to design biological parts<br />
<br />
*Cannot!<br />
<br />
*Engineering life.<br />
<br />
*The design and construction of synthetic biological systems.<br />
<br />
*It is something for the next generation<br />
<br />
*a new mode of production or imitation by engineered organisms<br />
<br />
*creating a genetic network of genes from various sources in a chassis organism<br />
<br />
*Building machines using non-conventional parts of biological origin<br />
<br />
*the (re-)design and construction of biological parts and systems.<br />
<br />
*the engineering and modification of a natural system (i.e. a cell)<br />
<br />
*Synthize devices with biological activity by way of design from genetic level<br />
<br />
*build up meaningful organism with small materials<br />
<br />
*making new biological parts<br />
<br />
*creat special protein by assembling different genes together<br />
<br />
*The synthesis of biological parts to form improvised parts.<br />
<br />
*synthesizing biological organisms using biological building blocks<br />
<br />
*Re-Engineering biological organisms found in nature to be tools for useful purposes or creating biological parts the future<br />
<br />
*synthetic biology is...a newly developed scientific field that deals with brand new types of and applications of genetically engineered, or modified, organisms.<br />
<br />
*hmmm...not pretty sure as to define it in short words though.<br />
<br />
*Using and combing nature biological components to create something new<br />
<br />
*A mix of math and biology<br />
<br />
*artificially putting constructs of DNA sequences into an organism to achieve desired traits.<br />
<br />
*Using basic genetic parts to reconstruct life with fancy fuctions.<br />
<br />
*!@!*$@!$<br />
<br />
*To use biological components as pieces of machinery<br />
<br />
*giving a bacteria genetic qualities so that it does things you want it to do<br />
<br />
*engineering bacteria in a controlled way<br />
<br />
*Using some skills make a new gene part.<br />
<br />
*synthesizing working biological circuits from smaller biological entities for desired purposes<br />
<br />
*Synthetic biology is an emerging scientific field which focuses on introducing novel functions to simple cells via DNA manipulation and synthesis.<br />
<br />
*Ability to induce some already known and unknown phenotypes in a new system. Eg. fluorescent fishes.<br />
<br />
*Creating life (or something on a smaller scale).<br />
<br />
*To build a biological machinary for a certain purpose.<br />
<br />
*using DNA to construct the new brand or function of creature<br />
<br />
*Synthetic biology is rearranging DNA in living organisms to try and make them perform a function they do not naturally do.<br />
<br />
*Constructing biological components from raw materials.<br />
<br />
*a biological competition<br />
<br />
*1. conventional view: using bioparts to make genetic circuits<br />
<br />
*2. synthetic genomics view: combinatorial genomics<br />
<br />
*Synthetic biology is the process by which human beings create biological organisms that operate in unique ways (i.e. not found in nature) using standard biological processes that exist in nature<br />
<br />
*using standardized method to genetically engineer/modify organisms<br />
<br />
*exploring the possibilities of recombined organic molecules (mostly proteines and nucleic acids) which were constructed using the principles of molecular biology<br />
<br />
*To define it you can compare genes as functional building blocks, that can be moved among organisms. In synthetic biology this is utilised to make biological systems with the functions we request.<br />
<br />
*design and construction of biological systems<br />
<br />
*The science of using DNA parts to build up a complex biological system<br />
<br />
*brain storming<br />
<br />
*to me it is making chemicalsystems behave lifelike, and alsow manipulating whit allredy living organismens<br />
<br />
*Building biological systems from the bottom-up.<br />
<br />
*The application of biological components to produce bio-synthetic components.<br />
<br />
*Engineering organisms or life basically to exist or produce desired chemicals, etc.<br />
<br />
*genetically engineering of E. coli and other organisms to produce desired products<br />
<br />
*Manipulating the genetics code of an organism in order to make it produce a product of interest<br />
<br />
*Synthetic biology is the next step after genetic engineering. It involves industrialiing the processes behind genetic engineering so that we can work at a higher leve.<br />
<br />
*Design of genetic material in organisms to accomplish a task.<br />
<br />
*design and manipulation of biological, namely genetic, parts<br />
<br />
*To build up a building with the blocks of genes<br />
<br />
*contructing new biobrick parts, making biology easier for engineers<br />
<br />
*This picture represents a person trying to brainstorm using a mechanical device which apparently gave him some cool idea. The person as such doesnt look so bright<br />
<br />
*Yes<br />
<br />
*Branch of Bio where u cut copy and paste parts of DNA to get new parts with new functions :)<br />
<br />
*Man-made biological processes and parts<br />
<br />
*Synthetic Biology is genetic engineering using genes as separate parts that can be combined to do cool things. Whoa.<br />
<br />
*Manipulating the genes of organisms to make them perform some function not natural to them.<br />
<br />
*Manipulating the genetic material of a microbe in order to make it perform actions it normally would not.<br />
<br />
*Synthetic biology is the use of math, compuer science, and life sciences to design and construct 'biological machines' for the use of prbolem solving and advancement.<br />
<br />
*[Re]design of biological systems for the purposes of conducting basic science as well as developing applications.<br />
<br />
*The designing of biological parts<br />
<br />
*design and construction of new biological parts<br />
<br />
*Yes.<br />
<br />
*development of biological tools to assist reseach ect.<br />
<br />
*regard genes as bricks, build in a machine with specific function<br />
<br />
*This is a poor boy with thinking cap.<br />
<br />
*Human-manipulated usage of organisms and cellular buildingblocks (cells, proteins, molecules, horomones, enzymes, etc.)<br />
<br />
*Combining man-made parts and mechanisms with natural components (like Bacteria) for a processes.<br />
<br />
*Synthetic Biology is like biology in computer form.<br />
<br />
*To manipulate the DNA sequence in order to create new combination or new function or whatever<br />
<br />
*New area of biology<br />
<br />
*artificially modifying natural biological processes/organisms to perform a task or improve functionality<br />
<br />
*It is mad!<br />
<br />
*study to make possible life.<br />
<br />
*Using biological components to synthesize systems<br />
<br />
*bacteria machine bottom up approach creative<br />
<br />
*synthetic biology is the combination of biology with electrical engineering to create biological circuits<br />
<br />
*Yes<br />
<br />
*Building biological systems from various parts (genes)<br />
<br />
*Putting genes into organisms to make them do cool things<br />
<br />
*Engineering living things to do something useful.<br />
<br />
*Using various biological parts to build unique living things which has self regualtion system.<br />
<br />
*fixing parts together to make a genetic network<br />
<br />
*Artificial recombintaion of biological parts<br />
<br />
*Remodeling biological processes on an artificial, chemical level<br />
<br />
*ertgr5<br />
<br />
*Biosynthesis is enzyme-catalyzed process wherein more complex chemical compounds are produced from simpler substrates<br />
<br />
*[wikipedia]<br />
<br />
*creating out of different genetical parts new organisms<br />
<br />
*It is the design and fabrication of biological parts/systems.<br />
<br />
*Synthetic Biology is Systems biology in reverse - obtaining in vivo results by in silico prediction<br />
<br />
*Synthetic biology is a field which tries to look at the complex biological network by exploring every layer of the biological complexity. Therefore synthetic biology provides an explanation to the complications of the natural biological systems by artificially re-building them and studying them.<br />
<br />
*Synthetic biology is how to make automated programming of living organisms.<br />
<br />
*Wants to be the area of engineering organisms, but currently is a crude form of re-engineering organisms. Largely a slow progression of the metabolic engineering from the mid 1980's---slightly more dynamic in its control strategies, though.<br />
<br />
*man-made genetic 'circuits'<br />
<br />
*TV Show<br />
<br />
*Synthetic Biology can be defined as the field of biology that can be clustered with artificial world in various applications.<br />
<br />
*It's just like a jigsaw puzzle, putting different gene sequence together to reach a certain goal.<br />
<br />
*Within an organism, re-designing the layout of genes, and further produce biological 'program' to control the behavior of organisms<br />
<br />
*its the science of trying to understand biology by breaking it down into its simplest parts and then building up from these parts<br />
<br />
*It is about understanding better the microbiological world, by developing tools in parallel in wet and dry labs. It's an assembly of tools to reconstruct synthetically or construct from the scratch new pathways, genomes...understanding better allows to control better.<br />
<br />
*A field of knowledge that aims to understand the functions of the living by synthetizing it into others organism.<br />
<br />
*It is about understanding the basic of life forms and assembling them together.<br />
<br />
*making artificial biological systems in order to understand living systems<br />
<br />
*1) understanding biological systems in terms of their components and 2) designing novel parts, processes or subsystems based on those found in natural systems<br />
<br />
*SB seeks both a better understanding of natural biological systems (including their evolutionary origin), and the design and construction of artificial devices that solve technological needs throughout the simplification of biological systems.<br />
<br />
*Its a tools by which we can transfer a phenotype from one living system to another new system. The phenotype may be not necessary for survival of the new system. But this would help us better understand the phenotype.<br />
<br />
*an attempt to better understand and work with biological systems through the creation, standardization, planned combination, and characterization of segments of these systems.<br />
<br />
*An area of biology that aims to understand 'what is life' and apply biotechnologies by creating and analyzing genetically modified organisms.<br />
<br />
*Applying thought processes from various areas of science to gain a better understanding of biological systems<br />
<br />
*The engineering of nature in order to produce commercial goods or services or in order to further current knowledge of biological systems.<br />
<br />
*Synthetic biology is understanding and modifying existing biological structures and pathways to come up with engineered cells with unique and useful properties.<br />
<br />
*The attempt to artificially create life based on knowledge gained from existing life.<br />
<br />
*Engineering + Cell Biology - World Domination<br />
<br />
*Engineering approach to biology<br />
<br />
*Synthetic biology can be understood as the design and construction of new biological systems not found in nature<br />
<br />
*Applying engineering principles in biological systems to manipulate them into useful tools.<br />
<br />
*engineering biological systems according to rules of engineering such as insulation, abstraction or modularity.<br />
<br />
*Synthetic biology is an engineering approach to biotechnology<br />
<br />
*It could be defined as the engineering of Biology. It aims at providing reusable and modular biological systems to promote and stimulate innovation in Biotechnology.<br />
<br />
*engineering biology<br />
<br />
*Making new 'live devices' from genetic elements found in different organisms.<br />
<br />
*Engineering approach to molecular biology<br />
<br />
*designing new or re-designing existing, natural biological systems, devices etc. for useful purposes<br />
<br />
*It consits out of genetic engineering (PCR, recombinant DNA, etc.) sequencing, automation, abstraction, standardization, computer modeling.<br />
<br />
*it is the engineering of biology<br />
<br />
*inspired by Nature created by Human to develop new biological features and to unveil non yet understood biological/molecular pathway behaviour.<br />
<br />
*science standardization engineering life<br />
<br />
*molecular biology with the idea of standardization : the idea is to synthetize DNA from small standard parts<br />
<br />
*Synthetic biology is about doing functional standart with living organism in the aim to make them 'doing thing' you planed.<br />
<br />
*Working on a DNA level to engineer something new by combining allready excisting and new components of DNA.<br />
<br />
*Synthetic biology is a way to standardize biology by using standardized genes and genetical systems. It is trying to make biology standard enough to use it to engineer your own synthetic system with it.<br />
<br />
*enginering of bacteria<br />
<br />
*Engineering systems using genetic techniques.<br />
<br />
*sythetic biology is the engineering of cells. To make them do what you want to use them as machines. Using parts from many diffrent organisms or creating your own from scratch<br />
<br />
*It's considering life sciences from the point of view of an engineer, doing great GMOs using MB and CB tools. It's also thinking about what all this means as regards the special position of humans among terrestrian creatures.<br />
<br />
*Synthetic biology is the field gathering the methods enabling the engineering of biological systems.<br />
<br />
*Applying engineering principles in using independent and well characterised biological modules<br />
<br />
*engineering biological systems<br />
<br />
*It is the use of already existing DNA parts to create new functionalities in organisms.<br />
<br />
*It is an area of the sciences whose main aim is to create synthetic features which produce a desired phenotype when inside a specific organism.<br />
<br />
*Using technology to assemble new biological systems.<br />
<br />
*To engineer organisms or pathways to perform a specific task.<br />
<br />
*Thinking like a engineer and doing like a molecular biology.<br />
<br />
*new field inthat puts engineering into molecular biology<br />
<br />
*It's a new area of research, aiming at synthesizing complex systems, inspired by living being, with new functions which do not exist in nature, from simple bricks of DNA.<br />
<br />
*The possibility to engineer genetic systems out of simple genetic parts : It's a kind of 'genetic programation'<br />
<br />
*The altering of natural life to better serve human needs through an engineering approach, or the creation of synthetic life.<br />
<br />
*The construction of new biological systems using building blocks from other, well characterised, biological systems.<br />
<br />
*Designing/building novel biological 'machines' using biological parts.<br />
<br />
*The genetic manipulation of current organisms to introduce new systems/protein pathways and/or alter the existing systems/protein pathways of the organism.<br />
<br />
*science which deals with the design of new biological organisms according to native model organisms for optimization purposes...<br />
<br />
*Engineering biological systems in a systematic and minimalistic level to perform defined tasks<br />
<br />
*It's about designing and engineering in silico organisms to rock our future life, yeah.<br />
<br />
*'breaking' biological systems into small parts and store them, that everybody can have access to them and assemble them in a way that's useful to them. Thereby new biological systems can be build.<br />
<br />
*combination of biology and engineering methods<br />
<br />
*system biology with engineering<br />
<br />
*Synthetic Biology tries to use standardized devices and methods to influence the behaviour of cells. Important is the transferability of parts and devices in synthetic biology.<br />
<br />
*Create a new kind of organism by known biological elements, whose behaviours could be estimated by computational/theoretical model<br />
<br />
*Synthetic biology applies engineering principles to biology, thus it uses 'parts' to build 'machines'.<br />
<br />
*synthetic biology is a discipline where biological element/basic parts are dissected firstly, and then we assemble them to achive new functions that do not exsist or that have not been discovered, or we can exploit them to optimize the original biological system.<br />
<br />
*Synthetic biology is the use of biological techniques to create new biological systems that help solve problems.<br />
<br />
*design and constructions of new biological parts for usefull purposes<br />
<br />
*design new system to perform novel functions<br />
<br />
*The intersection of biology and engineering.<br />
<br />
*Using what is known about naturally occurring biological systems to construct novel biological parts, networks and systems, often with a desired functionality or purpose.<br />
<br />
*Just like computer programming, syn bio is aim at constructing biological system with standardized modules<br />
<br />
*Building up a new device from the parts available in nature<br />
<br />
*the application of quantitative design framework for modifying, creating, and controlling living organisms and processes, particularly at a genetic and cellular level.<br />
<br />
*Synthetic Biology is where the biology involved is being created by non natural means.<br />
<br />
*the design or redesign of biological parts for manipulation bio systems or creating new devices<br />
<br />
*The design and construction of novel biological systems.<br />
<br />
*A means of standardizing biology by us<br />
<br />
*Creating macro-scale biological machines from micro-scale biomolecular components.<br />
<br />
*Engineering biological systems or organisms for a purpose.<br />
<br />
*Synthetic Biology is a science that uses standard interchangeable parts to build genetic devices.<br />
<br />
*Its is a new area of science that requires biology and engineering to work together<br />
<br />
*Creating standardised biological parts for use and assembly for a variety of applications.<br />
<br />
*Genetic engineering resulting in a useful novel living system.<br />
<br />
*Re-creating organisms for developing of science and consummate the human interest<br />
<br />
*Messing around with biological systems using engineering and design principles along with molecular biology techniques to make them do something sweet.<br />
<br />
*Putting Biobricks together.<br />
<br />
*an area of biological research that combines science and engineering<br />
<br />
*In the synthetic biology we create new micro-organisms or just beneficial tools out of already existing organisms...<br />
<br />
*The design and construction of new biological parts, devices and systems that do not exist in the natural world and also the redesign of existing biological systems to perform specific tasks<br />
<br />
*Artificial life or devices created from biologicak materials<br />
<br />
*Build life from simple molecule.<br />
<br />
*The modification/improvement of existing biological systems or the creation of new ones in order to realize a genetically modified organism that show new and interesting skills.<br />
<br />
*the design and fabrication of biological components and systems that do not already exist in the natural world or re-design and fabrication of existing biological systems.<br />
<br />
*build biological systems made from standard biological parts<br />
<br />
*...<br />
<br />
*It is the construction of new biological parts, devices, and systems.<br />
<br />
*It is the biological material engineering, in order to add or modify a particular function of living organisms.<br />
<br />
*engineered biological systems<br />
<br />
*Application of engineering principles in life sciences.<br />
<br />
*Approaching to biology in a more rigorous, quantitative way, in order to create regulable biological systems.<br />
<br />
*Using DNA manipulation to modify existing biological systems or to create new biological systems for a purpose<br />
<br />
*The building of biological circuits and organisms based on well-defined, well-characterized, and standardized parts.<br />
<br />
*The science that tries to engineer biological systems in a controlled way<br />
<br />
*building new biological machines out of existing biological parts<br />
<br />
*Design of standard parts (biobricks in the iGEM competition)<br />
<br />
*To use natural things to create artificial ones.<br />
<br />
*Creating novel products using biological parts<br />
<br />
*Using genes as building blocks in creating organisms with characteristics that we desire.<br />
<br />
*The reduction of biological processes into manipulated parts, and the recombination of these parts into more complex devices.<br />
<br />
*Applying a hierarchical model to genetic engineering, where each gene is treated as a single 'part' that can be combined to make composite parts, devices, and machines.<br />
<br />
*designing or redesigning and building biological systems, parts, or devices for some [useful] purpose<br />
<br />
*design or modify a creature by some standard methods related to genetics engineering so that it has some specific function<br />
<br />
*Synthetic biology is the application of the idea of engineer to the field of biology science. And the result would be amazing.<br />
<br />
*synthetic biology is using 'non-living' organisms and using them to create functional systems<br />
<br />
*I think any definition is non-encompassing. A field that combines Science and Engineering to design new systems,<br />
<br />
*it is engineering and biology mixed into a novel and exciting study<br />
<br />
*The design, production and refinement of artificial biological circuits to perform useful functions for humans.<br />
<br />
*It is basically combing science and engineering in order to design and build biological functions and systems.<br />
<br />
*Making new biological awesomeness!<br />
<br />
*use some basic element to create a complicate systems<br />
<br />
*Make artificial biological systems!<br />
<br />
*It's the most simple way to do engineering as well as 'NATURE'<br />
<br />
*Synthetic biology is one field of science that encourages people to use DNA recombination skill which can create new system in any cells and have new usage.<br />
<br />
*Synthetic biology studies how to build artificial biological systems.<br />
<br />
*Through the change of DNA to make a new creature.<br />
<br />
*Using biological parts such as promoter, binding site and coding sequence, compromise the whole something new biological system it never exists naturally<br />
<br />
*synthetic biology is like an engineering science. Being able to build biological machines use synthetic parts.<br />
<br />
*ynthetic Biology is a new technology which applies engineering principles to biology. It is an advancement from genetic engineering, which uses the insertion/deletion of a few specific genes to one where we can engineer highly regulated genetic systems.<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Building of new novel biological parts/devices/systems for engineering applications<br />
<br />
*synthetic biology is the engineering of biοlogical systems in order for the latter to have desired properties.<br />
<br />
*the construction of novel biological systems to replace classically designed machines<br />
<br />
*Making machine based on biologic system<br />
<br />
*Technics of engineering applied on biological systems<br />
<br />
*constructing new abilities by cutting and pasting with DNA, thus enabling cells to make/do something they don't naturally do.<br />
<br />
*Synthetic biology is the artificial manipulation of genetic code to produce novel organisms or organisms with a desired, predictable function based on the manipulated genes.<br />
<br />
*Finding a way to create life in a test tube and not using 'alive' precursors<br />
<br />
*To create lifes that as our wish.<br />
<br />
*It's the making of synthetic organism from the bottom up.<br />
<br />
*Constructing complex biological systems out of standard parts.<br />
<br />
*creating new biological systems out of different parts<br />
<br />
*Create new biological systems from parts of existing ones<br />
<br />
*Synthetic biology, analogous to synthetic chemistry, is a field in which complex molecular-level mechanical systems are synthesized from genetically engineered biological components. SynBio attempts to recreate or modify constructs normally found in nature in the lab.<br />
<br />
*An approach to study and apply biology through modularization and standardization<br />
<br />
*Creating of biological systems not present in nature<br />
<br />
*Synthetic Biology is the ability to create/implement systems not previously found in that organism. We can uses these systems to do anything from display a picture to create chemicals.<br />
<br />
*It is an applicative branch of biology focused on inventing and using novel organisms (especially genetically modifed) or their products that differ from natural ones and have new useful functions.<br />
<br />
*it's an area of research that enables us to modify and build new biological systems<br />
<br />
*The construction, engineering and reengineering of organic machinery<br />
<br />
*the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*synthetic biology is designing novel biological systems using well defined basic biological components.<br />
<br />
*Synthetic Biology is Engineering biological systems to perform a specific function<br />
<br />
*breaking down and analyzing biological subsystems and recombining them in such a way that they perform new tasks<br />
<br />
*synthetic biology is rewiring the naturally found genes to make new circuits which deliver better,predictable and programmable outputs.<br />
<br />
*engineering of biological parts<br />
<br />
*engineering biology<br />
<br />
*making organisms with new and hopefully useful functions<br />
<br />
*decouple life, Construct life<br />
<br />
*Biology which starts in essention on genes and they are combined to engineer and create new bacteria with specific features you just want.<br />
<br />
*Novel thought process leads to Innovation and creativity.<br />
<br />
*The biological equivalent of digital system design. Hopefully Moore's Law will also be applicable.<br />
<br />
*according to me it is applying engineering principles to biological system so that we can understand it in a better way or achieve some novel output from a cell.<br />
<br />
*use the known bio-parts to construct a new system.<br />
<br />
*A field that combines engineering and biology to build life forms for useful purposes<br />
<br />
*Biological engineering at the DNA level<br />
<br />
*An area of biology that involves designing and building new bilogical systems and functions.<br />
<br />
*Applying an engineering mindset to the medium of biology.<br />
<br />
*An engineering approach to biology<br />
<br />
*Engineering biological machines using cells as a media.<br />
<br />
*Synthetic biology is the practice of engineering biological systems to produce a specific product using well characterized 'parts'.<br />
<br />
*It is putting together DNA sequences / Genes from multiple organisms that would not normally interact with each other to create a construct that exhibits a novel function.<br />
<br />
*an interdisciplinary field combining biology and engineering<br />
<br />
*Engineering biological components.<br />
<br />
*Synthetic biology: Involves combination of Engineering with Science, to synthesize biological functions/systems<br />
<br />
*Synthetic+Biology - to artificially inducing a new property in a another living system<br />
<br />
*Make biology easy to engineer.<br />
<br />
*engineering and analyzing synthetic biological networks<br />
<br />
*Using genetic engineering to create artificial (non-naturally occuring) organisms, with specific functions.<br />
<br />
*the study of applied engineering in biology<br />
<br />
*new kind of biology that tryes to modify biological sistems in order to gain new functions<br />
<br />
*Genetically modifying an organism to perform a novel function (novel to that organism).<br />
<br />
*Synthetic biology is to compose and engineer biological organisms and manipulate them to do desired actions.<br />
<br />
*A multi-disciplinary field that is rapidly emerging. The field tried to build biological systems with parts called biobricks.<br />
<br />
*engineering and biology and design<br />
<br />
*The rational design and production of organisms (new or modified) or multi-cellular systems, using genetic manipulation/ modification techniques, that have functions or combinations of properties not normally found in nature.<br />
<br />
*Creating new organisms by modifying dna<br />
<br />
*Synthetic Biology is the design and creation of new biological parts, devices and systems and the redesign of existing biological parts, devices and systems for useful purposes<br />
<br />
*Synthetic Biology is the study of designing a new biological devices or reconstructing an existing parts.<br />
<br />
*Syntetic biology is the designing and creation of biological systems, both to enhance known systems or to create new ones<br />
<br />
*The creation of artificial systems<br />
<br />
*The engineering of biological systems<br />
<br />
*design, construction of new biological parts, devices, systems re-design of existing systems for useful purposes<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes<br />
<br />
*Sure.... Oh define it here I get it. Synthetic Biology is the feild of biology devoted to the creation of novel pathways or proteins in organisms that did not previously use said pathways.<br />
<br />
*Engineering biological devices to do useful things<br />
<br />
*standardization of biology and the tools used to manipulate it<br />
<br />
*Synthetic biology is manufacturing a new kind of creature by any methods, including chemical, physical, biological ways<br />
<br />
*it is the combination of biology and engineering which synthesis some biological products or systems<br />
<br />
*Changing or creating new biological systems or processes<br />
<br />
*To be able to create smaller component parts of the genomic world that can radically alter the abilities of a cell to accomplish specified tasks.<br />
<br />
*Synthetic Biology, an intertwining of principles from Biology and Engineering<br />
<br />
*Constructing new biological parts from existing ones<br />
<br />
*Design. construction and standardization of biological parts.<br />
<br />
*Biological Engineering<br />
<br />
*"the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes."<br />
<br />
*The reduction of an array of molecular biology techniques into a standardized set of common practices designed to streamline modern molecular biology.<br />
<br />
*Synthetic biology is the design and construction of new biological parts, devices, and systems which are either novel to the natural world or are modifications based on existing biological systems. The goal is to program organisms to perform specific functions.<br />
<br />
*applying engineering principles to solving biological problems<br />
<br />
*field involved in the engineering of biological parts, devices and systems by standardizing DNA sequence information for reuse in designs<br />
<br />
*a way to build new biological systems<br />
<br />
*Engineering biology from the ground up.<br />
<br />
*The use biotechnology in a consistent and systematic way to engineer modified organisms with relative ease (as compared to traditional biotechnological methods).<br />
<br />
*It involves designing and modeling biological systems<br />
<br />
*It is a magic field of study where we can design an artificial genetic network to endow novel biological and non-biological functions to microbes!<br />
<br />
*synthbio can be boiled down to the creation of biological parts and systems.<br />
<br />
*design and build novel biological functions and systems<br />
<br />
*design of novel and new biological parts or devices<br />
<br />
*using advanced genetic components and technologies to create new parts or functions in a creature<br />
<br />
*design and construction of new biological parts, devices, and systems<br />
<br />
*design and creation of new biological parts<br />
<br />
*It is the emerging discipline which seeks to standardize biology and unlock the potential of new technologies which allow the de novo synthesis of biological components.<br />
<br />
*Engineering approach to biology<br />
<br />
*genetically modify a bacteria, virus or other organisms to create a something new with a specialized function, which can help our life in some way.<br />
<br />
*a method that allows for better engineering of biology/life<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes, According to http://syntheticbiology.org/ and I agree with this definition.<br />
<br />
*Adding new genes or circuits to cells to achieve new behaviors and properties from those organisms.<br />
<br />
*A nes research field where it is combine the biological and engineering knowledge<br />
<br />
*Engineering biology<br />
<br />
*The design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes<br />
<br />
*The essay to create a functional biological system, starting with the smallest parts<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*How to apply engineering in cells<br />
<br />
*Studying Protein design and trying to optimize it by genetical means. Also designing new functions for organisms is called synthetic biology<br />
<br />
*Synthetic biology is genetic engineering on a larger scale, involving editing of genes, building entire systems, synthesis of dna, and application of engineering methods to genetic modification.<br />
<br />
*designing biological systems that are not already in nature.<br />
<br />
*standarized parts, new functions, quatative analysis, model<br />
<br />
*transfer of gens from cell 1 into cell 2, the trying to creat new products any kind (enzyms, cells, pathways)<br />
<br />
*build new biological systems<br />
<br />
*Engineering genes of biological systems to add to their way of everyday living.<br />
<br />
*engineering / programming life<br />
<br />
*The synthetic biology aims to build new biological parts for the creation of new genes and in the future whole genoms.<br />
<br />
*This will provide new opportunities in medicin, biochemics and engineering.<br />
<br />
*Creating artificial biological systems<br />
<br />
*Hm, I would say sort of designing new molecules, new biochemical pathways or even organisms ('minimal cells') etc. which don´t exist in nature.<br />
<br />
*the redesign of natural biological parts to perform a new useful task<br />
<br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/All_DefinitionsTeam:Valencia/All Definitions2009-10-22T03:48:50Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 25000px;<br />
}<br />
</style><br />
</html><br />
==''All Definitions'''==<br />
<br><br />
<div align="justify" style="position:relative; top:-250px; left:10px; width:700px; color:black; font-size:11pt; font-family: Verdana"><br />
<br />
In our suvey we asked for the definition of Synthetic Biology, and we received lots of answers:<br />
<br />
*Synthetic Biology aims to use a combination of engineering principles and biological knowledge to design and construct standard parts, devices and systems, and re-design existing biological systems, for purposeful and efficient functionality.<br />
<br />
*design new biological part or system by applying engineering strategy<br />
<br />
*Synthetic biology is a new approach to biology, which aims at synthesizing and engineer components and biological systems to new or re-engineering existing biological elements in order to create systems performing useful functions.<br />
<br />
*Engineering biological systems according to an idea of bio-blue prints, making standardization of biology possible.<br />
<br />
*The use of an engineering approach to molecular biology with the object of creating new life forms that will have a practical application<br />
<br />
*Application of engineering principles and methodology on biological systems in order to change them or create new ones to fulfill some purpose<br />
<br />
*Using engineering principles as a standardised way of designing biological devices<br />
<br />
*"yes i can :D hum... say just that it's a concept of 'engineered biology' using the industrial tool in biology : standards, concept and so on."<br />
<br />
*A mixture of Science and Engineering. The building of live machines.<br />
<br />
*The synthetic biology is the engineering of live: the synthesis of complex systems based on the biology, and which perform functions don't existing in the nature.<br />
<br />
*Application of engineering principles (modularity, abstraction) to rationalize the art of genetic modification, increasing the complexity of systems that can be designed and constructed reliably.<br />
<br />
*The application of engineering principles to creating biological machines, based on gene regulatory networks.<br />
<br />
*Using design and engineering principles to create biological devices.<br />
<br />
*building of new systems using engineering and sciences<br />
<br />
*synthetic biology is for me the combination between modern bioscience and engineering. Thereby creating new organisms and or biomolecules which are not existing in live,<br />
<br />
*A ground up approach to genetic engineering in which parts encoding primitive biological functions are combined in model organisms to elicit new and useful biological behavior.<br />
<br />
*Designing and engineering new biological parts and systems using natural biology in a creative way.<br />
<br />
*The design, creation and testing of artificial biological systems using an engineering approach.<br />
<br />
*It is a process which involves engineering/building/designing artificial in order to create a biological systems or functions<br />
<br />
*Application of engineerings and design approaches to the construction of novel biological functionalities.<br />
<br />
*A new discipline that aims to design new organisms or add new functionality to already available organisms using modular components<br />
<br />
*Creating new functionalities or immitating naturally occuring functionalities in biological sytems by building up genetic regulatory networks from standardized compounds.<br />
<br />
*Engineering and constructing of new biological functions in a biological system.<br />
<br />
*New view on synthetic biology, try to engineer biology, life.<br />
<br />
*the design of standard parts that does not exist yet or reconstruct other parts it is engineering<br />
<br />
*engineering of biological components and systems that do not exist in today's society<br />
<br />
*Synthetic Biology is a term used for a wide variety of developing technologies and ideas that bridge the divide be science, engineering and technology. Mainly this is focused around 're-building' already existing organisms in order to make them more effiient etc. as well as creating new organisms.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*A discipline in bio-engineering, with emphasis on building genetic elements that encode biological functions in a modular fashion.<br />
<br />
*taking naturally occurring systems or functions and applying them for a function that they are not naturally doing by taking an engineering approach.<br />
<br />
*Modular approach to biology by constructing/synthesizing genetic networks or life forms via genetic engineering techniques.<br />
<br />
*Taking biological engineering concepts and expanding them to be abstracted and standardized to ease the 'programming' of biology.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Applying engineering principles to biology in an attempt to work towards standarization, abstraction and acceleration.<br />
<br />
*Building new organisms through the combined use of biology and engineering.<br />
<br />
*using engineering, biology and bio-engineering to design new systems with a variety of applications, in a modular and controlled way<br />
<br />
*Synthetic Biology is the practice of combining well defined components to create engineered nanomachines with novel properties that the components alone would not have had.<br />
<br />
*Build novel biological systems which don't exist in nature by joining several standard parts together.<br />
<br />
*It is a field where we engineer biological components into different system which are not present in the nature.<br />
<br />
*An engineering approach to biology, with the goal of designing and implementing new cellular behaviors<br />
<br />
*Synthetic Biology is an art of engineering new biological systems that don’t exist in nature.<br />
<br />
*Enginering organisms to perform a new function<br />
<br />
*Life created from standard components to perform well-defined tasks.<br />
<br />
*The merging of biology and engineering disciplines, generally characterized by forward engineering de novo biological constructs rather than reverse engineering existing biological entities and systems.<br />
<br />
*Synthetic Biology is a growing field concerned with the integration of biology and engineering to design biological machines from standard biological parts.<br />
<br />
*Using engineering and science techniques to create novel biological systems<br />
<br />
*Brings ideas from engineering and biology together to allow for the creation of 'new' synthetic biological entities<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Is science which combines biology and engineering in order to combine new systems that are able of making new products or functions.<br />
<br />
*Use engineering and biology to design and creat a new life<br />
<br />
*Engineering cells to complete a new function<br />
<br />
*A combination of the natural sciences and engineering techniques to achieve novel biological systems.<br />
<br />
*Synthetic Biology combines chemical, biological and engineering sciences to (re)create biological systems with novel (engineered) functions<br />
<br />
*Engineering biology in a standardized way.<br />
<br />
*Synthetic Biology is an emerging field that aims to combine principles from biology and engineering so as to engineer biological systems to perform novel tasks.<br />
<br />
*Synthetic biology attempts to standardize biological practices with the ultimate goal of engineering biological systems.<br />
<br />
*The application of Engineering principles to Biology. Synthetic Biology builds on the foundation laid out by Molecular Biology (including Restriction Enzymes, PCR and Sequencing) by adding synthesis, standardization and abstraction.<br />
<br />
*Creating synthetic organism/systems/parts using standard parts<br />
<br />
*Synthetic Biology is an area that combines science and engineering in order to design and build new biological systems using standard elements.<br />
<br />
*Using principles of bioscience, engineering, mathematics and other related sciences to modify bacteria so that the bacteria will be able to fulfill a bunch of specialized functions.<br />
<br />
*joining the power of life sciences and engineering in order to get novel biological systems/functions<br />
<br />
*Engineering of biological lifeforms at the genetic level with the desired result of new behaviour or metabolism that is not considered to be part of their natural function.<br />
<br />
*An area of science where biological sciences and engineering are combined to build or create biological structures from scratch.<br />
<br />
*The amalgamation of the fields of mathematics, engineering, life sciences, biology, chemistry and everything in between to come up with novel ways of creating microbes to do things for us.<br />
<br />
*Abstracting biology concepts with an engineering framework to introduce standards into the field. Like lego.<br />
<br />
*Using standardized biological parts for new devices and systems or to re-design natural systems from standardized parts<br />
<br />
*Synthethic biology is a rapidly evolving research area that combines science and engineering in order to design, synthesize, and analyze novel biological functions and systems.<br />
<br />
*Synthetic biology is the powerful interface between biology, engineering, and computer science. It has great potential for the development, creation, and thorough understanding of novel biological systems.<br />
<br />
*Synthetic Biology defines a combination of Life Sciene and Engineering. It's goal is to create new biological systems and to improve the understanding of complex pathways by experimental and computational work.<br />
<br />
*Synthetic biology is a new discipline of life sciences focused on bringing engineering into biology. It uses engineering concepts like modeling and standardization to create biological devices with new capabilities that do not exist in nature.<br />
<br />
*The development of new life from the bottom up.<br />
<br />
*The systematization and re-arrangement of life as we know it today to have new functions, making it engineerable.<br />
<br />
*A new interdisciplinary field, that involves the design, construction and standardization of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Synthetic biology applies fundamental engineering concepts like standardization and abstraction to biology in order to allow reliable design of biological devices and systems.<br />
<br />
*The use of engineering principles to model, design and use modular units of biology to construct new biological devices.<br />
<br />
*It is an extension of the field of gennetic enginereing which applies enginereing principles to standardise and simplify biological systems and make new ones<br />
<br />
*To engineer the bacteria which have some new functions by introducing genes which are normalized as parts<br />
<br />
*The application of engineering principles and processes to genetic manipulation, with a focus on furthering our understanding of biological systems by the mimicry of, and creation of orthogonal alternatives to, those systems via abstraction and characterisation of their component devices and parts<br />
<br />
*Systems biology studies complex biological systems as integrated wholes, using tools of modeling, simulation, and comparison to experiment.<br />
<br />
*trying to save the world<br />
<br />
*Letting your brain think up new and exciting posebilities for challeging problems you are confronted with.<br />
<br />
*The syntethic biology is a technique used by engeneers to modulate living systems. The goal is to use existing technics and to jungle with them to create new processes<br />
<br />
*Design, construction and assembly of biological parts.<br />
<br />
*an electronically transformed guy<br />
<br />
*A field in which bacterial computers or functional gene based systems are constructed for the benefit of science<br />
<br />
*Synthetic Biology (SB) is at the interface of Engineering and Molecular Biology. The basis of SB is that a cell can be broken down into hierarchies and viewed as a combination of functional elements, just like any machine, allowing construction of complex biological systems from first principles.<br />
<br />
*engineering of artificial biological systems with the use of synthetic components in living organisms<br />
<br />
*Synthetic biology is the manipulation of organic material to make new organic material. For example, it is currently mostly applied in DNA, where plasmids for bacteria are made artificially and applied to bacteria to perform certain functions<br />
<br />
*adding features to an existent bio-system like adding new methods using a Operative System to boot it up<br />
<br />
*Design of different things with biological elements<br />
<br />
*genetic engineering under precise control.<br />
<br />
*Using new technologies and combining tecnology with biology.<br />
<br />
*An interdisciplinar field of science concentrated on developing a biological systems.<br />
<br />
*Yes, in my mind I think it means use bacteria and some other kinds of living things like that to produce the products we want. Often people need to do some genetic engineering to make the bacteria produce the certain products.<br />
<br />
*In just a few words I would define synthetic biology as a field op bioengineering with natural an artificial components.<br />
<br />
*Designing and engineering novel activities de novo using existing chassis or building novel chassis<br />
<br />
*the design and creation of devices in a living cell<br />
<br />
*I guess you could say there are two approaches: 1) the making of (and thereby defining) life from scratch. 2) reverse engineering known lifeforms to make it more easy to engineer.<br />
<br />
*Engineering with DNA<br />
<br />
*Rational genetic engineering.<br />
<br />
*extensive genetic engineering of organisms<br />
<br />
*Engineering the DNA circuits, design and implement specific functions, global and network-oriented approach<br />
<br />
*un ingénierie du vivant.<br />
<br />
*Naturally occuring organisms that have been genetically altered.<br />
<br />
*Creating functions by directed evolution<br />
<br />
*brainstorming<br />
<br />
*Modularising Components of Bacteria and DNA to allow simple organisisms to be used in an engineering context<br />
<br />
*genetic engineering---make the proper organism to produce the product of interest<br />
<br />
*Using highly artificial molecular-biological tools in biological systems for some research-related application.<br />
<br />
*Taking individual molecular processes and compiling them to complete a task different than normally used<br />
<br />
*international genetically engineering machine<br />
<br />
*to use genes or DNA moleculars to construct some functional part.<br />
<br />
*The use of a biological system to replace a classical engineered system<br />
<br />
*Genetic alterations in organisms, typically bacterial, resulting in a change, such as a biological process for industrial or other type of application<br />
<br />
*using synthetic approach to do biology<br />
<br />
*The synthesis and modification of biological systems on a genetic level.<br />
<br />
*Constructing biological parts.<br />
<br />
*Synthetic biology is the principle of applying genetic modification to achieve an alternation of certain organic functions.<br />
<br />
*The application of biological and biochemical techniques for the develop and engineering of classically designed systems and tools from biological parts (i.e. nucleic acids, protiens, lipids and carbohydrates).<br />
<br />
*The systematic study of the effects and uses of inserting useful artificially engineered gene sequences into living cells.<br />
<br />
*The use of biological elements in genetic engineering to create a system which is useful in solving complex and important problems.<br />
<br />
*Treating bacteria as machines and genetically modifying them for novel applications.<br />
<br />
*design of existing, natural biological systems for useful purposes<br />
<br />
*To assemble DNA parts and transform it into the module to express certain function.<br />
<br />
*Modifying genes in organisms to perform a specific function to design biological parts<br />
<br />
*Cannot!<br />
<br />
*Engineering life.<br />
<br />
*The design and construction of synthetic biological systems.<br />
<br />
*It is something for the next generation<br />
<br />
*a new mode of production or imitation by engineered organisms<br />
<br />
*creating a genetic network of genes from various sources in a chassis organism<br />
<br />
*Building machines using non-conventional parts of biological origin<br />
<br />
*the (re-)design and construction of biological parts and systems.<br />
<br />
*the engineering and modification of a natural system (i.e. a cell)<br />
<br />
*Synthize devices with biological activity by way of design from genetic level<br />
<br />
*build up meaningful organism with small materials<br />
<br />
*making new biological parts<br />
<br />
*creat special protein by assembling different genes together<br />
<br />
*The synthesis of biological parts to form improvised parts.<br />
<br />
*synthesizing biological organisms using biological building blocks<br />
<br />
*Re-Engineering biological organisms found in nature to be tools for useful purposes or creating biological parts the future<br />
<br />
*synthetic biology is...a newly developed scientific field that deals with brand new types of and applications of genetically engineered, or modified, organisms.<br />
<br />
*hmmm...not pretty sure as to define it in short words though.<br />
<br />
*Using and combing nature biological components to create something new<br />
<br />
*A mix of math and biology<br />
<br />
*artificially putting constructs of DNA sequences into an organism to achieve desired traits.<br />
<br />
*Using basic genetic parts to reconstruct life with fancy fuctions.<br />
<br />
*!@!*$@!$<br />
<br />
*To use biological components as pieces of machinery<br />
<br />
*giving a bacteria genetic qualities so that it does things you want it to do<br />
<br />
*engineering bacteria in a controlled way<br />
<br />
*Using some skills make a new gene part.<br />
<br />
*synthesizing working biological circuits from smaller biological entities for desired purposes<br />
<br />
*Synthetic biology is an emerging scientific field which focuses on introducing novel functions to simple cells via DNA manipulation and synthesis.<br />
<br />
*Ability to induce some already known and unknown phenotypes in a new system. Eg. fluorescent fishes.<br />
<br />
*Creating life (or something on a smaller scale).<br />
<br />
*To build a biological machinary for a certain purpose.<br />
<br />
*using DNA to construct the new brand or function of creature<br />
<br />
*Synthetic biology is rearranging DNA in living organisms to try and make them perform a function they do not naturally do.<br />
<br />
*Constructing biological components from raw materials.<br />
<br />
*a biological competition<br />
<br />
*1. conventional view: using bioparts to make genetic circuits<br />
<br />
*2. synthetic genomics view: combinatorial genomics<br />
<br />
*Synthetic biology is the process by which human beings create biological organisms that operate in unique ways (i.e. not found in nature) using standard biological processes that exist in nature<br />
<br />
*using standardized method to genetically engineer/modify organisms<br />
<br />
*exploring the possibilities of recombined organic molecules (mostly proteines and nucleic acids) which were constructed using the principles of molecular biology<br />
<br />
*To define it you can compare genes as functional building blocks, that can be moved among organisms. In synthetic biology this is utilised to make biological systems with the functions we request.<br />
<br />
*design and construction of biological systems<br />
<br />
*The science of using DNA parts to build up a complex biological system<br />
<br />
*brain storming<br />
<br />
*to me it is making chemicalsystems behave lifelike, and alsow manipulating whit allredy living organismens<br />
<br />
*Building biological systems from the bottom-up.<br />
<br />
*The application of biological components to produce bio-synthetic components.<br />
<br />
*Engineering organisms or life basically to exist or produce desired chemicals, etc.<br />
<br />
*genetically engineering of E. coli and other organisms to produce desired products<br />
<br />
*Manipulating the genetics code of an organism in order to make it produce a product of interest<br />
<br />
*Synthetic biology is the next step after genetic engineering. It involves industrialiing the processes behind genetic engineering so that we can work at a higher leve.<br />
<br />
*Design of genetic material in organisms to accomplish a task.<br />
<br />
*design and manipulation of biological, namely genetic, parts<br />
<br />
*To build up a building with the blocks of genes<br />
<br />
*contructing new biobrick parts, making biology easier for engineers<br />
<br />
*This picture represents a person trying to brainstorm using a mechanical device which apparently gave him some cool idea. The person as such doesnt look so bright<br />
<br />
*Yes<br />
<br />
*Branch of Bio where u cut copy and paste parts of DNA to get new parts with new functions :)<br />
<br />
*Man-made biological processes and parts<br />
<br />
*Synthetic Biology is genetic engineering using genes as separate parts that can be combined to do cool things. Whoa.<br />
<br />
*Manipulating the genes of organisms to make them perform some function not natural to them.<br />
<br />
*Manipulating the genetic material of a microbe in order to make it perform actions it normally would not.<br />
<br />
*Synthetic biology is the use of math, compuer science, and life sciences to design and construct 'biological machines' for the use of prbolem solving and advancement.<br />
<br />
*[Re]design of biological systems for the purposes of conducting basic science as well as developing applications.<br />
<br />
*The designing of biological parts<br />
<br />
*design and construction of new biological parts<br />
<br />
*Yes.<br />
<br />
*development of biological tools to assist reseach ect.<br />
<br />
*regard genes as bricks, build in a machine with specific function<br />
<br />
*This is a poor boy with thinking cap.<br />
<br />
*Human-manipulated usage of organisms and cellular buildingblocks (cells, proteins, molecules, horomones, enzymes, etc.)<br />
<br />
*Combining man-made parts and mechanisms with natural components (like Bacteria) for a processes.<br />
<br />
*Synthetic Biology is like biology in computer form.<br />
<br />
*To manipulate the DNA sequence in order to create new combination or new function or whatever<br />
<br />
*New area of biology<br />
<br />
*artificially modifying natural biological processes/organisms to perform a task or improve functionality<br />
<br />
*It is mad!<br />
<br />
*study to make possible life.<br />
<br />
*Using biological components to synthesize systems<br />
<br />
*bacteria machine bottom up approach creative<br />
<br />
*synthetic biology is the combination of biology with electrical engineering to create biological circuits<br />
<br />
*Yes<br />
<br />
*Building biological systems from various parts (genes)<br />
<br />
*Putting genes into organisms to make them do cool things<br />
<br />
*Engineering living things to do something useful.<br />
<br />
*Using various biological parts to build unique living things which has self regualtion system.<br />
<br />
*fixing parts together to make a genetic network<br />
<br />
*Artificial recombintaion of biological parts<br />
<br />
*Remodeling biological processes on an artificial, chemical level<br />
<br />
*ertgr5<br />
<br />
*Biosynthesis is enzyme-catalyzed process wherein more complex chemical compounds are produced from simpler substrates<br />
<br />
*[wikipedia]<br />
<br />
*creating out of different genetical parts new organisms<br />
<br />
*It is the design and fabrication of biological parts/systems.<br />
<br />
*Synthetic Biology is Systems biology in reverse - obtaining in vivo results by in silico prediction<br />
<br />
*Synthetic biology is a field which tries to look at the complex biological network by exploring every layer of the biological complexity. Therefore synthetic biology provides an explanation to the complications of the natural biological systems by artificially re-building them and studying them.<br />
<br />
*Synthetic biology is how to make automated programming of living organisms.<br />
<br />
*Wants to be the area of engineering organisms, but currently is a crude form of re-engineering organisms. Largely a slow progression of the metabolic engineering from the mid 1980's---slightly more dynamic in its control strategies, though.<br />
<br />
*man-made genetic 'circuits'<br />
<br />
*TV Show<br />
<br />
*Synthetic Biology can be defined as the field of biology that can be clustered with artificial world in various applications.<br />
<br />
*It's just like a jigsaw puzzle, putting different gene sequence together to reach a certain goal.<br />
<br />
*Within an organism, re-designing the layout of genes, and further produce biological 'program' to control the behavior of organisms<br />
<br />
*its the science of trying to understand biology by breaking it down into its simplest parts and then building up from these parts<br />
<br />
*It is about understanding better the microbiological world, by developing tools in parallel in wet and dry labs. It's an assembly of tools to reconstruct synthetically or construct from the scratch new pathways, genomes...understanding better allows to control better.<br />
<br />
*A field of knowledge that aims to understand the functions of the living by synthetizing it into others organism.<br />
<br />
*It is about understanding the basic of life forms and assembling them together.<br />
<br />
*making artificial biological systems in order to understand living systems<br />
<br />
*1) understanding biological systems in terms of their components and 2) designing novel parts, processes or subsystems based on those found in natural systems<br />
<br />
*SB seeks both a better understanding of natural biological systems (including their evolutionary origin), and the design and construction of artificial devices that solve technological needs throughout the simplification of biological systems.<br />
<br />
*Its a tools by which we can transfer a phenotype from one living system to another new system. The phenotype may be not necessary for survival of the new system. But this would help us better understand the phenotype.<br />
<br />
*an attempt to better understand and work with biological systems through the creation, standardization, planned combination, and characterization of segments of these systems.<br />
<br />
*An area of biology that aims to understand 'what is life' and apply biotechnologies by creating and analyzing genetically modified organisms.<br />
<br />
*Applying thought processes from various areas of science to gain a better understanding of biological systems<br />
<br />
*The engineering of nature in order to produce commercial goods or services or in order to further current knowledge of biological systems.<br />
<br />
*Synthetic biology is understanding and modifying existing biological structures and pathways to come up with engineered cells with unique and useful properties.<br />
<br />
*The attempt to artificially create life based on knowledge gained from existing life.<br />
<br />
*Engineering + Cell Biology - World Domination<br />
<br />
*Engineering approach to biology<br />
<br />
*Synthetic biology can be understood as the design and construction of new biological systems not found in nature<br />
<br />
*Applying engineering principles in biological systems to manipulate them into useful tools.<br />
<br />
*engineering biological systems according to rules of engineering such as insulation, abstraction or modularity.<br />
<br />
*Synthetic biology is an engineering approach to biotechnology<br />
<br />
*It could be defined as the engineering of Biology. It aims at providing reusable and modular biological systems to promote and stimulate innovation in Biotechnology.<br />
<br />
*engineering biology<br />
<br />
*Making new 'live devices' from genetic elements found in different organisms.<br />
<br />
*Engineering approach to molecular biology<br />
<br />
*designing new or re-designing existing, natural biological systems, devices etc. for useful purposes<br />
<br />
*It consits out of genetic engineering (PCR, recombinant DNA, etc.) sequencing, automation, abstraction, standardization, computer modeling.<br />
<br />
*it is the engineering of biology<br />
<br />
*inspired by Nature created by Human to develop new biological features and to unveil non yet understood biological/molecular pathway behaviour.<br />
<br />
*science standardization engineering life<br />
<br />
*molecular biology with the idea of standardization : the idea is to synthetize DNA from small standard parts<br />
<br />
*Synthetic biology is about doing functional standart with living organism in the aim to make them 'doing thing' you planed.<br />
<br />
*Working on a DNA level to engineer something new by combining allready excisting and new components of DNA.<br />
<br />
*Synthetic biology is a way to standardize biology by using standardized genes and genetical systems. It is trying to make biology standard enough to use it to engineer your own synthetic system with it.<br />
<br />
*enginering of bacteria<br />
<br />
*Engineering systems using genetic techniques.<br />
<br />
*sythetic biology is the engineering of cells. To make them do what you want to use them as machines. Using parts from many diffrent organisms or creating your own from scratch<br />
<br />
*It's considering life sciences from the point of view of an engineer, doing great GMOs using MB and CB tools. It's also thinking about what all this means as regards the special position of humans among terrestrian creatures.<br />
<br />
*Synthetic biology is the field gathering the methods enabling the engineering of biological systems.<br />
<br />
*Applying engineering principles in using independent and well characterised biological modules<br />
<br />
*engineering biological systems<br />
<br />
*It is the use of already existing DNA parts to create new functionalities in organisms.<br />
<br />
*It is an area of the sciences whose main aim is to create synthetic features which produce a desired phenotype when inside a specific organism.<br />
<br />
*Using technology to assemble new biological systems.<br />
<br />
*To engineer organisms or pathways to perform a specific task.<br />
<br />
*Thinking like a engineer and doing like a molecular biology.<br />
<br />
*new field inthat puts engineering into molecular biology<br />
<br />
*It's a new area of research, aiming at synthesizing complex systems, inspired by living being, with new functions which do not exist in nature, from simple bricks of DNA.<br />
<br />
*The possibility to engineer genetic systems out of simple genetic parts : It's a kind of 'genetic programation'<br />
<br />
*The altering of natural life to better serve human needs through an engineering approach, or the creation of synthetic life.<br />
<br />
*The construction of new biological systems using building blocks from other, well characterised, biological systems.<br />
<br />
*Designing/building novel biological 'machines' using biological parts.<br />
<br />
*The genetic manipulation of current organisms to introduce new systems/protein pathways and/or alter the existing systems/protein pathways of the organism.<br />
<br />
*science which deals with the design of new biological organisms according to native model organisms for optimization purposes...<br />
<br />
*Engineering biological systems in a systematic and minimalistic level to perform defined tasks<br />
<br />
*It's about designing and engineering in silico organisms to rock our future life, yeah.<br />
<br />
*'breaking' biological systems into small parts and store them, that everybody can have access to them and assemble them in a way that's useful to them. Thereby new biological systems can be build.<br />
<br />
*combination of biology and engineering methods<br />
<br />
*system biology with engineering<br />
<br />
*Synthetic Biology tries to use standardized devices and methods to influence the behaviour of cells. Important is the transferability of parts and devices in synthetic biology.<br />
<br />
*Create a new kind of organism by known biological elements, whose behaviours could be estimated by computational/theoretical model<br />
<br />
*Synthetic biology applies engineering principles to biology, thus it uses 'parts' to build 'machines'.<br />
<br />
*synthetic biology is a discipline where biological element/basic parts are dissected firstly, and then we assemble them to achive new functions that do not exsist or that have not been discovered, or we can exploit them to optimize the original biological system.<br />
<br />
*Synthetic biology is the use of biological techniques to create new biological systems that help solve problems.<br />
<br />
*design and constructions of new biological parts for usefull purposes<br />
<br />
*design new system to perform novel functions<br />
<br />
*The intersection of biology and engineering.<br />
<br />
*Using what is known about naturally occurring biological systems to construct novel biological parts, networks and systems, often with a desired functionality or purpose.<br />
<br />
*Just like computer programming, syn bio is aim at constructing biological system with standardized modules<br />
<br />
*Building up a new device from the parts available in nature<br />
<br />
*the application of quantitative design framework for modifying, creating, and controlling living organisms and processes, particularly at a genetic and cellular level.<br />
<br />
*Synthetic Biology is where the biology involved is being created by non natural means.<br />
<br />
*the design or redesign of biological parts for manipulation bio systems or creating new devices<br />
<br />
*The design and construction of novel biological systems.<br />
<br />
*A means of standardizing biology by us<br />
<br />
*Creating macro-scale biological machines from micro-scale biomolecular components.<br />
<br />
*Engineering biological systems or organisms for a purpose.<br />
<br />
*Synthetic Biology is a science that uses standard interchangeable parts to build genetic devices.<br />
<br />
*Its is a new area of science that requires biology and engineering to work together<br />
<br />
*Creating standardised biological parts for use and assembly for a variety of applications.<br />
<br />
*Genetic engineering resulting in a useful novel living system.<br />
<br />
*Re-creating organisms for developing of science and consummate the human interest<br />
<br />
*Messing around with biological systems using engineering and design principles along with molecular biology techniques to make them do something sweet.<br />
<br />
*Putting Biobricks together.<br />
<br />
*an area of biological research that combines science and engineering<br />
<br />
*In the synthetic biology we create new micro-organisms or just beneficial tools out of already existing organisms...<br />
<br />
*The design and construction of new biological parts, devices and systems that do not exist in the natural world and also the redesign of existing biological systems to perform specific tasks<br />
<br />
*Artificial life or devices created from biologicak materials<br />
<br />
*Build life from simple molecule.<br />
<br />
*The modification/improvement of existing biological systems or the creation of new ones in order to realize a genetically modified organism that show new and interesting skills.<br />
<br />
*the design and fabrication of biological components and systems that do not already exist in the natural world or re-design and fabrication of existing biological systems.<br />
<br />
*build biological systems made from standard biological parts<br />
<br />
*...<br />
<br />
*It is the construction of new biological parts, devices, and systems.<br />
<br />
*It is the biological material engineering, in order to add or modify a particular function of living organisms.<br />
<br />
*engineered biological systems<br />
<br />
*Application of engineering principles in life sciences.<br />
<br />
*Approaching to biology in a more rigorous, quantitative way, in order to create regulable biological systems.<br />
<br />
*Using DNA manipulation to modify existing biological systems or to create new biological systems for a purpose<br />
<br />
*The building of biological circuits and organisms based on well-defined, well-characterized, and standardized parts.<br />
<br />
*The science that tries to engineer biological systems in a controlled way<br />
<br />
*building new biological machines out of existing biological parts<br />
<br />
*Design of standard parts (biobricks in the iGEM competition)<br />
<br />
*To use natural things to create artificial ones.<br />
<br />
*Creating novel products using biological parts<br />
<br />
*Using genes as building blocks in creating organisms with characteristics that we desire.<br />
<br />
*The reduction of biological processes into manipulated parts, and the recombination of these parts into more complex devices.<br />
<br />
*Applying a hierarchical model to genetic engineering, where each gene is treated as a single 'part' that can be combined to make composite parts, devices, and machines.<br />
<br />
*designing or redesigning and building biological systems, parts, or devices for some [useful] purpose<br />
<br />
*design or modify a creature by some standard methods related to genetics engineering so that it has some specific function<br />
<br />
*Synthetic biology is the application of the idea of engineer to the field of biology science. And the result would be amazing.<br />
<br />
*synthetic biology is using 'non-living' organisms and using them to create functional systems<br />
<br />
*I think any definition is non-encompassing. A field that combines Science and Engineering to design new systems,<br />
<br />
*it is engineering and biology mixed into a novel and exciting study<br />
<br />
*The design, production and refinement of artificial biological circuits to perform useful functions for humans.<br />
<br />
*It is basically combing science and engineering in order to design and build biological functions and systems.<br />
<br />
*Making new biological awesomeness!<br />
<br />
*use some basic element to create a complicate systems<br />
<br />
*Make artificial biological systems!<br />
<br />
*It's the most simple way to do engineering as well as 'NATURE'<br />
<br />
*Synthetic biology is one field of science that encourages people to use DNA recombination skill which can create new system in any cells and have new usage.<br />
<br />
*Synthetic biology studies how to build artificial biological systems.<br />
<br />
*Through the change of DNA to make a new creature.<br />
<br />
*Using biological parts such as promoter, binding site and coding sequence, compromise the whole something new biological system it never exists naturally<br />
<br />
*synthetic biology is like an engineering science. Being able to build biological machines use synthetic parts.<br />
<br />
*ynthetic Biology is a new technology which applies engineering principles to biology. It is an advancement from genetic engineering, which uses the insertion/deletion of a few specific genes to one where we can engineer highly regulated genetic systems.<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Building of new novel biological parts/devices/systems for engineering applications<br />
<br />
*synthetic biology is the engineering of biοlogical systems in order for the latter to have desired properties.<br />
<br />
*the construction of novel biological systems to replace classically designed machines<br />
<br />
*Making machine based on biologic system<br />
<br />
*Technics of engineering applied on biological systems<br />
<br />
*constructing new abilities by cutting and pasting with DNA, thus enabling cells to make/do something they don't naturally do.<br />
<br />
*Synthetic biology is the artificial manipulation of genetic code to produce novel organisms or organisms with a desired, predictable function based on the manipulated genes.<br />
<br />
*Finding a way to create life in a test tube and not using 'alive' precursors<br />
<br />
*To create lifes that as our wish.<br />
<br />
*It's the making of synthetic organism from the bottom up.<br />
<br />
*Constructing complex biological systems out of standard parts.<br />
<br />
*creating new biological systems out of different parts<br />
<br />
*Create new biological systems from parts of existing ones<br />
<br />
*Synthetic biology, analogous to synthetic chemistry, is a field in which complex molecular-level mechanical systems are synthesized from genetically engineered biological components. SynBio attempts to recreate or modify constructs normally found in nature in the lab.<br />
<br />
*An approach to study and apply biology through modularization and standardization<br />
<br />
*Creating of biological systems not present in nature<br />
<br />
*Synthetic Biology is the ability to create/implement systems not previously found in that organism. We can uses these systems to do anything from display a picture to create chemicals.<br />
<br />
*It is an applicative branch of biology focused on inventing and using novel organisms (especially genetically modifed) or their products that differ from natural ones and have new useful functions.<br />
<br />
*it's an area of research that enables us to modify and build new biological systems<br />
<br />
*The construction, engineering and reengineering of organic machinery<br />
<br />
*the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*synthetic biology is designing novel biological systems using well defined basic biological components.<br />
<br />
*Synthetic Biology is Engineering biological systems to perform a specific function<br />
<br />
*breaking down and analyzing biological subsystems and recombining them in such a way that they perform new tasks<br />
<br />
*synthetic biology is rewiring the naturally found genes to make new circuits which deliver better,predictable and programmable outputs.<br />
<br />
*engineering of biological parts<br />
<br />
*engineering biology<br />
<br />
*making organisms with new and hopefully useful functions<br />
<br />
*decouple life, Construct life<br />
<br />
*Biology which starts in essention on genes and they are combined to engineer and create new bacteria with specific features you just want.<br />
<br />
*Novel thought process leads to Innovation and creativity.<br />
<br />
*The biological equivalent of digital system design. Hopefully Moore's Law will also be applicable.<br />
<br />
*according to me it is applying engineering principles to biological system so that we can understand it in a better way or achieve some novel output from a cell.<br />
<br />
*use the known bio-parts to construct a new system.<br />
<br />
*A field that combines engineering and biology to build life forms for useful purposes<br />
<br />
*Biological engineering at the DNA level<br />
<br />
*An area of biology that involves designing and building new bilogical systems and functions.<br />
<br />
*Applying an engineering mindset to the medium of biology.<br />
<br />
*An engineering approach to biology<br />
<br />
*Engineering biological machines using cells as a media.<br />
<br />
*Synthetic biology is the practice of engineering biological systems to produce a specific product using well characterized 'parts'.<br />
<br />
*It is putting together DNA sequences / Genes from multiple organisms that would not normally interact with each other to create a construct that exhibits a novel function.<br />
<br />
*an interdisciplinary field combining biology and engineering<br />
<br />
*Engineering biological components.<br />
<br />
*Synthetic biology: Involves combination of Engineering with Science, to synthesize biological functions/systems<br />
<br />
*Synthetic+Biology - to artificially inducing a new property in a another living system<br />
<br />
*Make biology easy to engineer.<br />
<br />
*engineering and analyzing synthetic biological networks<br />
<br />
*Using genetic engineering to create artificial (non-naturally occuring) organisms, with specific functions.<br />
<br />
*the study of applied engineering in biology<br />
<br />
*new kind of biology that tryes to modify biological sistems in order to gain new functions<br />
<br />
*Genetically modifying an organism to perform a novel function (novel to that organism).<br />
<br />
*Synthetic biology is to compose and engineer biological organisms and manipulate them to do desired actions.<br />
<br />
*A multi-disciplinary field that is rapidly emerging. The field tried to build biological systems with parts called biobricks.<br />
<br />
*engineering and biology and design<br />
<br />
*The rational design and production of organisms (new or modified) or multi-cellular systems, using genetic manipulation/ modification techniques, that have functions or combinations of properties not normally found in nature.<br />
<br />
*Creating new organisms by modifying dna<br />
<br />
*Synthetic Biology is the design and creation of new biological parts, devices and systems and the redesign of existing biological parts, devices and systems for useful purposes<br />
<br />
*Synthetic Biology is the study of designing a new biological devices or reconstructing an existing parts.<br />
<br />
*Syntetic biology is the designing and creation of biological systems, both to enhance known systems or to create new ones<br />
<br />
*The creation of artificial systems<br />
<br />
*The engineering of biological systems<br />
<br />
*design, construction of new biological parts, devices, systems re-design of existing systems for useful purposes<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes<br />
<br />
*Sure.... Oh define it here I get it. Synthetic Biology is the feild of biology devoted to the creation of novel pathways or proteins in organisms that did not previously use said pathways.<br />
<br />
*Engineering biological devices to do useful things<br />
<br />
*standardization of biology and the tools used to manipulate it<br />
<br />
*Synthetic biology is manufacturing a new kind of creature by any methods, including chemical, physical, biological ways<br />
<br />
*it is the combination of biology and engineering which synthesis some biological products or systems<br />
<br />
*Changing or creating new biological systems or processes<br />
<br />
*To be able to create smaller component parts of the genomic world that can radically alter the abilities of a cell to accomplish specified tasks.<br />
<br />
*Synthetic Biology, an intertwining of principles from Biology and Engineering<br />
<br />
*Constructing new biological parts from existing ones<br />
<br />
*Design. construction and standardization of biological parts.<br />
<br />
*Biological Engineering<br />
<br />
*"the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes."<br />
<br />
*The reduction of an array of molecular biology techniques into a standardized set of common practices designed to streamline modern molecular biology.<br />
<br />
*Synthetic biology is the design and construction of new biological parts, devices, and systems which are either novel to the natural world or are modifications based on existing biological systems. The goal is to program organisms to perform specific functions.<br />
<br />
*applying engineering principles to solving biological problems<br />
<br />
*field involved in the engineering of biological parts, devices and systems by standardizing DNA sequence information for reuse in designs<br />
<br />
*a way to build new biological systems<br />
<br />
*Engineering biology from the ground up.<br />
<br />
*The use biotechnology in a consistent and systematic way to engineer modified organisms with relative ease (as compared to traditional biotechnological methods).<br />
<br />
*It involves designing and modeling biological systems<br />
<br />
*It is a magic field of study where we can design an artificial genetic network to endow novel biological and non-biological functions to microbes!<br />
<br />
*synthbio can be boiled down to the creation of biological parts and systems.<br />
<br />
*design and build novel biological functions and systems<br />
<br />
*design of novel and new biological parts or devices<br />
<br />
*using advanced genetic components and technologies to create new parts or functions in a creature<br />
<br />
*design and construction of new biological parts, devices, and systems<br />
<br />
*design and creation of new biological parts<br />
<br />
*It is the emerging discipline which seeks to standardize biology and unlock the potential of new technologies which allow the de novo synthesis of biological components.<br />
<br />
*Engineering approach to biology<br />
<br />
*genetically modify a bacteria, virus or other organisms to create a something new with a specialized function, which can help our life in some way.<br />
<br />
*a method that allows for better engineering of biology/life<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes, According to http://syntheticbiology.org/ and I agree with this definition.<br />
<br />
*Adding new genes or circuits to cells to achieve new behaviors and properties from those organisms.<br />
<br />
*A nes research field where it is combine the biological and engineering knowledge<br />
<br />
*Engineering biology<br />
<br />
*The design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes<br />
<br />
*The essay to create a functional biological system, starting with the smallest parts<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*How to apply engineering in cells<br />
<br />
*Studying Protein design and trying to optimize it by genetical means. Also designing new functions for organisms is called synthetic biology<br />
<br />
*Synthetic biology is genetic engineering on a larger scale, involving editing of genes, building entire systems, synthesis of dna, and application of engineering methods to genetic modification.<br />
<br />
*designing biological systems that are not already in nature.<br />
<br />
*standarized parts, new functions, quatative analysis, model<br />
<br />
*transfer of gens from cell 1 into cell 2, the trying to creat new products any kind (enzyms, cells, pathways)<br />
<br />
*build new biological systems<br />
<br />
*Engineering genes of biological systems to add to their way of everyday living.<br />
<br />
*engineering / programming life<br />
<br />
*The synthetic biology aims to build new biological parts for the creation of new genes and in the future whole genoms.<br />
<br />
*This will provide new opportunities in medicin, biochemics and engineering.<br />
<br />
*Creating artificial biological systems<br />
<br />
*Hm, I would say sort of designing new molecules, new biochemical pathways or even organisms ('minimal cells') etc. which don´t exist in nature.<br />
<br />
*the redesign of natural biological parts to perform a new useful task<br />
<br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/All_DefinitionsTeam:Valencia/All Definitions2009-10-22T03:47:24Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 12000px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-250px; left:10px; width:700px; color:black; font-size:11pt; font-family: Verdana"><br />
<br />
In our suvey we asked for the definition of Synthetic Biology, and we received lots of answers:<br />
<br />
*Synthetic Biology aims to use a combination of engineering principles and biological knowledge to design and construct standard parts, devices and systems, and re-design existing biological systems, for purposeful and efficient functionality.<br />
<br />
*design new biological part or system by applying engineering strategy<br />
<br />
*Synthetic biology is a new approach to biology, which aims at synthesizing and engineer components and biological systems to new or re-engineering existing biological elements in order to create systems performing useful functions.<br />
<br />
*Engineering biological systems according to an idea of bio-blue prints, making standardization of biology possible.<br />
<br />
*The use of an engineering approach to molecular biology with the object of creating new life forms that will have a practical application<br />
<br />
*Application of engineering principles and methodology on biological systems in order to change them or create new ones to fulfill some purpose<br />
<br />
*Using engineering principles as a standardised way of designing biological devices<br />
<br />
*"yes i can :D hum... say just that it's a concept of 'engineered biology' using the industrial tool in biology : standards, concept and so on."<br />
<br />
*A mixture of Science and Engineering. The building of live machines.<br />
<br />
*The synthetic biology is the engineering of live: the synthesis of complex systems based on the biology, and which perform functions don't existing in the nature.<br />
<br />
*Application of engineering principles (modularity, abstraction) to rationalize the art of genetic modification, increasing the complexity of systems that can be designed and constructed reliably.<br />
<br />
*The application of engineering principles to creating biological machines, based on gene regulatory networks.<br />
<br />
*Using design and engineering principles to create biological devices.<br />
<br />
*building of new systems using engineering and sciences<br />
<br />
*synthetic biology is for me the combination between modern bioscience and engineering. Thereby creating new organisms and or biomolecules which are not existing in live,<br />
<br />
*A ground up approach to genetic engineering in which parts encoding primitive biological functions are combined in model organisms to elicit new and useful biological behavior.<br />
<br />
*Designing and engineering new biological parts and systems using natural biology in a creative way.<br />
<br />
*The design, creation and testing of artificial biological systems using an engineering approach.<br />
<br />
*It is a process which involves engineering/building/designing artificial in order to create a biological systems or functions<br />
<br />
*Application of engineerings and design approaches to the construction of novel biological functionalities.<br />
<br />
*A new discipline that aims to design new organisms or add new functionality to already available organisms using modular components<br />
<br />
*Creating new functionalities or immitating naturally occuring functionalities in biological sytems by building up genetic regulatory networks from standardized compounds.<br />
<br />
*Engineering and constructing of new biological functions in a biological system.<br />
<br />
*New view on synthetic biology, try to engineer biology, life.<br />
<br />
*the design of standard parts that does not exist yet or reconstruct other parts it is engineering<br />
<br />
*engineering of biological components and systems that do not exist in today's society<br />
<br />
*Synthetic Biology is a term used for a wide variety of developing technologies and ideas that bridge the divide be science, engineering and technology. Mainly this is focused around 're-building' already existing organisms in order to make them more effiient etc. as well as creating new organisms.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*A discipline in bio-engineering, with emphasis on building genetic elements that encode biological functions in a modular fashion.<br />
<br />
*taking naturally occurring systems or functions and applying them for a function that they are not naturally doing by taking an engineering approach.<br />
<br />
*Modular approach to biology by constructing/synthesizing genetic networks or life forms via genetic engineering techniques.<br />
<br />
*Taking biological engineering concepts and expanding them to be abstracted and standardized to ease the 'programming' of biology.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Applying engineering principles to biology in an attempt to work towards standarization, abstraction and acceleration.<br />
<br />
*Building new organisms through the combined use of biology and engineering.<br />
<br />
*using engineering, biology and bio-engineering to design new systems with a variety of applications, in a modular and controlled way<br />
<br />
*Synthetic Biology is the practice of combining well defined components to create engineered nanomachines with novel properties that the components alone would not have had.<br />
<br />
*Build novel biological systems which don't exist in nature by joining several standard parts together.<br />
<br />
*It is a field where we engineer biological components into different system which are not present in the nature.<br />
<br />
*An engineering approach to biology, with the goal of designing and implementing new cellular behaviors<br />
<br />
*Synthetic Biology is an art of engineering new biological systems that don’t exist in nature.<br />
<br />
*Enginering organisms to perform a new function<br />
<br />
*Life created from standard components to perform well-defined tasks.<br />
<br />
*The merging of biology and engineering disciplines, generally characterized by forward engineering de novo biological constructs rather than reverse engineering existing biological entities and systems.<br />
<br />
*Synthetic Biology is a growing field concerned with the integration of biology and engineering to design biological machines from standard biological parts.<br />
<br />
*Using engineering and science techniques to create novel biological systems<br />
<br />
*Brings ideas from engineering and biology together to allow for the creation of 'new' synthetic biological entities<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Is science which combines biology and engineering in order to combine new systems that are able of making new products or functions.<br />
<br />
*Use engineering and biology to design and creat a new life<br />
<br />
*Engineering cells to complete a new function<br />
<br />
*A combination of the natural sciences and engineering techniques to achieve novel biological systems.<br />
<br />
*Synthetic Biology combines chemical, biological and engineering sciences to (re)create biological systems with novel (engineered) functions<br />
<br />
*Engineering biology in a standardized way.<br />
<br />
*Synthetic Biology is an emerging field that aims to combine principles from biology and engineering so as to engineer biological systems to perform novel tasks.<br />
<br />
*Synthetic biology attempts to standardize biological practices with the ultimate goal of engineering biological systems.<br />
<br />
*The application of Engineering principles to Biology. Synthetic Biology builds on the foundation laid out by Molecular Biology (including Restriction Enzymes, PCR and Sequencing) by adding synthesis, standardization and abstraction.<br />
<br />
*Creating synthetic organism/systems/parts using standard parts<br />
<br />
*Synthetic Biology is an area that combines science and engineering in order to design and build new biological systems using standard elements.<br />
<br />
*Using principles of bioscience, engineering, mathematics and other related sciences to modify bacteria so that the bacteria will be able to fulfill a bunch of specialized functions.<br />
<br />
*joining the power of life sciences and engineering in order to get novel biological systems/functions<br />
<br />
*Engineering of biological lifeforms at the genetic level with the desired result of new behaviour or metabolism that is not considered to be part of their natural function.<br />
<br />
*An area of science where biological sciences and engineering are combined to build or create biological structures from scratch.<br />
<br />
*The amalgamation of the fields of mathematics, engineering, life sciences, biology, chemistry and everything in between to come up with novel ways of creating microbes to do things for us.<br />
<br />
*Abstracting biology concepts with an engineering framework to introduce standards into the field. Like lego.<br />
<br />
*Using standardized biological parts for new devices and systems or to re-design natural systems from standardized parts<br />
<br />
*Synthethic biology is a rapidly evolving research area that combines science and engineering in order to design, synthesize, and analyze novel biological functions and systems.<br />
<br />
*Synthetic biology is the powerful interface between biology, engineering, and computer science. It has great potential for the development, creation, and thorough understanding of novel biological systems.<br />
<br />
*Synthetic Biology defines a combination of Life Sciene and Engineering. It's goal is to create new biological systems and to improve the understanding of complex pathways by experimental and computational work.<br />
<br />
*Synthetic biology is a new discipline of life sciences focused on bringing engineering into biology. It uses engineering concepts like modeling and standardization to create biological devices with new capabilities that do not exist in nature.<br />
<br />
*The development of new life from the bottom up.<br />
<br />
*The systematization and re-arrangement of life as we know it today to have new functions, making it engineerable.<br />
<br />
*A new interdisciplinary field, that involves the design, construction and standardization of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Synthetic biology applies fundamental engineering concepts like standardization and abstraction to biology in order to allow reliable design of biological devices and systems.<br />
<br />
*The use of engineering principles to model, design and use modular units of biology to construct new biological devices.<br />
<br />
*It is an extension of the field of gennetic enginereing which applies enginereing principles to standardise and simplify biological systems and make new ones<br />
<br />
*To engineer the bacteria which have some new functions by introducing genes which are normalized as parts<br />
<br />
*The application of engineering principles and processes to genetic manipulation, with a focus on furthering our understanding of biological systems by the mimicry of, and creation of orthogonal alternatives to, those systems via abstraction and characterisation of their component devices and parts<br />
<br />
*Systems biology studies complex biological systems as integrated wholes, using tools of modeling, simulation, and comparison to experiment.<br />
<br />
*trying to save the world<br />
<br />
*Letting your brain think up new and exciting posebilities for challeging problems you are confronted with.<br />
<br />
*The syntethic biology is a technique used by engeneers to modulate living systems. The goal is to use existing technics and to jungle with them to create new processes<br />
<br />
*Design, construction and assembly of biological parts.<br />
<br />
*an electronically transformed guy<br />
<br />
*A field in which bacterial computers or functional gene based systems are constructed for the benefit of science<br />
<br />
*Synthetic Biology (SB) is at the interface of Engineering and Molecular Biology. The basis of SB is that a cell can be broken down into hierarchies and viewed as a combination of functional elements, just like any machine, allowing construction of complex biological systems from first principles.<br />
<br />
*engineering of artificial biological systems with the use of synthetic components in living organisms<br />
<br />
*Synthetic biology is the manipulation of organic material to make new organic material. For example, it is currently mostly applied in DNA, where plasmids for bacteria are made artificially and applied to bacteria to perform certain functions<br />
<br />
*adding features to an existent bio-system like adding new methods using a Operative System to boot it up<br />
<br />
*Design of different things with biological elements<br />
<br />
*genetic engineering under precise control.<br />
<br />
*Using new technologies and combining tecnology with biology.<br />
<br />
*An interdisciplinar field of science concentrated on developing a biological systems.<br />
<br />
*Yes, in my mind I think it means use bacteria and some other kinds of living things like that to produce the products we want. Often people need to do some genetic engineering to make the bacteria produce the certain products.<br />
<br />
*In just a few words I would define synthetic biology as a field op bioengineering with natural an artificial components.<br />
<br />
*Designing and engineering novel activities de novo using existing chassis or building novel chassis<br />
<br />
*the design and creation of devices in a living cell<br />
<br />
*I guess you could say there are two approaches: 1) the making of (and thereby defining) life from scratch. 2) reverse engineering known lifeforms to make it more easy to engineer.<br />
<br />
*Engineering with DNA<br />
<br />
*Rational genetic engineering.<br />
<br />
*extensive genetic engineering of organisms<br />
<br />
*Engineering the DNA circuits, design and implement specific functions, global and network-oriented approach<br />
<br />
*un ingénierie du vivant.<br />
<br />
*Naturally occuring organisms that have been genetically altered.<br />
<br />
*Creating functions by directed evolution<br />
<br />
*brainstorming<br />
<br />
*Modularising Components of Bacteria and DNA to allow simple organisisms to be used in an engineering context<br />
<br />
*genetic engineering---make the proper organism to produce the product of interest<br />
<br />
*Using highly artificial molecular-biological tools in biological systems for some research-related application.<br />
<br />
*Taking individual molecular processes and compiling them to complete a task different than normally used<br />
<br />
*international genetically engineering machine<br />
<br />
*to use genes or DNA moleculars to construct some functional part.<br />
<br />
*The use of a biological system to replace a classical engineered system<br />
<br />
*Genetic alterations in organisms, typically bacterial, resulting in a change, such as a biological process for industrial or other type of application<br />
<br />
*using synthetic approach to do biology<br />
<br />
*The synthesis and modification of biological systems on a genetic level.<br />
<br />
*Constructing biological parts.<br />
<br />
*Synthetic biology is the principle of applying genetic modification to achieve an alternation of certain organic functions.<br />
<br />
*The application of biological and biochemical techniques for the develop and engineering of classically designed systems and tools from biological parts (i.e. nucleic acids, protiens, lipids and carbohydrates).<br />
<br />
*The systematic study of the effects and uses of inserting useful artificially engineered gene sequences into living cells.<br />
<br />
*The use of biological elements in genetic engineering to create a system which is useful in solving complex and important problems.<br />
<br />
*Treating bacteria as machines and genetically modifying them for novel applications.<br />
<br />
*design of existing, natural biological systems for useful purposes<br />
<br />
*To assemble DNA parts and transform it into the module to express certain function.<br />
<br />
*Modifying genes in organisms to perform a specific function to design biological parts<br />
<br />
*Cannot!<br />
<br />
*Engineering life.<br />
<br />
*The design and construction of synthetic biological systems.<br />
<br />
*It is something for the next generation<br />
<br />
*a new mode of production or imitation by engineered organisms<br />
<br />
*creating a genetic network of genes from various sources in a chassis organism<br />
<br />
*Building machines using non-conventional parts of biological origin<br />
<br />
*the (re-)design and construction of biological parts and systems.<br />
<br />
*the engineering and modification of a natural system (i.e. a cell)<br />
<br />
*Synthize devices with biological activity by way of design from genetic level<br />
<br />
*build up meaningful organism with small materials<br />
<br />
*making new biological parts<br />
<br />
*creat special protein by assembling different genes together<br />
<br />
*The synthesis of biological parts to form improvised parts.<br />
<br />
*synthesizing biological organisms using biological building blocks<br />
<br />
*Re-Engineering biological organisms found in nature to be tools for useful purposes or creating biological parts the future<br />
<br />
*synthetic biology is...a newly developed scientific field that deals with brand new types of and applications of genetically engineered, or modified, organisms.<br />
<br />
*hmmm...not pretty sure as to define it in short words though.<br />
<br />
*Using and combing nature biological components to create something new<br />
<br />
*A mix of math and biology<br />
<br />
*artificially putting constructs of DNA sequences into an organism to achieve desired traits.<br />
<br />
*Using basic genetic parts to reconstruct life with fancy fuctions.<br />
<br />
*!@!*$@!$<br />
<br />
*To use biological components as pieces of machinery<br />
<br />
*giving a bacteria genetic qualities so that it does things you want it to do<br />
<br />
*engineering bacteria in a controlled way<br />
<br />
*Using some skills make a new gene part.<br />
<br />
*synthesizing working biological circuits from smaller biological entities for desired purposes<br />
<br />
*Synthetic biology is an emerging scientific field which focuses on introducing novel functions to simple cells via DNA manipulation and synthesis.<br />
<br />
*Ability to induce some already known and unknown phenotypes in a new system. Eg. fluorescent fishes.<br />
<br />
*Creating life (or something on a smaller scale).<br />
<br />
*To build a biological machinary for a certain purpose.<br />
<br />
*using DNA to construct the new brand or function of creature<br />
<br />
*Synthetic biology is rearranging DNA in living organisms to try and make them perform a function they do not naturally do.<br />
<br />
*Constructing biological components from raw materials.<br />
<br />
*a biological competition<br />
<br />
*1. conventional view: using bioparts to make genetic circuits<br />
<br />
*2. synthetic genomics view: combinatorial genomics<br />
<br />
*Synthetic biology is the process by which human beings create biological organisms that operate in unique ways (i.e. not found in nature) using standard biological processes that exist in nature<br />
<br />
*using standardized method to genetically engineer/modify organisms<br />
<br />
*exploring the possibilities of recombined organic molecules (mostly proteines and nucleic acids) which were constructed using the principles of molecular biology<br />
<br />
*To define it you can compare genes as functional building blocks, that can be moved among organisms. In synthetic biology this is utilised to make biological systems with the functions we request.<br />
<br />
*design and construction of biological systems<br />
<br />
*The science of using DNA parts to build up a complex biological system<br />
<br />
*brain storming<br />
<br />
*to me it is making chemicalsystems behave lifelike, and alsow manipulating whit allredy living organismens<br />
<br />
*Building biological systems from the bottom-up.<br />
<br />
*The application of biological components to produce bio-synthetic components.<br />
<br />
*Engineering organisms or life basically to exist or produce desired chemicals, etc.<br />
<br />
*genetically engineering of E. coli and other organisms to produce desired products<br />
<br />
*Manipulating the genetics code of an organism in order to make it produce a product of interest<br />
<br />
*Synthetic biology is the next step after genetic engineering. It involves industrialiing the processes behind genetic engineering so that we can work at a higher leve.<br />
<br />
*Design of genetic material in organisms to accomplish a task.<br />
<br />
*design and manipulation of biological, namely genetic, parts<br />
<br />
*To build up a building with the blocks of genes<br />
<br />
*contructing new biobrick parts, making biology easier for engineers<br />
<br />
*This picture represents a person trying to brainstorm using a mechanical device which apparently gave him some cool idea. The person as such doesnt look so bright<br />
<br />
*Yes<br />
<br />
*Branch of Bio where u cut copy and paste parts of DNA to get new parts with new functions :)<br />
<br />
*Man-made biological processes and parts<br />
<br />
*Synthetic Biology is genetic engineering using genes as separate parts that can be combined to do cool things. Whoa.<br />
<br />
*Manipulating the genes of organisms to make them perform some function not natural to them.<br />
<br />
*Manipulating the genetic material of a microbe in order to make it perform actions it normally would not.<br />
<br />
*Synthetic biology is the use of math, compuer science, and life sciences to design and construct 'biological machines' for the use of prbolem solving and advancement.<br />
<br />
*[Re]design of biological systems for the purposes of conducting basic science as well as developing applications.<br />
<br />
*The designing of biological parts<br />
<br />
*design and construction of new biological parts<br />
<br />
*Yes.<br />
<br />
*development of biological tools to assist reseach ect.<br />
<br />
*regard genes as bricks, build in a machine with specific function<br />
<br />
*This is a poor boy with thinking cap.<br />
<br />
*Human-manipulated usage of organisms and cellular buildingblocks (cells, proteins, molecules, horomones, enzymes, etc.)<br />
<br />
*Combining man-made parts and mechanisms with natural components (like Bacteria) for a processes.<br />
<br />
*Synthetic Biology is like biology in computer form.<br />
<br />
*To manipulate the DNA sequence in order to create new combination or new function or whatever<br />
<br />
*New area of biology<br />
<br />
*artificially modifying natural biological processes/organisms to perform a task or improve functionality<br />
<br />
*It is mad!<br />
<br />
*study to make possible life.<br />
<br />
*Using biological components to synthesize systems<br />
<br />
*bacteria machine bottom up approach creative<br />
<br />
*synthetic biology is the combination of biology with electrical engineering to create biological circuits<br />
<br />
*Yes<br />
<br />
*Building biological systems from various parts (genes)<br />
<br />
*Putting genes into organisms to make them do cool things<br />
<br />
*Engineering living things to do something useful.<br />
<br />
*Using various biological parts to build unique living things which has self regualtion system.<br />
<br />
*fixing parts together to make a genetic network<br />
<br />
*Artificial recombintaion of biological parts<br />
<br />
*Remodeling biological processes on an artificial, chemical level<br />
<br />
*ertgr5<br />
<br />
*Biosynthesis is enzyme-catalyzed process wherein more complex chemical compounds are produced from simpler substrates<br />
<br />
*[wikipedia]<br />
<br />
*creating out of different genetical parts new organisms<br />
<br />
*It is the design and fabrication of biological parts/systems.<br />
<br />
*Synthetic Biology is Systems biology in reverse - obtaining in vivo results by in silico prediction<br />
<br />
*Synthetic biology is a field which tries to look at the complex biological network by exploring every layer of the biological complexity. Therefore synthetic biology provides an explanation to the complications of the natural biological systems by artificially re-building them and studying them.<br />
<br />
*Synthetic biology is how to make automated programming of living organisms.<br />
<br />
*Wants to be the area of engineering organisms, but currently is a crude form of re-engineering organisms. Largely a slow progression of the metabolic engineering from the mid 1980's---slightly more dynamic in its control strategies, though.<br />
<br />
*man-made genetic 'circuits'<br />
<br />
*TV Show<br />
<br />
*Synthetic Biology can be defined as the field of biology that can be clustered with artificial world in various applications.<br />
<br />
*It's just like a jigsaw puzzle, putting different gene sequence together to reach a certain goal.<br />
<br />
*Within an organism, re-designing the layout of genes, and further produce biological 'program' to control the behavior of organisms<br />
<br />
*its the science of trying to understand biology by breaking it down into its simplest parts and then building up from these parts<br />
<br />
*It is about understanding better the microbiological world, by developing tools in parallel in wet and dry labs. It's an assembly of tools to reconstruct synthetically or construct from the scratch new pathways, genomes...understanding better allows to control better.<br />
<br />
*A field of knowledge that aims to understand the functions of the living by synthetizing it into others organism.<br />
<br />
*It is about understanding the basic of life forms and assembling them together.<br />
<br />
*making artificial biological systems in order to understand living systems<br />
<br />
*1) understanding biological systems in terms of their components and 2) designing novel parts, processes or subsystems based on those found in natural systems<br />
<br />
*SB seeks both a better understanding of natural biological systems (including their evolutionary origin), and the design and construction of artificial devices that solve technological needs throughout the simplification of biological systems.<br />
<br />
*Its a tools by which we can transfer a phenotype from one living system to another new system. The phenotype may be not necessary for survival of the new system. But this would help us better understand the phenotype.<br />
<br />
*an attempt to better understand and work with biological systems through the creation, standardization, planned combination, and characterization of segments of these systems.<br />
<br />
*An area of biology that aims to understand 'what is life' and apply biotechnologies by creating and analyzing genetically modified organisms.<br />
<br />
*Applying thought processes from various areas of science to gain a better understanding of biological systems<br />
<br />
*The engineering of nature in order to produce commercial goods or services or in order to further current knowledge of biological systems.<br />
<br />
*Synthetic biology is understanding and modifying existing biological structures and pathways to come up with engineered cells with unique and useful properties.<br />
<br />
*The attempt to artificially create life based on knowledge gained from existing life.<br />
<br />
*Engineering + Cell Biology - World Domination<br />
<br />
*Engineering approach to biology<br />
<br />
*Synthetic biology can be understood as the design and construction of new biological systems not found in nature<br />
<br />
*Applying engineering principles in biological systems to manipulate them into useful tools.<br />
<br />
*engineering biological systems according to rules of engineering such as insulation, abstraction or modularity.<br />
<br />
*Synthetic biology is an engineering approach to biotechnology<br />
<br />
*It could be defined as the engineering of Biology. It aims at providing reusable and modular biological systems to promote and stimulate innovation in Biotechnology.<br />
<br />
*engineering biology<br />
<br />
*Making new 'live devices' from genetic elements found in different organisms.<br />
<br />
*Engineering approach to molecular biology<br />
<br />
*designing new or re-designing existing, natural biological systems, devices etc. for useful purposes<br />
<br />
*It consits out of genetic engineering (PCR, recombinant DNA, etc.) sequencing, automation, abstraction, standardization, computer modeling.<br />
<br />
*it is the engineering of biology<br />
<br />
*inspired by Nature created by Human to develop new biological features and to unveil non yet understood biological/molecular pathway behaviour.<br />
<br />
*science standardization engineering life<br />
<br />
*molecular biology with the idea of standardization : the idea is to synthetize DNA from small standard parts<br />
<br />
*Synthetic biology is about doing functional standart with living organism in the aim to make them 'doing thing' you planed.<br />
<br />
*Working on a DNA level to engineer something new by combining allready excisting and new components of DNA.<br />
<br />
*Synthetic biology is a way to standardize biology by using standardized genes and genetical systems. It is trying to make biology standard enough to use it to engineer your own synthetic system with it.<br />
<br />
*enginering of bacteria<br />
<br />
*Engineering systems using genetic techniques.<br />
<br />
*sythetic biology is the engineering of cells. To make them do what you want to use them as machines. Using parts from many diffrent organisms or creating your own from scratch<br />
<br />
*It's considering life sciences from the point of view of an engineer, doing great GMOs using MB and CB tools. It's also thinking about what all this means as regards the special position of humans among terrestrian creatures.<br />
<br />
*Synthetic biology is the field gathering the methods enabling the engineering of biological systems.<br />
<br />
*Applying engineering principles in using independent and well characterised biological modules<br />
<br />
*engineering biological systems<br />
<br />
*It is the use of already existing DNA parts to create new functionalities in organisms.<br />
<br />
*It is an area of the sciences whose main aim is to create synthetic features which produce a desired phenotype when inside a specific organism.<br />
<br />
*Using technology to assemble new biological systems.<br />
<br />
*To engineer organisms or pathways to perform a specific task.<br />
<br />
*Thinking like a engineer and doing like a molecular biology.<br />
<br />
*new field inthat puts engineering into molecular biology<br />
<br />
*It's a new area of research, aiming at synthesizing complex systems, inspired by living being, with new functions which do not exist in nature, from simple bricks of DNA.<br />
<br />
*The possibility to engineer genetic systems out of simple genetic parts : It's a kind of 'genetic programation'<br />
<br />
*The altering of natural life to better serve human needs through an engineering approach, or the creation of synthetic life.<br />
<br />
*The construction of new biological systems using building blocks from other, well characterised, biological systems.<br />
<br />
*Designing/building novel biological 'machines' using biological parts.<br />
<br />
*The genetic manipulation of current organisms to introduce new systems/protein pathways and/or alter the existing systems/protein pathways of the organism.<br />
<br />
*science which deals with the design of new biological organisms according to native model organisms for optimization purposes...<br />
<br />
*Engineering biological systems in a systematic and minimalistic level to perform defined tasks<br />
<br />
*It's about designing and engineering in silico organisms to rock our future life, yeah.<br />
<br />
*'breaking' biological systems into small parts and store them, that everybody can have access to them and assemble them in a way that's useful to them. Thereby new biological systems can be build.<br />
<br />
*combination of biology and engineering methods<br />
<br />
*system biology with engineering<br />
<br />
*Synthetic Biology tries to use standardized devices and methods to influence the behaviour of cells. Important is the transferability of parts and devices in synthetic biology.<br />
<br />
*Create a new kind of organism by known biological elements, whose behaviours could be estimated by computational/theoretical model<br />
<br />
*Synthetic biology applies engineering principles to biology, thus it uses 'parts' to build 'machines'.<br />
<br />
*synthetic biology is a discipline where biological element/basic parts are dissected firstly, and then we assemble them to achive new functions that do not exsist or that have not been discovered, or we can exploit them to optimize the original biological system.<br />
<br />
*Synthetic biology is the use of biological techniques to create new biological systems that help solve problems.<br />
<br />
*design and constructions of new biological parts for usefull purposes<br />
<br />
*design new system to perform novel functions<br />
<br />
*The intersection of biology and engineering.<br />
<br />
*Using what is known about naturally occurring biological systems to construct novel biological parts, networks and systems, often with a desired functionality or purpose.<br />
<br />
*Just like computer programming, syn bio is aim at constructing biological system with standardized modules<br />
<br />
*Building up a new device from the parts available in nature<br />
<br />
*the application of quantitative design framework for modifying, creating, and controlling living organisms and processes, particularly at a genetic and cellular level.<br />
<br />
*Synthetic Biology is where the biology involved is being created by non natural means.<br />
<br />
*the design or redesign of biological parts for manipulation bio systems or creating new devices<br />
<br />
*The design and construction of novel biological systems.<br />
<br />
*A means of standardizing biology by us<br />
<br />
*Creating macro-scale biological machines from micro-scale biomolecular components.<br />
<br />
*Engineering biological systems or organisms for a purpose.<br />
<br />
*Synthetic Biology is a science that uses standard interchangeable parts to build genetic devices.<br />
<br />
*Its is a new area of science that requires biology and engineering to work together<br />
<br />
*Creating standardised biological parts for use and assembly for a variety of applications.<br />
<br />
*Genetic engineering resulting in a useful novel living system.<br />
<br />
*Re-creating organisms for developing of science and consummate the human interest<br />
<br />
*Messing around with biological systems using engineering and design principles along with molecular biology techniques to make them do something sweet.<br />
<br />
*Putting Biobricks together.<br />
<br />
*an area of biological research that combines science and engineering<br />
<br />
*In the synthetic biology we create new micro-organisms or just beneficial tools out of already existing organisms...<br />
<br />
*The design and construction of new biological parts, devices and systems that do not exist in the natural world and also the redesign of existing biological systems to perform specific tasks<br />
<br />
*Artificial life or devices created from biologicak materials<br />
<br />
*Build life from simple molecule.<br />
<br />
*The modification/improvement of existing biological systems or the creation of new ones in order to realize a genetically modified organism that show new and interesting skills.<br />
<br />
*the design and fabrication of biological components and systems that do not already exist in the natural world or re-design and fabrication of existing biological systems.<br />
<br />
*build biological systems made from standard biological parts<br />
<br />
*...<br />
<br />
*It is the construction of new biological parts, devices, and systems.<br />
<br />
*It is the biological material engineering, in order to add or modify a particular function of living organisms.<br />
<br />
*engineered biological systems<br />
<br />
*Application of engineering principles in life sciences.<br />
<br />
*Approaching to biology in a more rigorous, quantitative way, in order to create regulable biological systems.<br />
<br />
*Using DNA manipulation to modify existing biological systems or to create new biological systems for a purpose<br />
<br />
*The building of biological circuits and organisms based on well-defined, well-characterized, and standardized parts.<br />
<br />
*The science that tries to engineer biological systems in a controlled way<br />
<br />
*building new biological machines out of existing biological parts<br />
<br />
*Design of standard parts (biobricks in the iGEM competition)<br />
<br />
*To use natural things to create artificial ones.<br />
<br />
*Creating novel products using biological parts<br />
<br />
*Using genes as building blocks in creating organisms with characteristics that we desire.<br />
<br />
*The reduction of biological processes into manipulated parts, and the recombination of these parts into more complex devices.<br />
<br />
*Applying a hierarchical model to genetic engineering, where each gene is treated as a single 'part' that can be combined to make composite parts, devices, and machines.<br />
<br />
*designing or redesigning and building biological systems, parts, or devices for some [useful] purpose<br />
<br />
*design or modify a creature by some standard methods related to genetics engineering so that it has some specific function<br />
<br />
*Synthetic biology is the application of the idea of engineer to the field of biology science. And the result would be amazing.<br />
<br />
*synthetic biology is using 'non-living' organisms and using them to create functional systems<br />
<br />
*I think any definition is non-encompassing. A field that combines Science and Engineering to design new systems,<br />
<br />
*it is engineering and biology mixed into a novel and exciting study<br />
<br />
*The design, production and refinement of artificial biological circuits to perform useful functions for humans.<br />
<br />
*It is basically combing science and engineering in order to design and build biological functions and systems.<br />
<br />
*Making new biological awesomeness!<br />
<br />
*use some basic element to create a complicate systems<br />
<br />
*Make artificial biological systems!<br />
<br />
*It's the most simple way to do engineering as well as 'NATURE'<br />
<br />
*Synthetic biology is one field of science that encourages people to use DNA recombination skill which can create new system in any cells and have new usage.<br />
<br />
*Synthetic biology studies how to build artificial biological systems.<br />
<br />
*Through the change of DNA to make a new creature.<br />
<br />
*Using biological parts such as promoter, binding site and coding sequence, compromise the whole something new biological system it never exists naturally<br />
<br />
*synthetic biology is like an engineering science. Being able to build biological machines use synthetic parts.<br />
<br />
*ynthetic Biology is a new technology which applies engineering principles to biology. It is an advancement from genetic engineering, which uses the insertion/deletion of a few specific genes to one where we can engineer highly regulated genetic systems.<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Building of new novel biological parts/devices/systems for engineering applications<br />
<br />
*synthetic biology is the engineering of biοlogical systems in order for the latter to have desired properties.<br />
<br />
*the construction of novel biological systems to replace classically designed machines<br />
<br />
*Making machine based on biologic system<br />
<br />
*Technics of engineering applied on biological systems<br />
<br />
*constructing new abilities by cutting and pasting with DNA, thus enabling cells to make/do something they don't naturally do.<br />
<br />
*Synthetic biology is the artificial manipulation of genetic code to produce novel organisms or organisms with a desired, predictable function based on the manipulated genes.<br />
<br />
*Finding a way to create life in a test tube and not using 'alive' precursors<br />
<br />
*To create lifes that as our wish.<br />
<br />
*It's the making of synthetic organism from the bottom up.<br />
<br />
*Constructing complex biological systems out of standard parts.<br />
<br />
*creating new biological systems out of different parts<br />
<br />
*Create new biological systems from parts of existing ones<br />
<br />
*Synthetic biology, analogous to synthetic chemistry, is a field in which complex molecular-level mechanical systems are synthesized from genetically engineered biological components. SynBio attempts to recreate or modify constructs normally found in nature in the lab.<br />
<br />
*An approach to study and apply biology through modularization and standardization<br />
<br />
*Creating of biological systems not present in nature<br />
<br />
*Synthetic Biology is the ability to create/implement systems not previously found in that organism. We can uses these systems to do anything from display a picture to create chemicals.<br />
<br />
*It is an applicative branch of biology focused on inventing and using novel organisms (especially genetically modifed) or their products that differ from natural ones and have new useful functions.<br />
<br />
*it's an area of research that enables us to modify and build new biological systems<br />
<br />
*The construction, engineering and reengineering of organic machinery<br />
<br />
*the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*synthetic biology is designing novel biological systems using well defined basic biological components.<br />
<br />
*Synthetic Biology is Engineering biological systems to perform a specific function<br />
<br />
*breaking down and analyzing biological subsystems and recombining them in such a way that they perform new tasks<br />
<br />
*synthetic biology is rewiring the naturally found genes to make new circuits which deliver better,predictable and programmable outputs.<br />
<br />
*engineering of biological parts<br />
<br />
*engineering biology<br />
<br />
*making organisms with new and hopefully useful functions<br />
<br />
*decouple life, Construct life<br />
<br />
*Biology which starts in essention on genes and they are combined to engineer and create new bacteria with specific features you just want.<br />
<br />
*Novel thought process leads to Innovation and creativity.<br />
<br />
*The biological equivalent of digital system design. Hopefully Moore's Law will also be applicable.<br />
<br />
*according to me it is applying engineering principles to biological system so that we can understand it in a better way or achieve some novel output from a cell.<br />
<br />
*use the known bio-parts to construct a new system.<br />
<br />
*A field that combines engineering and biology to build life forms for useful purposes<br />
<br />
*Biological engineering at the DNA level<br />
<br />
*An area of biology that involves designing and building new bilogical systems and functions.<br />
<br />
*Applying an engineering mindset to the medium of biology.<br />
<br />
*An engineering approach to biology<br />
<br />
*Engineering biological machines using cells as a media.<br />
<br />
*Synthetic biology is the practice of engineering biological systems to produce a specific product using well characterized 'parts'.<br />
<br />
*It is putting together DNA sequences / Genes from multiple organisms that would not normally interact with each other to create a construct that exhibits a novel function.<br />
<br />
*an interdisciplinary field combining biology and engineering<br />
<br />
*Engineering biological components.<br />
<br />
*Synthetic biology: Involves combination of Engineering with Science, to synthesize biological functions/systems<br />
<br />
*Synthetic+Biology - to artificially inducing a new property in a another living system<br />
<br />
*Make biology easy to engineer.<br />
<br />
*engineering and analyzing synthetic biological networks<br />
<br />
*Using genetic engineering to create artificial (non-naturally occuring) organisms, with specific functions.<br />
<br />
*the study of applied engineering in biology<br />
<br />
*new kind of biology that tryes to modify biological sistems in order to gain new functions<br />
<br />
*Genetically modifying an organism to perform a novel function (novel to that organism).<br />
<br />
*Synthetic biology is to compose and engineer biological organisms and manipulate them to do desired actions.<br />
<br />
*A multi-disciplinary field that is rapidly emerging. The field tried to build biological systems with parts called biobricks.<br />
<br />
*engineering and biology and design<br />
<br />
*The rational design and production of organisms (new or modified) or multi-cellular systems, using genetic manipulation/ modification techniques, that have functions or combinations of properties not normally found in nature.<br />
<br />
*Creating new organisms by modifying dna<br />
<br />
*Synthetic Biology is the design and creation of new biological parts, devices and systems and the redesign of existing biological parts, devices and systems for useful purposes<br />
<br />
*Synthetic Biology is the study of designing a new biological devices or reconstructing an existing parts.<br />
<br />
*Syntetic biology is the designing and creation of biological systems, both to enhance known systems or to create new ones<br />
<br />
*The creation of artificial systems<br />
<br />
*The engineering of biological systems<br />
<br />
*design, construction of new biological parts, devices, systems re-design of existing systems for useful purposes<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes<br />
<br />
*Sure.... Oh define it here I get it. Synthetic Biology is the feild of biology devoted to the creation of novel pathways or proteins in organisms that did not previously use said pathways.<br />
<br />
*Engineering biological devices to do useful things<br />
<br />
*standardization of biology and the tools used to manipulate it<br />
<br />
*Synthetic biology is manufacturing a new kind of creature by any methods, including chemical, physical, biological ways<br />
<br />
*it is the combination of biology and engineering which synthesis some biological products or systems<br />
<br />
*Changing or creating new biological systems or processes<br />
<br />
*To be able to create smaller component parts of the genomic world that can radically alter the abilities of a cell to accomplish specified tasks.<br />
<br />
*Synthetic Biology, an intertwining of principles from Biology and Engineering<br />
<br />
*Constructing new biological parts from existing ones<br />
<br />
*Design. construction and standardization of biological parts.<br />
<br />
*Biological Engineering<br />
<br />
*"the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes."<br />
<br />
*The reduction of an array of molecular biology techniques into a standardized set of common practices designed to streamline modern molecular biology.<br />
<br />
*Synthetic biology is the design and construction of new biological parts, devices, and systems which are either novel to the natural world or are modifications based on existing biological systems. The goal is to program organisms to perform specific functions.<br />
<br />
*applying engineering principles to solving biological problems<br />
<br />
*field involved in the engineering of biological parts, devices and systems by standardizing DNA sequence information for reuse in designs<br />
<br />
*a way to build new biological systems<br />
<br />
*Engineering biology from the ground up.<br />
<br />
*The use biotechnology in a consistent and systematic way to engineer modified organisms with relative ease (as compared to traditional biotechnological methods).<br />
<br />
*It involves designing and modeling biological systems<br />
<br />
*It is a magic field of study where we can design an artificial genetic network to endow novel biological and non-biological functions to microbes!<br />
<br />
*synthbio can be boiled down to the creation of biological parts and systems.<br />
<br />
*design and build novel biological functions and systems<br />
<br />
*design of novel and new biological parts or devices<br />
<br />
*using advanced genetic components and technologies to create new parts or functions in a creature<br />
<br />
*design and construction of new biological parts, devices, and systems<br />
<br />
*design and creation of new biological parts<br />
<br />
*It is the emerging discipline which seeks to standardize biology and unlock the potential of new technologies which allow the de novo synthesis of biological components.<br />
<br />
*Engineering approach to biology<br />
<br />
*genetically modify a bacteria, virus or other organisms to create a something new with a specialized function, which can help our life in some way.<br />
<br />
*a method that allows for better engineering of biology/life<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes, According to http://syntheticbiology.org/ and I agree with this definition.<br />
<br />
*Adding new genes or circuits to cells to achieve new behaviors and properties from those organisms.<br />
<br />
*A nes research field where it is combine the biological and engineering knowledge<br />
<br />
*Engineering biology<br />
<br />
*The design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes<br />
<br />
*The essay to create a functional biological system, starting with the smallest parts<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*How to apply engineering in cells<br />
<br />
*Studying Protein design and trying to optimize it by genetical means. Also designing new functions for organisms is called synthetic biology<br />
<br />
*Synthetic biology is genetic engineering on a larger scale, involving editing of genes, building entire systems, synthesis of dna, and application of engineering methods to genetic modification.<br />
<br />
*designing biological systems that are not already in nature.<br />
<br />
*standarized parts, new functions, quatative analysis, model<br />
<br />
*transfer of gens from cell 1 into cell 2, the trying to creat new products any kind (enzyms, cells, pathways)<br />
<br />
*build new biological systems<br />
<br />
*Engineering genes of biological systems to add to their way of everyday living.<br />
<br />
*engineering / programming life<br />
<br />
*The synthetic biology aims to build new biological parts for the creation of new genes and in the future whole genoms.<br />
<br />
*This will provide new opportunities in medicin, biochemics and engineering.<br />
<br />
*Creating artificial biological systems<br />
<br />
*Hm, I would say sort of designing new molecules, new biochemical pathways or even organisms ('minimal cells') etc. which don´t exist in nature.<br />
<br />
*the redesign of natural biological parts to perform a new useful task<br />
<br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/All_DefinitionsTeam:Valencia/All Definitions2009-10-22T03:46:41Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 8000px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-20px; left:10px; width:700px; color:black; font-size:11pt; font-family: Verdana"><br />
<br />
In our suvey we asked for the definition of Synthetic Biology, and we received lots of answers:<br />
<br />
*Synthetic Biology aims to use a combination of engineering principles and biological knowledge to design and construct standard parts, devices and systems, and re-design existing biological systems, for purposeful and efficient functionality.<br />
<br />
*design new biological part or system by applying engineering strategy<br />
<br />
*Synthetic biology is a new approach to biology, which aims at synthesizing and engineer components and biological systems to new or re-engineering existing biological elements in order to create systems performing useful functions.<br />
<br />
*Engineering biological systems according to an idea of bio-blue prints, making standardization of biology possible.<br />
<br />
*The use of an engineering approach to molecular biology with the object of creating new life forms that will have a practical application<br />
<br />
*Application of engineering principles and methodology on biological systems in order to change them or create new ones to fulfill some purpose<br />
<br />
*Using engineering principles as a standardised way of designing biological devices<br />
<br />
*"yes i can :D hum... say just that it's a concept of 'engineered biology' using the industrial tool in biology : standards, concept and so on."<br />
<br />
*A mixture of Science and Engineering. The building of live machines.<br />
<br />
*The synthetic biology is the engineering of live: the synthesis of complex systems based on the biology, and which perform functions don't existing in the nature.<br />
<br />
*Application of engineering principles (modularity, abstraction) to rationalize the art of genetic modification, increasing the complexity of systems that can be designed and constructed reliably.<br />
<br />
*The application of engineering principles to creating biological machines, based on gene regulatory networks.<br />
<br />
*Using design and engineering principles to create biological devices.<br />
<br />
*building of new systems using engineering and sciences<br />
<br />
*synthetic biology is for me the combination between modern bioscience and engineering. Thereby creating new organisms and or biomolecules which are not existing in live,<br />
<br />
*A ground up approach to genetic engineering in which parts encoding primitive biological functions are combined in model organisms to elicit new and useful biological behavior.<br />
<br />
*Designing and engineering new biological parts and systems using natural biology in a creative way.<br />
<br />
*The design, creation and testing of artificial biological systems using an engineering approach.<br />
<br />
*It is a process which involves engineering/building/designing artificial in order to create a biological systems or functions<br />
<br />
*Application of engineerings and design approaches to the construction of novel biological functionalities.<br />
<br />
*A new discipline that aims to design new organisms or add new functionality to already available organisms using modular components<br />
<br />
*Creating new functionalities or immitating naturally occuring functionalities in biological sytems by building up genetic regulatory networks from standardized compounds.<br />
<br />
*Engineering and constructing of new biological functions in a biological system.<br />
<br />
*New view on synthetic biology, try to engineer biology, life.<br />
<br />
*the design of standard parts that does not exist yet or reconstruct other parts it is engineering<br />
<br />
*engineering of biological components and systems that do not exist in today's society<br />
<br />
*Synthetic Biology is a term used for a wide variety of developing technologies and ideas that bridge the divide be science, engineering and technology. Mainly this is focused around 're-building' already existing organisms in order to make them more effiient etc. as well as creating new organisms.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*A discipline in bio-engineering, with emphasis on building genetic elements that encode biological functions in a modular fashion.<br />
<br />
*taking naturally occurring systems or functions and applying them for a function that they are not naturally doing by taking an engineering approach.<br />
<br />
*Modular approach to biology by constructing/synthesizing genetic networks or life forms via genetic engineering techniques.<br />
<br />
*Taking biological engineering concepts and expanding them to be abstracted and standardized to ease the 'programming' of biology.<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Applying engineering principles to biology in an attempt to work towards standarization, abstraction and acceleration.<br />
<br />
*Building new organisms through the combined use of biology and engineering.<br />
<br />
*using engineering, biology and bio-engineering to design new systems with a variety of applications, in a modular and controlled way<br />
<br />
*Synthetic Biology is the practice of combining well defined components to create engineered nanomachines with novel properties that the components alone would not have had.<br />
<br />
*Build novel biological systems which don't exist in nature by joining several standard parts together.<br />
<br />
*It is a field where we engineer biological components into different system which are not present in the nature.<br />
<br />
*An engineering approach to biology, with the goal of designing and implementing new cellular behaviors<br />
<br />
*Synthetic Biology is an art of engineering new biological systems that don’t exist in nature.<br />
<br />
*Enginering organisms to perform a new function<br />
<br />
*Life created from standard components to perform well-defined tasks.<br />
<br />
*The merging of biology and engineering disciplines, generally characterized by forward engineering de novo biological constructs rather than reverse engineering existing biological entities and systems.<br />
<br />
*Synthetic Biology is a growing field concerned with the integration of biology and engineering to design biological machines from standard biological parts.<br />
<br />
*Using engineering and science techniques to create novel biological systems<br />
<br />
*Brings ideas from engineering and biology together to allow for the creation of 'new' synthetic biological entities<br />
<br />
*Synthetic biology is a new area of biological research that combines science and engineering in order to design and build ('synthesize') novel biological functions and systems.<br />
<br />
*Is science which combines biology and engineering in order to combine new systems that are able of making new products or functions.<br />
<br />
*Use engineering and biology to design and creat a new life<br />
<br />
*Engineering cells to complete a new function<br />
<br />
*A combination of the natural sciences and engineering techniques to achieve novel biological systems.<br />
<br />
*Synthetic Biology combines chemical, biological and engineering sciences to (re)create biological systems with novel (engineered) functions<br />
<br />
*Engineering biology in a standardized way.<br />
<br />
*Synthetic Biology is an emerging field that aims to combine principles from biology and engineering so as to engineer biological systems to perform novel tasks.<br />
<br />
*Synthetic biology attempts to standardize biological practices with the ultimate goal of engineering biological systems.<br />
<br />
*The application of Engineering principles to Biology. Synthetic Biology builds on the foundation laid out by Molecular Biology (including Restriction Enzymes, PCR and Sequencing) by adding synthesis, standardization and abstraction.<br />
<br />
*Creating synthetic organism/systems/parts using standard parts<br />
<br />
*Synthetic Biology is an area that combines science and engineering in order to design and build new biological systems using standard elements.<br />
<br />
*Using principles of bioscience, engineering, mathematics and other related sciences to modify bacteria so that the bacteria will be able to fulfill a bunch of specialized functions.<br />
<br />
*joining the power of life sciences and engineering in order to get novel biological systems/functions<br />
<br />
*Engineering of biological lifeforms at the genetic level with the desired result of new behaviour or metabolism that is not considered to be part of their natural function.<br />
<br />
*An area of science where biological sciences and engineering are combined to build or create biological structures from scratch.<br />
<br />
*The amalgamation of the fields of mathematics, engineering, life sciences, biology, chemistry and everything in between to come up with novel ways of creating microbes to do things for us.<br />
<br />
*Abstracting biology concepts with an engineering framework to introduce standards into the field. Like lego.<br />
<br />
*Using standardized biological parts for new devices and systems or to re-design natural systems from standardized parts<br />
<br />
*Synthethic biology is a rapidly evolving research area that combines science and engineering in order to design, synthesize, and analyze novel biological functions and systems.<br />
<br />
*Synthetic biology is the powerful interface between biology, engineering, and computer science. It has great potential for the development, creation, and thorough understanding of novel biological systems.<br />
<br />
*Synthetic Biology defines a combination of Life Sciene and Engineering. It's goal is to create new biological systems and to improve the understanding of complex pathways by experimental and computational work.<br />
<br />
*Synthetic biology is a new discipline of life sciences focused on bringing engineering into biology. It uses engineering concepts like modeling and standardization to create biological devices with new capabilities that do not exist in nature.<br />
<br />
*The development of new life from the bottom up.<br />
<br />
*The systematization and re-arrangement of life as we know it today to have new functions, making it engineerable.<br />
<br />
*A new interdisciplinary field, that involves the design, construction and standardization of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Synthetic biology applies fundamental engineering concepts like standardization and abstraction to biology in order to allow reliable design of biological devices and systems.<br />
<br />
*The use of engineering principles to model, design and use modular units of biology to construct new biological devices.<br />
<br />
*It is an extension of the field of gennetic enginereing which applies enginereing principles to standardise and simplify biological systems and make new ones<br />
<br />
*To engineer the bacteria which have some new functions by introducing genes which are normalized as parts<br />
<br />
*The application of engineering principles and processes to genetic manipulation, with a focus on furthering our understanding of biological systems by the mimicry of, and creation of orthogonal alternatives to, those systems via abstraction and characterisation of their component devices and parts<br />
<br />
*Systems biology studies complex biological systems as integrated wholes, using tools of modeling, simulation, and comparison to experiment.<br />
<br />
*trying to save the world<br />
<br />
*Letting your brain think up new and exciting posebilities for challeging problems you are confronted with.<br />
<br />
*The syntethic biology is a technique used by engeneers to modulate living systems. The goal is to use existing technics and to jungle with them to create new processes<br />
<br />
*Design, construction and assembly of biological parts.<br />
<br />
*an electronically transformed guy<br />
<br />
*A field in which bacterial computers or functional gene based systems are constructed for the benefit of science<br />
<br />
*Synthetic Biology (SB) is at the interface of Engineering and Molecular Biology. The basis of SB is that a cell can be broken down into hierarchies and viewed as a combination of functional elements, just like any machine, allowing construction of complex biological systems from first principles.<br />
<br />
*engineering of artificial biological systems with the use of synthetic components in living organisms<br />
<br />
*Synthetic biology is the manipulation of organic material to make new organic material. For example, it is currently mostly applied in DNA, where plasmids for bacteria are made artificially and applied to bacteria to perform certain functions<br />
<br />
*adding features to an existent bio-system like adding new methods using a Operative System to boot it up<br />
<br />
*Design of different things with biological elements<br />
<br />
*genetic engineering under precise control.<br />
<br />
*Using new technologies and combining tecnology with biology.<br />
<br />
*An interdisciplinar field of science concentrated on developing a biological systems.<br />
<br />
*Yes, in my mind I think it means use bacteria and some other kinds of living things like that to produce the products we want. Often people need to do some genetic engineering to make the bacteria produce the certain products.<br />
<br />
*In just a few words I would define synthetic biology as a field op bioengineering with natural an artificial components.<br />
<br />
*Designing and engineering novel activities de novo using existing chassis or building novel chassis<br />
<br />
*the design and creation of devices in a living cell<br />
<br />
*I guess you could say there are two approaches: 1) the making of (and thereby defining) life from scratch. 2) reverse engineering known lifeforms to make it more easy to engineer.<br />
<br />
*Engineering with DNA<br />
<br />
*Rational genetic engineering.<br />
<br />
*extensive genetic engineering of organisms<br />
<br />
*Engineering the DNA circuits, design and implement specific functions, global and network-oriented approach<br />
<br />
*un ingénierie du vivant.<br />
<br />
*Naturally occuring organisms that have been genetically altered.<br />
<br />
*Creating functions by directed evolution<br />
<br />
*brainstorming<br />
<br />
*Modularising Components of Bacteria and DNA to allow simple organisisms to be used in an engineering context<br />
<br />
*genetic engineering---make the proper organism to produce the product of interest<br />
<br />
*Using highly artificial molecular-biological tools in biological systems for some research-related application.<br />
<br />
*Taking individual molecular processes and compiling them to complete a task different than normally used<br />
<br />
*international genetically engineering machine<br />
<br />
*to use genes or DNA moleculars to construct some functional part.<br />
<br />
*The use of a biological system to replace a classical engineered system<br />
<br />
*Genetic alterations in organisms, typically bacterial, resulting in a change, such as a biological process for industrial or other type of application<br />
<br />
*using synthetic approach to do biology<br />
<br />
*The synthesis and modification of biological systems on a genetic level.<br />
<br />
*Constructing biological parts.<br />
<br />
*Synthetic biology is the principle of applying genetic modification to achieve an alternation of certain organic functions.<br />
<br />
*The application of biological and biochemical techniques for the develop and engineering of classically designed systems and tools from biological parts (i.e. nucleic acids, protiens, lipids and carbohydrates).<br />
<br />
*The systematic study of the effects and uses of inserting useful artificially engineered gene sequences into living cells.<br />
<br />
*The use of biological elements in genetic engineering to create a system which is useful in solving complex and important problems.<br />
<br />
*Treating bacteria as machines and genetically modifying them for novel applications.<br />
<br />
*design of existing, natural biological systems for useful purposes<br />
<br />
*To assemble DNA parts and transform it into the module to express certain function.<br />
<br />
*Modifying genes in organisms to perform a specific function to design biological parts<br />
<br />
*Cannot!<br />
<br />
*Engineering life.<br />
<br />
*The design and construction of synthetic biological systems.<br />
<br />
*It is something for the next generation<br />
<br />
*a new mode of production or imitation by engineered organisms<br />
<br />
*creating a genetic network of genes from various sources in a chassis organism<br />
<br />
*Building machines using non-conventional parts of biological origin<br />
<br />
*the (re-)design and construction of biological parts and systems.<br />
<br />
*the engineering and modification of a natural system (i.e. a cell)<br />
<br />
*Synthize devices with biological activity by way of design from genetic level<br />
<br />
*build up meaningful organism with small materials<br />
<br />
*making new biological parts<br />
<br />
*creat special protein by assembling different genes together<br />
<br />
*The synthesis of biological parts to form improvised parts.<br />
<br />
*synthesizing biological organisms using biological building blocks<br />
<br />
*Re-Engineering biological organisms found in nature to be tools for useful purposes or creating biological parts the future<br />
<br />
*synthetic biology is...a newly developed scientific field that deals with brand new types of and applications of genetically engineered, or modified, organisms.<br />
<br />
*hmmm...not pretty sure as to define it in short words though.<br />
<br />
*Using and combing nature biological components to create something new<br />
<br />
*A mix of math and biology<br />
<br />
*artificially putting constructs of DNA sequences into an organism to achieve desired traits.<br />
<br />
*Using basic genetic parts to reconstruct life with fancy fuctions.<br />
<br />
*!@!*$@!$<br />
<br />
*To use biological components as pieces of machinery<br />
<br />
*giving a bacteria genetic qualities so that it does things you want it to do<br />
<br />
*engineering bacteria in a controlled way<br />
<br />
*Using some skills make a new gene part.<br />
<br />
*synthesizing working biological circuits from smaller biological entities for desired purposes<br />
<br />
*Synthetic biology is an emerging scientific field which focuses on introducing novel functions to simple cells via DNA manipulation and synthesis.<br />
<br />
*Ability to induce some already known and unknown phenotypes in a new system. Eg. fluorescent fishes.<br />
<br />
*Creating life (or something on a smaller scale).<br />
<br />
*To build a biological machinary for a certain purpose.<br />
<br />
*using DNA to construct the new brand or function of creature<br />
<br />
*Synthetic biology is rearranging DNA in living organisms to try and make them perform a function they do not naturally do.<br />
<br />
*Constructing biological components from raw materials.<br />
<br />
*a biological competition<br />
<br />
*1. conventional view: using bioparts to make genetic circuits<br />
<br />
*2. synthetic genomics view: combinatorial genomics<br />
<br />
*Synthetic biology is the process by which human beings create biological organisms that operate in unique ways (i.e. not found in nature) using standard biological processes that exist in nature<br />
<br />
*using standardized method to genetically engineer/modify organisms<br />
<br />
*exploring the possibilities of recombined organic molecules (mostly proteines and nucleic acids) which were constructed using the principles of molecular biology<br />
<br />
*To define it you can compare genes as functional building blocks, that can be moved among organisms. In synthetic biology this is utilised to make biological systems with the functions we request.<br />
<br />
*design and construction of biological systems<br />
<br />
*The science of using DNA parts to build up a complex biological system<br />
<br />
*brain storming<br />
<br />
*to me it is making chemicalsystems behave lifelike, and alsow manipulating whit allredy living organismens<br />
<br />
*Building biological systems from the bottom-up.<br />
<br />
*The application of biological components to produce bio-synthetic components.<br />
<br />
*Engineering organisms or life basically to exist or produce desired chemicals, etc.<br />
<br />
*genetically engineering of E. coli and other organisms to produce desired products<br />
<br />
*Manipulating the genetics code of an organism in order to make it produce a product of interest<br />
<br />
*Synthetic biology is the next step after genetic engineering. It involves industrialiing the processes behind genetic engineering so that we can work at a higher leve.<br />
<br />
*Design of genetic material in organisms to accomplish a task.<br />
<br />
*design and manipulation of biological, namely genetic, parts<br />
<br />
*To build up a building with the blocks of genes<br />
<br />
*contructing new biobrick parts, making biology easier for engineers<br />
<br />
*This picture represents a person trying to brainstorm using a mechanical device which apparently gave him some cool idea. The person as such doesnt look so bright<br />
<br />
*Yes<br />
<br />
*Branch of Bio where u cut copy and paste parts of DNA to get new parts with new functions :)<br />
<br />
*Man-made biological processes and parts<br />
<br />
*Synthetic Biology is genetic engineering using genes as separate parts that can be combined to do cool things. Whoa.<br />
<br />
*Manipulating the genes of organisms to make them perform some function not natural to them.<br />
<br />
*Manipulating the genetic material of a microbe in order to make it perform actions it normally would not.<br />
<br />
*Synthetic biology is the use of math, compuer science, and life sciences to design and construct 'biological machines' for the use of prbolem solving and advancement.<br />
<br />
*[Re]design of biological systems for the purposes of conducting basic science as well as developing applications.<br />
<br />
*The designing of biological parts<br />
<br />
*design and construction of new biological parts<br />
<br />
*Yes.<br />
<br />
*development of biological tools to assist reseach ect.<br />
<br />
*regard genes as bricks, build in a machine with specific function<br />
<br />
*This is a poor boy with thinking cap.<br />
<br />
*Human-manipulated usage of organisms and cellular buildingblocks (cells, proteins, molecules, horomones, enzymes, etc.)<br />
<br />
*Combining man-made parts and mechanisms with natural components (like Bacteria) for a processes.<br />
<br />
*Synthetic Biology is like biology in computer form.<br />
<br />
*To manipulate the DNA sequence in order to create new combination or new function or whatever<br />
<br />
*New area of biology<br />
<br />
*artificially modifying natural biological processes/organisms to perform a task or improve functionality<br />
<br />
*It is mad!<br />
<br />
*study to make possible life.<br />
<br />
*Using biological components to synthesize systems<br />
<br />
*bacteria machine bottom up approach creative<br />
<br />
*synthetic biology is the combination of biology with electrical engineering to create biological circuits<br />
<br />
*Yes<br />
<br />
*Building biological systems from various parts (genes)<br />
<br />
*Putting genes into organisms to make them do cool things<br />
<br />
*Engineering living things to do something useful.<br />
<br />
*Using various biological parts to build unique living things which has self regualtion system.<br />
<br />
*fixing parts together to make a genetic network<br />
<br />
*Artificial recombintaion of biological parts<br />
<br />
*Remodeling biological processes on an artificial, chemical level<br />
<br />
*ertgr5<br />
<br />
*Biosynthesis is enzyme-catalyzed process wherein more complex chemical compounds are produced from simpler substrates<br />
<br />
*[wikipedia]<br />
<br />
*creating out of different genetical parts new organisms<br />
<br />
*It is the design and fabrication of biological parts/systems.<br />
<br />
*Synthetic Biology is Systems biology in reverse - obtaining in vivo results by in silico prediction<br />
<br />
*Synthetic biology is a field which tries to look at the complex biological network by exploring every layer of the biological complexity. Therefore synthetic biology provides an explanation to the complications of the natural biological systems by artificially re-building them and studying them.<br />
<br />
*Synthetic biology is how to make automated programming of living organisms.<br />
<br />
*Wants to be the area of engineering organisms, but currently is a crude form of re-engineering organisms. Largely a slow progression of the metabolic engineering from the mid 1980's---slightly more dynamic in its control strategies, though.<br />
<br />
*man-made genetic 'circuits'<br />
<br />
*TV Show<br />
<br />
*Synthetic Biology can be defined as the field of biology that can be clustered with artificial world in various applications.<br />
<br />
*It's just like a jigsaw puzzle, putting different gene sequence together to reach a certain goal.<br />
<br />
*Within an organism, re-designing the layout of genes, and further produce biological 'program' to control the behavior of organisms<br />
<br />
*its the science of trying to understand biology by breaking it down into its simplest parts and then building up from these parts<br />
<br />
*It is about understanding better the microbiological world, by developing tools in parallel in wet and dry labs. It's an assembly of tools to reconstruct synthetically or construct from the scratch new pathways, genomes...understanding better allows to control better.<br />
<br />
*A field of knowledge that aims to understand the functions of the living by synthetizing it into others organism.<br />
<br />
*It is about understanding the basic of life forms and assembling them together.<br />
<br />
*making artificial biological systems in order to understand living systems<br />
<br />
*1) understanding biological systems in terms of their components and 2) designing novel parts, processes or subsystems based on those found in natural systems<br />
<br />
*SB seeks both a better understanding of natural biological systems (including their evolutionary origin), and the design and construction of artificial devices that solve technological needs throughout the simplification of biological systems.<br />
<br />
*Its a tools by which we can transfer a phenotype from one living system to another new system. The phenotype may be not necessary for survival of the new system. But this would help us better understand the phenotype.<br />
<br />
*an attempt to better understand and work with biological systems through the creation, standardization, planned combination, and characterization of segments of these systems.<br />
<br />
*An area of biology that aims to understand 'what is life' and apply biotechnologies by creating and analyzing genetically modified organisms.<br />
<br />
*Applying thought processes from various areas of science to gain a better understanding of biological systems<br />
<br />
*The engineering of nature in order to produce commercial goods or services or in order to further current knowledge of biological systems.<br />
<br />
*Synthetic biology is understanding and modifying existing biological structures and pathways to come up with engineered cells with unique and useful properties.<br />
<br />
*The attempt to artificially create life based on knowledge gained from existing life.<br />
<br />
*Engineering + Cell Biology - World Domination<br />
<br />
*Engineering approach to biology<br />
<br />
*Synthetic biology can be understood as the design and construction of new biological systems not found in nature<br />
<br />
*Applying engineering principles in biological systems to manipulate them into useful tools.<br />
<br />
*engineering biological systems according to rules of engineering such as insulation, abstraction or modularity.<br />
<br />
*Synthetic biology is an engineering approach to biotechnology<br />
<br />
*It could be defined as the engineering of Biology. It aims at providing reusable and modular biological systems to promote and stimulate innovation in Biotechnology.<br />
<br />
*engineering biology<br />
<br />
*Making new 'live devices' from genetic elements found in different organisms.<br />
<br />
*Engineering approach to molecular biology<br />
<br />
*designing new or re-designing existing, natural biological systems, devices etc. for useful purposes<br />
<br />
*It consits out of genetic engineering (PCR, recombinant DNA, etc.) sequencing, automation, abstraction, standardization, computer modeling.<br />
<br />
*it is the engineering of biology<br />
<br />
*inspired by Nature created by Human to develop new biological features and to unveil non yet understood biological/molecular pathway behaviour.<br />
<br />
*science standardization engineering life<br />
<br />
*molecular biology with the idea of standardization : the idea is to synthetize DNA from small standard parts<br />
<br />
*Synthetic biology is about doing functional standart with living organism in the aim to make them 'doing thing' you planed.<br />
<br />
*Working on a DNA level to engineer something new by combining allready excisting and new components of DNA.<br />
<br />
*Synthetic biology is a way to standardize biology by using standardized genes and genetical systems. It is trying to make biology standard enough to use it to engineer your own synthetic system with it.<br />
<br />
*enginering of bacteria<br />
<br />
*Engineering systems using genetic techniques.<br />
<br />
*sythetic biology is the engineering of cells. To make them do what you want to use them as machines. Using parts from many diffrent organisms or creating your own from scratch<br />
<br />
*It's considering life sciences from the point of view of an engineer, doing great GMOs using MB and CB tools. It's also thinking about what all this means as regards the special position of humans among terrestrian creatures.<br />
<br />
*Synthetic biology is the field gathering the methods enabling the engineering of biological systems.<br />
<br />
*Applying engineering principles in using independent and well characterised biological modules<br />
<br />
*engineering biological systems<br />
<br />
*It is the use of already existing DNA parts to create new functionalities in organisms.<br />
<br />
*It is an area of the sciences whose main aim is to create synthetic features which produce a desired phenotype when inside a specific organism.<br />
<br />
*Using technology to assemble new biological systems.<br />
<br />
*To engineer organisms or pathways to perform a specific task.<br />
<br />
*Thinking like a engineer and doing like a molecular biology.<br />
<br />
*new field inthat puts engineering into molecular biology<br />
<br />
*It's a new area of research, aiming at synthesizing complex systems, inspired by living being, with new functions which do not exist in nature, from simple bricks of DNA.<br />
<br />
*The possibility to engineer genetic systems out of simple genetic parts : It's a kind of 'genetic programation'<br />
<br />
*The altering of natural life to better serve human needs through an engineering approach, or the creation of synthetic life.<br />
<br />
*The construction of new biological systems using building blocks from other, well characterised, biological systems.<br />
<br />
*Designing/building novel biological 'machines' using biological parts.<br />
<br />
*The genetic manipulation of current organisms to introduce new systems/protein pathways and/or alter the existing systems/protein pathways of the organism.<br />
<br />
*science which deals with the design of new biological organisms according to native model organisms for optimization purposes...<br />
<br />
*Engineering biological systems in a systematic and minimalistic level to perform defined tasks<br />
<br />
*It's about designing and engineering in silico organisms to rock our future life, yeah.<br />
<br />
*'breaking' biological systems into small parts and store them, that everybody can have access to them and assemble them in a way that's useful to them. Thereby new biological systems can be build.<br />
<br />
*combination of biology and engineering methods<br />
<br />
*system biology with engineering<br />
<br />
*Synthetic Biology tries to use standardized devices and methods to influence the behaviour of cells. Important is the transferability of parts and devices in synthetic biology.<br />
<br />
*Create a new kind of organism by known biological elements, whose behaviours could be estimated by computational/theoretical model<br />
<br />
*Synthetic biology applies engineering principles to biology, thus it uses 'parts' to build 'machines'.<br />
<br />
*synthetic biology is a discipline where biological element/basic parts are dissected firstly, and then we assemble them to achive new functions that do not exsist or that have not been discovered, or we can exploit them to optimize the original biological system.<br />
<br />
*Synthetic biology is the use of biological techniques to create new biological systems that help solve problems.<br />
<br />
*design and constructions of new biological parts for usefull purposes<br />
<br />
*design new system to perform novel functions<br />
<br />
*The intersection of biology and engineering.<br />
<br />
*Using what is known about naturally occurring biological systems to construct novel biological parts, networks and systems, often with a desired functionality or purpose.<br />
<br />
*Just like computer programming, syn bio is aim at constructing biological system with standardized modules<br />
<br />
*Building up a new device from the parts available in nature<br />
<br />
*the application of quantitative design framework for modifying, creating, and controlling living organisms and processes, particularly at a genetic and cellular level.<br />
<br />
*Synthetic Biology is where the biology involved is being created by non natural means.<br />
<br />
*the design or redesign of biological parts for manipulation bio systems or creating new devices<br />
<br />
*The design and construction of novel biological systems.<br />
<br />
*A means of standardizing biology by us<br />
<br />
*Creating macro-scale biological machines from micro-scale biomolecular components.<br />
<br />
*Engineering biological systems or organisms for a purpose.<br />
<br />
*Synthetic Biology is a science that uses standard interchangeable parts to build genetic devices.<br />
<br />
*Its is a new area of science that requires biology and engineering to work together<br />
<br />
*Creating standardised biological parts for use and assembly for a variety of applications.<br />
<br />
*Genetic engineering resulting in a useful novel living system.<br />
<br />
*Re-creating organisms for developing of science and consummate the human interest<br />
<br />
*Messing around with biological systems using engineering and design principles along with molecular biology techniques to make them do something sweet.<br />
<br />
*Putting Biobricks together.<br />
<br />
*an area of biological research that combines science and engineering<br />
<br />
*In the synthetic biology we create new micro-organisms or just beneficial tools out of already existing organisms...<br />
<br />
*The design and construction of new biological parts, devices and systems that do not exist in the natural world and also the redesign of existing biological systems to perform specific tasks<br />
<br />
*Artificial life or devices created from biologicak materials<br />
<br />
*Build life from simple molecule.<br />
<br />
*The modification/improvement of existing biological systems or the creation of new ones in order to realize a genetically modified organism that show new and interesting skills.<br />
<br />
*the design and fabrication of biological components and systems that do not already exist in the natural world or re-design and fabrication of existing biological systems.<br />
<br />
*build biological systems made from standard biological parts<br />
<br />
*...<br />
<br />
*It is the construction of new biological parts, devices, and systems.<br />
<br />
*It is the biological material engineering, in order to add or modify a particular function of living organisms.<br />
<br />
*engineered biological systems<br />
<br />
*Application of engineering principles in life sciences.<br />
<br />
*Approaching to biology in a more rigorous, quantitative way, in order to create regulable biological systems.<br />
<br />
*Using DNA manipulation to modify existing biological systems or to create new biological systems for a purpose<br />
<br />
*The building of biological circuits and organisms based on well-defined, well-characterized, and standardized parts.<br />
<br />
*The science that tries to engineer biological systems in a controlled way<br />
<br />
*building new biological machines out of existing biological parts<br />
<br />
*Design of standard parts (biobricks in the iGEM competition)<br />
<br />
*To use natural things to create artificial ones.<br />
<br />
*Creating novel products using biological parts<br />
<br />
*Using genes as building blocks in creating organisms with characteristics that we desire.<br />
<br />
*The reduction of biological processes into manipulated parts, and the recombination of these parts into more complex devices.<br />
<br />
*Applying a hierarchical model to genetic engineering, where each gene is treated as a single 'part' that can be combined to make composite parts, devices, and machines.<br />
<br />
*designing or redesigning and building biological systems, parts, or devices for some [useful] purpose<br />
<br />
*design or modify a creature by some standard methods related to genetics engineering so that it has some specific function<br />
<br />
*Synthetic biology is the application of the idea of engineer to the field of biology science. And the result would be amazing.<br />
<br />
*synthetic biology is using 'non-living' organisms and using them to create functional systems<br />
<br />
*I think any definition is non-encompassing. A field that combines Science and Engineering to design new systems,<br />
<br />
*it is engineering and biology mixed into a novel and exciting study<br />
<br />
*The design, production and refinement of artificial biological circuits to perform useful functions for humans.<br />
<br />
*It is basically combing science and engineering in order to design and build biological functions and systems.<br />
<br />
*Making new biological awesomeness!<br />
<br />
*use some basic element to create a complicate systems<br />
<br />
*Make artificial biological systems!<br />
<br />
*It's the most simple way to do engineering as well as 'NATURE'<br />
<br />
*Synthetic biology is one field of science that encourages people to use DNA recombination skill which can create new system in any cells and have new usage.<br />
<br />
*Synthetic biology studies how to build artificial biological systems.<br />
<br />
*Through the change of DNA to make a new creature.<br />
<br />
*Using biological parts such as promoter, binding site and coding sequence, compromise the whole something new biological system it never exists naturally<br />
<br />
*synthetic biology is like an engineering science. Being able to build biological machines use synthetic parts.<br />
<br />
*ynthetic Biology is a new technology which applies engineering principles to biology. It is an advancement from genetic engineering, which uses the insertion/deletion of a few specific genes to one where we can engineer highly regulated genetic systems.<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*Building of new novel biological parts/devices/systems for engineering applications<br />
<br />
*synthetic biology is the engineering of biοlogical systems in order for the latter to have desired properties.<br />
<br />
*the construction of novel biological systems to replace classically designed machines<br />
<br />
*Making machine based on biologic system<br />
<br />
*Technics of engineering applied on biological systems<br />
<br />
*constructing new abilities by cutting and pasting with DNA, thus enabling cells to make/do something they don't naturally do.<br />
<br />
*Synthetic biology is the artificial manipulation of genetic code to produce novel organisms or organisms with a desired, predictable function based on the manipulated genes.<br />
<br />
*Finding a way to create life in a test tube and not using 'alive' precursors<br />
<br />
*To create lifes that as our wish.<br />
<br />
*It's the making of synthetic organism from the bottom up.<br />
<br />
*Constructing complex biological systems out of standard parts.<br />
<br />
*creating new biological systems out of different parts<br />
<br />
*Create new biological systems from parts of existing ones<br />
<br />
*Synthetic biology, analogous to synthetic chemistry, is a field in which complex molecular-level mechanical systems are synthesized from genetically engineered biological components. SynBio attempts to recreate or modify constructs normally found in nature in the lab.<br />
<br />
*An approach to study and apply biology through modularization and standardization<br />
<br />
*Creating of biological systems not present in nature<br />
<br />
*Synthetic Biology is the ability to create/implement systems not previously found in that organism. We can uses these systems to do anything from display a picture to create chemicals.<br />
<br />
*It is an applicative branch of biology focused on inventing and using novel organisms (especially genetically modifed) or their products that differ from natural ones and have new useful functions.<br />
<br />
*it's an area of research that enables us to modify and build new biological systems<br />
<br />
*The construction, engineering and reengineering of organic machinery<br />
<br />
*the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*synthetic biology is designing novel biological systems using well defined basic biological components.<br />
<br />
*Synthetic Biology is Engineering biological systems to perform a specific function<br />
<br />
*breaking down and analyzing biological subsystems and recombining them in such a way that they perform new tasks<br />
<br />
*synthetic biology is rewiring the naturally found genes to make new circuits which deliver better,predictable and programmable outputs.<br />
<br />
*engineering of biological parts<br />
<br />
*engineering biology<br />
<br />
*making organisms with new and hopefully useful functions<br />
<br />
*decouple life, Construct life<br />
<br />
*Biology which starts in essention on genes and they are combined to engineer and create new bacteria with specific features you just want.<br />
<br />
*Novel thought process leads to Innovation and creativity.<br />
<br />
*The biological equivalent of digital system design. Hopefully Moore's Law will also be applicable.<br />
<br />
*according to me it is applying engineering principles to biological system so that we can understand it in a better way or achieve some novel output from a cell.<br />
<br />
*use the known bio-parts to construct a new system.<br />
<br />
*A field that combines engineering and biology to build life forms for useful purposes<br />
<br />
*Biological engineering at the DNA level<br />
<br />
*An area of biology that involves designing and building new bilogical systems and functions.<br />
<br />
*Applying an engineering mindset to the medium of biology.<br />
<br />
*An engineering approach to biology<br />
<br />
*Engineering biological machines using cells as a media.<br />
<br />
*Synthetic biology is the practice of engineering biological systems to produce a specific product using well characterized 'parts'.<br />
<br />
*It is putting together DNA sequences / Genes from multiple organisms that would not normally interact with each other to create a construct that exhibits a novel function.<br />
<br />
*an interdisciplinary field combining biology and engineering<br />
<br />
*Engineering biological components.<br />
<br />
*Synthetic biology: Involves combination of Engineering with Science, to synthesize biological functions/systems<br />
<br />
*Synthetic+Biology - to artificially inducing a new property in a another living system<br />
<br />
*Make biology easy to engineer.<br />
<br />
*engineering and analyzing synthetic biological networks<br />
<br />
*Using genetic engineering to create artificial (non-naturally occuring) organisms, with specific functions.<br />
<br />
*the study of applied engineering in biology<br />
<br />
*new kind of biology that tryes to modify biological sistems in order to gain new functions<br />
<br />
*Genetically modifying an organism to perform a novel function (novel to that organism).<br />
<br />
*Synthetic biology is to compose and engineer biological organisms and manipulate them to do desired actions.<br />
<br />
*A multi-disciplinary field that is rapidly emerging. The field tried to build biological systems with parts called biobricks.<br />
<br />
*engineering and biology and design<br />
<br />
*The rational design and production of organisms (new or modified) or multi-cellular systems, using genetic manipulation/ modification techniques, that have functions or combinations of properties not normally found in nature.<br />
<br />
*Creating new organisms by modifying dna<br />
<br />
*Synthetic Biology is the design and creation of new biological parts, devices and systems and the redesign of existing biological parts, devices and systems for useful purposes<br />
<br />
*Synthetic Biology is the study of designing a new biological devices or reconstructing an existing parts.<br />
<br />
*Syntetic biology is the designing and creation of biological systems, both to enhance known systems or to create new ones<br />
<br />
*The creation of artificial systems<br />
<br />
*The engineering of biological systems<br />
<br />
*design, construction of new biological parts, devices, systems re-design of existing systems for useful purposes<br />
<br />
*A) the design and construction of new biological parts, devices, and systems, and<br />
<br />
*B) the re-design of existing, natural biological systems for useful purposes<br />
<br />
*Sure.... Oh define it here I get it. Synthetic Biology is the feild of biology devoted to the creation of novel pathways or proteins in organisms that did not previously use said pathways.<br />
<br />
*Engineering biological devices to do useful things<br />
<br />
*standardization of biology and the tools used to manipulate it<br />
<br />
*Synthetic biology is manufacturing a new kind of creature by any methods, including chemical, physical, biological ways<br />
<br />
*it is the combination of biology and engineering which synthesis some biological products or systems<br />
<br />
*Changing or creating new biological systems or processes<br />
<br />
*To be able to create smaller component parts of the genomic world that can radically alter the abilities of a cell to accomplish specified tasks.<br />
<br />
*Synthetic Biology, an intertwining of principles from Biology and Engineering<br />
<br />
*Constructing new biological parts from existing ones<br />
<br />
*Design. construction and standardization of biological parts.<br />
<br />
*Biological Engineering<br />
<br />
*"the design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes."<br />
<br />
*The reduction of an array of molecular biology techniques into a standardized set of common practices designed to streamline modern molecular biology.<br />
<br />
*Synthetic biology is the design and construction of new biological parts, devices, and systems which are either novel to the natural world or are modifications based on existing biological systems. The goal is to program organisms to perform specific functions.<br />
<br />
*applying engineering principles to solving biological problems<br />
<br />
*field involved in the engineering of biological parts, devices and systems by standardizing DNA sequence information for reuse in designs<br />
<br />
*a way to build new biological systems<br />
<br />
*Engineering biology from the ground up.<br />
<br />
*The use biotechnology in a consistent and systematic way to engineer modified organisms with relative ease (as compared to traditional biotechnological methods).<br />
<br />
*It involves designing and modeling biological systems<br />
<br />
*It is a magic field of study where we can design an artificial genetic network to endow novel biological and non-biological functions to microbes!<br />
<br />
*synthbio can be boiled down to the creation of biological parts and systems.<br />
<br />
*design and build novel biological functions and systems<br />
<br />
*design of novel and new biological parts or devices<br />
<br />
*using advanced genetic components and technologies to create new parts or functions in a creature<br />
<br />
*design and construction of new biological parts, devices, and systems<br />
<br />
*design and creation of new biological parts<br />
<br />
*It is the emerging discipline which seeks to standardize biology and unlock the potential of new technologies which allow the de novo synthesis of biological components.<br />
<br />
*Engineering approach to biology<br />
<br />
*genetically modify a bacteria, virus or other organisms to create a something new with a specialized function, which can help our life in some way.<br />
<br />
*a method that allows for better engineering of biology/life<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes, According to http://syntheticbiology.org/ and I agree with this definition.<br />
<br />
*Adding new genes or circuits to cells to achieve new behaviors and properties from those organisms.<br />
<br />
*A nes research field where it is combine the biological and engineering knowledge<br />
<br />
*Engineering biology<br />
<br />
*The design and construction of new biological parts, devices, and systems, and the re-design of existing, natural biological systems for useful purposes<br />
<br />
*The essay to create a functional biological system, starting with the smallest parts<br />
<br />
*Synthetic Biology is A) the design and construction of new biological parts, devices, and systems, and B) the re-design of existing, natural biological systems for useful purposes.<br />
<br />
*How to apply engineering in cells<br />
<br />
*Studying Protein design and trying to optimize it by genetical means. Also designing new functions for organisms is called synthetic biology<br />
<br />
*Synthetic biology is genetic engineering on a larger scale, involving editing of genes, building entire systems, synthesis of dna, and application of engineering methods to genetic modification.<br />
<br />
*designing biological systems that are not already in nature.<br />
<br />
*standarized parts, new functions, quatative analysis, model<br />
<br />
*transfer of gens from cell 1 into cell 2, the trying to creat new products any kind (enzyms, cells, pathways)<br />
<br />
*build new biological systems<br />
<br />
*Engineering genes of biological systems to add to their way of everyday living.<br />
<br />
*engineering / programming life<br />
<br />
*The synthetic biology aims to build new biological parts for the creation of new genes and in the future whole genoms.<br />
<br />
*This will provide new opportunities in medicin, biochemics and engineering.<br />
<br />
*Creating artificial biological systems<br />
<br />
*Hm, I would say sort of designing new molecules, new biochemical pathways or even organisms ('minimal cells') etc. which don´t exist in nature.<br />
<br />
*the redesign of natural biological parts to perform a new useful task<br />
<br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/ProjectTeam:Valencia/Project2009-10-22T03:22:35Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1700px;<br />
}<br />
</style><br />
</html><br />
<br />
<div style="position:relative; margin-left: 185px; top:-245px; height:2700px; width:700px; color:black; font-size:10pt; font-family:Verdana" align="justify"><br />
<br />
== '''Project description''' ==<br />
<br />
<br><br />
The <b>iGEM Valencia Lighting Cell Display</b> (<b>iLCD</b>) is our project for the present iGEM competition. We are developing '''BioElectronics''', a combination of Electronics and Biology. We hereby prove that cell behaviour is controlled by electrical pulses. In order to demonstrate this, we are making <b>a “bio-screen” of voltage-activated cells</b>, where every “cellular pixel” produces light. '''It is just like a bacterial photographic system, but it's digital'''. Within seconds, instead of hours, you can get an image formed of living cells.<br />
<br />
It is known that for instance <b>neurons, cardiomyocites or muscle cells</b> are able to sense and respond to electrical signals. These cells use a common second messenger system, calcium ion, which promotes a defined response when an electrical pulse is supplied to them. Nevertheless, these cultures present several disadvantages in order to use them from the technological point of view: <br />
<br />
* Get easily contaminated.<br />
<br />
* Genetic manipulation is complicated and expensive.<br />
<br />
* To be very sensible to external conditions. <br />
<br />
Valencia Team uses this electricity sensibility of calcium channel to <b>produce yeast luminescence as a response to electrical estimulous</b>. This project constitutes the '''FIRST TIME in which the electrical response of <i>Saccharomyces</i> and its potential applications have been tested''' building the first '''LEC''' (Light Emitting Cell). The obtained device will be used to build the first '''iLCD''' in history.<br />
<br />
Therefore, the project is divided in several stages from the fabrication of the first '''LEC''' up to the cooperative integration of various LECs in the first '''iLCD'''. The global scheme of the project is summarized in the following scheme:<br />
<br><br><br />
<html><center><img SRC="https://static.igem.org/mediawiki/2009/c/c2/V_ProjectDiag2.jpg" USEMAP="#ejemplo" BORDER=0 height=375 width=500><br />
<MAP NAME="ejemplo"><br />
<AREA SHAPE=RECT COORDS="35,15,250,130" title="WetLab" HREF="https://2009.igem.org/Team:Valencia/WetLab/YeastTeam"><br />
<AREA SHAPE=RECT COORDS="26,145,250,245" title="Modelling" HREF="https://2009.igem.org/Team:Valencia/Modelling"><br />
<AREA SHAPE=RECT COORDS="313,36,465,185" title="Hardware" HREF="https://2009.igem.org/Team:Valencia/Hardware"><br />
<AREA SHAPE=RECT COORDS="207,273,488,362" title="Results" HREF="https://2009.igem.org/Team:Valencia/Project/Results"><br />
</center><br />
</html><br />
<br />
<br><br />
<!--<html><br />
<div align="right"><br />
<embed src="https://static.igem.org/mediawiki/2009/b/b4/Esquema_flash_bueno.swf" type="application/x-shockwave-flash" width="550" height="750" quality="high" overflow="hidden" bgcolor="WHITE"></embed> <br />
</div><br />
</html> --><br />
<!--<div style="position:relative; top:-5px; left:150px; width:600px" align="justify">--> <br />
Three main parts can be appreciated:<br />
<br />
* LEC Construction.<br />
<br />
* LEC Characterization.<br />
<br />
* iLCD: LEC Integration Device.<br />
<br />
The main advantages of using electrical signals instead of chemical stimulation, as in the Coliroid project (Levskaya et al, <i>Synthetic biology: Engineering Escherichia coli to see light</i>. <b>Nature</b> 438, 441-442), are reversibility and high frequency: the system goes back to the resting state and it take <b>seconds (down to 12 seconds) to refresh an image, actually showing animated pictures!</b>. For that reason, we chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
<b>iLCD will be a major advance in Synthetic Biology, opening the field of BioElectronics, integrating electrical signals with cell behaviours</b>. This will reduce the response time of the cells to the activation signal by up to two orders of magnitude, as well as foster the combination of Electronics and Biology. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
<br />
<br><br />
<br />
<!-- <div style="position:absolute;top:-450px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --></div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-22T03:13:32Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 4200px;<br />
}<br />
</style><br />
</html><br />
<br />
<br />
<div style="position:relative; margin-top:-295px; margin-left:190px; width:700px; font-family: Verdana;" align="justify"><br />
<br><br />
='''Experimental results'''=<br />
<br><br />
Our ultimate goal was to make a bio-screen made with cellular pixels (LECs). But, before to be able to build this iLCD, we had to study the behaviour of one single LEC. Therefore, we focused on the electrical excitation of our transformed yeasts.<br />
<br />
This is the behaviour that stands as the cornerstone of our project. '''With a serie of voltage inputs, we accomplished a series of light emissions'''. No exciting light was needed, only aequorin, coelenterazine (the prosthetic group) and Ca<sup>2+</sup>.<br />
<br />
<table><br />
<tr><br />
<td>[[Image:Valencia_Grafica_continu_2_pics.jpg|500 px|left]]</td><br />
<td>[[Image:Bursts.gif|100 px|center]]</td><br />
</tr><br />
</table><br />
<br><br />
Arrows indicate when voltage was applied: 16V during 5 seconds applied at 300 seconds (5 minutes) and 600 seconds (10 minutes). Movie on the right shows how the response would be seen in a pixel.<br />
<br />
<br />
*'''WT''' indicates our LEC: our aequorin-engineered yeast, with coelenterazine and wild-type calcium channels<br />
*'''WT -coe''' indicates the same yeast, without the addition of coelenterazine.<br />
<br />
As we can observe, '''only our LEC is excited when electric current is applied'''. Withour coelenterazine there is no response to that stimulus.<br />
<br />
==Conclusions of the study==<br />
<br><br />
We have investigated a set of '''different voltages and times in order to precisely know how our system respons to electric current. Knowing this, we could control it properly. <br />
<br />
We will show and explain here the '''major results''', for a thorough description of the behaviour of the aequorin light emission system please refer to the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Characterization page'''] or to the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 '''Registry'''].<br />
<br><br />
===Controls===<br />
<br><br />
In every single experiment in a molecular biology laboratory, one has to bear in mind the use of negative controls for every logical step of the hypothesis.<br />
Therefore, we have taken advantage of the different experimental designs that were available: we had several calcium channel knock outs (''mid1'' and ''ch1''), as well as functional inhibitors of the calcium channels (KCl) and divalent ion quelant (EDTA).<br />
<br />
All these designs were used in order to reject the idea of looking to an artifact.<br />
<br />
[[Image:Comparació_disc.jpg|700 px||left]]<br />
<br />
This graph shows the behaviour of a set of designs after the supply of a 4V shock.<br />
<br />
* '''WT''' is our wild type luminiscent cell, with coelenterazine and fully working calcium channels<br />
<br />
* '''mid1''' is a knock out for a calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''cch1''' is another knock out mutant for a calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''' is a divalent ion quelant, so Ca2+ is quenched and not useful for the light emission, although every compound necessary for the reaction is present.<br />
<br />
* '''SD +coe''' is growth media with coelenterazine, just to be sure that without cells we had no light.<br />
<br />
* '''SD''' is plain growth media.<br />
<br />
* '''yeast -coe''' is our wild type luminiscent cell, without coelenterazine, the prosthetic group that is needed for the light emission.<br />
<br />
Three kinds of behaviour stem out of this experiment: no light at all, some light emission and full light emission.<br />
* ''no light at all'' is the case of '''SD +coe''','''SD''' and '''yeast -coe''' where there is a lack of at least one of the compnents of the LEC. <br />
* ''some light emission'' is the case of '''mid1''', '''cch1''' and '''EDTA''' where all the LEC components are present, but free calcium in the cell is somehow constrained.<br />
* ''full light emission'' is the case of '''WT''' where all the components of the LEC are presents and calcium channels are fully open.<br />
<br><br />
===Voltage===<br />
<br><br />
Varying voltage and exciting time, we can have a variety of responses (arrows indicate electric current supply):<br />
<center><br />
{|<br />
|[[Image:1,5V 10s.jpg|center|450px]]<br />
|-<br />
|[[Image:4,5V 5s.jpg|center|450px]]<br />
|}<br />
</center><br />
<br />
===Supply time===<br />
<br><br />
Varying the electric current time supply we can study the influence of this variable in our system. Here we see that if we apply too much time the system is overdosed. Figure on the right shows the behaviour of the three pixels, the third one would be a blow pixel as a consequence of an oversupply of voltage.<br />
<br />
<table><br />
<tr><br />
<td>[[Image:6V variats disc.jpg|410px|center]]</td><br />
<td>[[Image:Sixvolts.gif|360 px|center]]</td><br />
</tr><br />
</table><br />
<br />
===Repetition===<br />
<br><br />
Our idea was to have a screen, that is '''to have several images sequentially''', in order to see animated pictures. So we studied the different voltage times in a sequence of power applications to one LEC.<br />
[[Image:Manteniment resposta disc.jpg|center|600px]]<br />
<br />
===Refreshing rate===<br />
<br><br />
Finally, we were looking for the shortest refreshing rate as possible, so to have something close to a ''real'' screen.<br />
[[Image:24V 0,5s.jpg|center|500 px]]<br />
<br />
We have accomplished a refreshing rate of 12 seconds with a supply of 24V in 0,5 seconds.<br />
<br />
<br />
Again, if you find yourself hungry of knowledge, please find much more information on the aequorin and the study we have made upon it on the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Parts Characterization'''] page or on the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 '''Registry'''].</div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-22T03:13:01Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 4100px;<br />
}<br />
</style><br />
</html><br />
<br />
<br />
<div style="position:relative; margin-top:-295px; margin-left:190px; width:700px; font-family: Verdana;" align="justify"><br />
<br><br />
='''Experimental results'''=<br />
<br><br />
Our ultimate goal was to make a bio-screen made with cellular pixels (LECs). But, before to be able to build this iLCD, we had to study the behaviour of one single LEC. Therefore, we focused on the electrical excitation of our transformed yeasts.<br />
<br />
This is the behaviour that stands as the cornerstone of our project. '''With a serie of voltage inputs, we accomplished a series of light emissions'''. No exciting light was needed, only aequorin, coelenterazine (the prosthetic group) and Ca<sup>2+</sup>.<br />
<br />
<table><br />
<tr><br />
<td>[[Image:Valencia_Grafica_continu_2_pics.jpg|500 px|left]]</td><br />
<td>[[Image:Bursts.gif|100 px|center]]</td><br />
</tr><br />
</table><br />
<br><br />
Arrows indicate when voltage was applied: 16V during 5 seconds applied at 300 seconds (5 minutes) and 600 seconds (10 minutes). Movie on the right shows how the response would be seen in a pixel.<br />
<br />
<br />
*'''WT''' indicates our LEC: our aequorin-engineered yeast, with coelenterazine and wild-type calcium channels<br />
*'''WT -coe''' indicates the same yeast, without the addition of coelenterazine.<br />
<br />
As we can observe, '''only our LEC is excited when electric current is applied'''. Withour coelenterazine there is no response to that stimulus.<br />
<br />
==Conclusions of the study==<br />
<br><br />
We have investigated a set of '''different voltages and times in order to precisely know how our system respons to electric current. Knowing this, we could control it properly. <br />
<br />
We will show and explain here the '''major results''', for a thorough description of the behaviour of the aequorin light emission system please refer to the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Characterization page'''] or to the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 '''Registry'''].<br />
<br><br />
===Controls===<br />
<br><br />
In every single experiment in a molecular biology laboratory, one has to bear in mind the use of negative controls for every logical step of the hypothesis.<br />
Therefore, we have taken advantage of the different experimental designs that were available: we had several calcium channel knock outs (''mid1'' and ''ch1''), as well as functional inhibitors of the calcium channels (KCl) and divalent ion quelant (EDTA).<br />
<br />
All these designs were used in order to reject the idea of looking to an artifact.<br />
<br />
[[Image:Comparació_disc.jpg|700 px||left]]<br />
<br />
This graph shows the behaviour of a set of designs after the supply of a 4V shock.<br />
<br />
* '''WT''' is our wild type luminiscent cell, with coelenterazine and fully working calcium channels<br />
<br />
* '''mid1''' is a knock out for a calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''cch1''' is another knock out mutant for a calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''' is a divalent ion quelant, so Ca2+ is quenched and not useful for the light emission, although every compound necessary for the reaction is present.<br />
<br />
* '''SD +coe''' is growth media with coelenterazine, just to be sure that without cells we had no light.<br />
<br />
* '''SD''' is plain growth media.<br />
<br />
* '''yeast -coe''' is our wild type luminiscent cell, without coelenterazine, the prosthetic group that is needed for the light emission.<br />
<br />
Three kinds of behaviour stem out of this experiment: no light at all, some light emission and full light emission.<br />
* ''no light at all'' is the case of '''SD +coe''','''SD''' and '''yeast -coe''' where there is a lack of at least one of the compnents of the LEC. <br />
* ''some light emission'' is the case of '''mid1''', '''cch1''' and '''EDTA''' where all the LEC components are present, but free calcium in the cell is somehow constrained.<br />
* ''full light emission'' is the case of '''WT''' where all the components of the LEC are presents and calcium channels are fully open.<br />
<br><br />
===Voltage===<br />
<br><br />
Varying voltage and exciting time, we can have a variety of responses (arrows indicate electric current supply):<br />
<center><br />
{|<br />
|[[Image:1,5V 10s.jpg|center|450px]]<br />
|-<br />
|[[Image:4,5V 5s.jpg|center|450px]]<br />
|}<br />
</center><br />
<br />
===Supply time===<br />
<br><br />
Varying the electric current time supply we can study the influence of this variable in our system. Here we see that if we apply too much time the system is overdosed. Figure on the right shows the behaviour of the three pixels, the third one would be a blow pixel as a consequence of an oversupply of voltage.<br />
<br />
<table><br />
<tr><br />
<td>[[Image:6V variats disc.jpg|410px|center]]</td><br />
<td>[[Image:Sixvolts.gif|360 px|center]]</td><br />
</tr><br />
</table><br />
<br />
===Repetition===<br />
<br><br />
Our idea was to have a screen, that is '''to have several images sequentially''', in order to see animated pictures. So we studied the different voltage times in a sequence of power applications to one LEC.<br />
[[Image:Manteniment resposta disc.jpg|center|600px]]<br />
<br />
===Refreshing rate===<br />
<br><br />
Finally, we were looking for the shortest refreshing rate as possible, so to have something close to a ''real'' screen.<br />
[[Image:24V 0,5s.jpg|center|500 px]]<br />
<br />
We have accomplished a refreshing rate of 12 seconds with a supply of 24V in 0,5 seconds.<br />
<br />
<br />
Again, if you find yourself hungry of knowledge, please find much more information on the aequorin and the study we have made upon it on the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Parts Characterization'''] page or on the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 '''Registry'''].</div>Emiliohttp://2009.igem.org/User:AngelesUser:Angeles2009-10-22T01:48:12Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1550px;<br />
}<br />
</style><br />
</html><br />
<br />
<div align="justify" style="position:relative; top:-200px; margin-left:200px; width:700px; font-family:Verdana; font-size:10pt; color:#0174DF"><br />
<br />
<br><br />
[[Image:Angeles.jpg| 150px | thumb | left | Angeles - WETLAB]]<br />
<br />
== '''Personal presentation''' ==<br />
<br><br />
Hello world! I'm Angeles! <br />
<br />
I'm gonna start my last year studying Biology at the UV. I love everything related with DNA, interactions between molecules and those amazing proceses that happens inside cells. That's the main reason why I decided to be in the "yeast team" of our project, because we are working with the (sometimes loved and sometimes hated) Molecular Biology. I'm taking part on "aesthetic aspects" of the wiki, (hehe) and I'm the responsible of the BioBricks, too.<br />
<br />
I think Sintethic Biology is something raising that can become a very special area of the Biology of the future.<br />
<br />
<br />
</div></div>Emiliohttp://2009.igem.org/User:CarlesUser:Carles2009-10-22T01:46:26Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1550px;<br />
}<br />
</style><br />
</html><br />
<br />
<div align="justify" style="position:relative; top:-200px; margin-left:200px; width:700px; font-family:Verdana; font-size:10pt; color:#0174DF"><br />
<br><br />
[[Image:Carles.jpg| 150px | thumb | left | Carles - WETLAB]]<br />
<br />
== '''Personal presentation''' ==<br />
<br><br />
Hi everyone!<br />
<br />
I'm Carles and I want to be a pirate! Since there is no Pirate School in Valencia I decided to study Biochemistry at the UV. I'm in the Yeast Team because I like things you can't see like proteins, molecules, music and that kind of stuff. I'm also in the Human Practices Team because I like things you can't touch like ideas, ethics, music and that kind of stuff.<br />
<br />
See you at the Jamboree!<br />
</div></div>Emiliohttp://2009.igem.org/User:Guimar3User:Guimar32009-10-22T01:45:23Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1550px;<br />
}<br />
</style><br />
</html><br />
<br />
<div align="justify" style="position:relative; top:-200px; margin-left:200px; width:700px; font-family:Verdana; font-size:10pt; color:#0174DF"><br />
<br><br />
[[Image:Guillem.jpg| 150px | thumb | left | Guillem - WETLAB]]<br />
<br />
== '''Personal presentation''' ==<br />
<br><br />
Hello! I'm Guillem. I'm studying Biochemistry at Universitat de València, and this year is the last. Next year I'll be graduate!<br />
<br />
Now, I'm the coordinator of the wiki (but this does not mean that I have to do everything!) <br />
<br />
I'm working at Yeast Team too with the other WetLab members. The work is too hard but it's funny!<br />
<br />
What? Do you want to know more about me? OK. In my free time I like go to cinema, watch TV series and I like to be with my girlfriend Elena. Moreover, I like cats (I have three! They are fantastic).<br />
<br />
You can contact with me at guillemmarco@gmail.com<br />
<br />
Bye!!<br />
<br />
</div></div>Emiliohttp://2009.igem.org/User:AmandaUser:Amanda2009-10-22T01:44:28Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1550px;<br />
}<br />
</style><br />
</html><br />
<br />
<div align="justify" style="position:relative; top:-200px; margin-left:200px; width:700px; font-family:Verdana; font-size:10pt; color:#0174DF"><br />
<br><br />
[[Image:Sara.jpg| 150px | thumb | left | Sara - WETLAB]]<br />
<br />
== '''Personal presentation''' ==<br />
<br><br />
Hi! My name is Sara. <br />
<br />
I'm studying Biochemistry and Biotechnology, and I'm in the wetlab. I'm too the coordinator of the poster. About me, only saying that I love science, but apart from science, I love any artistic expression :)<br />
<br />
See you!<br />
</div></div>Emiliohttp://2009.igem.org/User:LaloUser:Lalo2009-10-22T01:42:40Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1550px;<br />
}<br />
</style><br />
</html><br />
<br />
<div align="justify" style="position:relative; top:-200px; margin-left:200px; width:700px; font-family:Verdana; font-size:10pt; color:#0174DF"><br />
<br><br />
[[Image:Edu.jpg| 150px | thumb | left | Jerzy - DRYLAB]]<br />
<br />
== '''Personal presentation''' ==<br />
<br><br />
Hey people!<br />
<br />
I´m a 23 year old Industrial Engineer student who already has an I.T. degree. I decided to follow another degree as I want you improve my knowledge on Robotics (my final target is to earn an enormous salary). <br />
<br />
I am enjoying this research project since I am very interested in the Engineering bit of the whole Synthetic Biology science. Don´t get me wrong, I am not a geek. Actually I am a regular guy who likes going out with my friends, having a beer and another one and saving the world from time to time.<br />
<br />
</div></div>Emiliohttp://2009.igem.org/Team:Valencia/ProjectTeam:Valencia/Project2009-10-22T01:30:23Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1700px;<br />
}<br />
</style><br />
</html><br />
<br />
<div style="position:relative; margin-left: 175px; top:-245px; height:2700px; width:700px; color:black; font-size:10pt; font-family:Verdana" align="justify"><br />
<br />
== '''Project description''' ==<br />
<br />
<br><br />
The <b>iGEM Valencia Lighting Cell Display</b> (<b>iLCD</b>) is our project for the present iGEM competition. We are developing '''BioElectronics''', a combination of Electronics and Biology. We think that cell behaviour might be controlled by electrical impulses. For demostrate this, we are making <b>a “bio-screen” of voltage-activated cells</b>, where every “cellular pixel” produces light. It is just like a bacterial photographic system, but '''it's digital'''. Within seconds, instead of hours, you can get an image formed of living cells.<br />
We use the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen<br />
<br />
It is known that for instance <b>neurons, cardiomyocites or muscle cells</b> are able to sense and respond to electrical signals. These cells use a common second messenger system, calcium ion, which promotes a defined response when an electrical pulse is supplied to them. Nevertheless, these cultures present several disadvantadges in order to make use of them from the technological point of view: <br />
<br />
- Get easily contaminated.<br />
<br />
- Genetic manipulation is complicated and expensive.<br />
<br />
- To be very sensible to external conditions. <br />
<br />
Valencia team uses this sensibility of calcium channel to electricity to <b>produce yeast luminiscence as a response to electrical estimulous</b>. This project constitutes the '''FIRST TIME in which the electrical response of <i>Saccharomyces</i> and its potential applications are going to be tested''' building the first '''LEC''' (Light Emitting Cell). The obtained device will be used to build the first''' iLCD''' in history.<br />
<br />
Therefore, the project is divided in several stages from the fabrication of the first '''LEC''' up to the cooperative integration of various LECs in the first '''iLCD'''. The global scheme of the project is summarized in the scheme of the figure:<br />
<br><br />
[[Image: V_ProjectDiag.JPG | center | 500px]]<br />
<br><br />
<!--<html><br />
<div align="right"><br />
<embed src="https://static.igem.org/mediawiki/2009/b/b4/Esquema_flash_bueno.swf" type="application/x-shockwave-flash" width="550" height="750" quality="high" overflow="hidden" bgcolor="WHITE"></embed> <br />
</div><br />
</html> --><br />
<!--<div style="position:relative; top:-5px; left:150px; width:600px" align="justify">--> <br />
Where three main parts can be appreciated<br />
<br />
* LEC Construction<br />
<br />
* LEC Characterization<br />
<br />
* LEC Integration Device<br />
<br />
The main advantages of using electrical signals instead of chemical stimulation, as in the Coliroid project (Levskaya et al, <i>Synthetic biology: Engineering Escherichia coli to see light</i>. <b>Nature</b> 438, 441-442), are reversibility and high frequency: the system can go back to the resting state and it will take <b>seconds to refresh an image, actually showing animated pictures!</b>. For that reason, we chose the calcium signaling because it is the fastest known modality of signaling in biology, and will allow for a fast refreshing rate of the screen.<br />
<br />
<b>iLCD will be a major advance in Synthetic Biology, opening the field of Green Electronics, integrating electrical signals with cell behaviours</b>. This will reduce the response time of the cells to the activation signal by up to two orders of magnitude, as well as foster the combination of Electronics and Biology. Thus, our engineered yeast are a state-of-art bioelectronic device.<br />
<br />
<br />
<br />
<br />
<br><br />
<br />
<!-- <div style="position:absolute;top:-450px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --></div>Emiliohttp://2009.igem.org/Team:Valencia/The_Town_DockTeam:Valencia/The Town Dock2009-10-22T01:21:47Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
<br />
#content{<br />
height:2650px;<br />
}<br />
</style><br />
</html><br />
<br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; font-size:10pt; font-family: Verdana"><br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana"><br />
<br />
== '''The Town Dock''' ==<br />
<br><br />
<br />
In 1962, using the methods that had worked in the<br />
previous year, we obtained an additional amount of aequorin<br />
and began to study various aspects of the molecule,<br />
including its application in the measurement of calcium<br />
ions. We also wanted to know the mechanism of the luminescence<br />
reaction and the structure of the light-emitting<br />
chromophore. But our efforts to achieve these goals were<br />
soon blocked by an insuperable difficulty. When various<br />
methods were used to break down the molecules of aequorin,<br />
the first step of the reaction was always an intramolecular<br />
chemical change; so it was impossible to isolate<br />
intact chromophores. We therefore decided to postpone<br />
further study on the light-emitting mechanism.<br />
<br />
<br />
In 1967, Ridgway and Ashley reported their observation,<br />
with the aid of microinjected aequorin, of transient<br />
Ca2+ signals in single muscle fibers of the barnacle. It was<br />
the first report on the use of aequorin in studying intracellular<br />
calcium, and it was soon followed by hundreds<br />
of papers. Because the importance of aequorin was now<br />
evident, we wanted to study the chemistry of the luminescence<br />
reaction. Although the structure of the native<br />
light-emitting chromophore seemed intractable, I thought<br />
that the structure of the chromophore after the luminescence<br />
reaction could be determined. For a structural study<br />
of the chromophore, I estimated that 100-200 mg of pure<br />
aequorin would be needed in a single experiment. About<br />
'''50,000 jellyfish (2.5 tons)''' would be needed to produce<br />
this amount of aequorin. But to process 50,000 jellyfish<br />
in one summer, we would have to collect and cut at least<br />
3000 of the animals each day, allowing for days of bad<br />
weather and poor fishing. This was a workload that could<br />
not be accomplished by collecting jellyfish at the lab dock<br />
and cutting ring with scissors at a rate of one ring per<br />
minute.<br />
<br />
[[Image:Medusas-pesca-japon.jpg|300px|center]]<br />
<br />
<br />
We resumed the jellyfish operation at Friday Harbor<br />
in the summer of 1967, not anticipating that it would<br />
continue for the next 20 years. To collect more jellyfish,<br />
we expanded our fishing ground beyond the lab dock,<br />
adding the Chevron dock (a small commercial pier), the<br />
town dock (public pier), and the shipyard (a covered boat<br />
storage), and we used a car to move around and to transport<br />
the buckets ofjellyfish. When the current carried the<br />
stream ofjellyfish far beyond the docks, we also used rowboats<br />
to collect jellyfish, a tricky activity that occasionally<br />
caused a collector to fall into very cold seawater. The<br />
Chevron dock was our favorite place during the first 2-3<br />
years, because there was a part of it where a large number<br />
ofjellyfish would stack up on an early morning tide. We<br />
had to be careful, however, not to make noise that might<br />
awaken sleeping people on the boats.<br />
<br />
<br />
The town dock was very small-almost nonexistentin<br />
the late ’60s; but then it was rapidly expanded. By 1975,<br />
the dock had been extended far enough into the bay to<br />
intersect with the main jellyfish stream, and it then became<br />
a highly favorable spot for fishing. Indeed, the town dock<br />
with its large sign saying “Port of Friday Harbor” became<br />
our main fishing ground, and the collection became much<br />
easier than before. We harvested jellyfish every morning<br />
and evening. The collectors were usually my wife, our son<br />
and daughter, a couple of assistants, and me. Dr. and<br />
Mrs. Johnson also helped for the first several years. Because<br />
the jellyfish are nearly transparent in seawater, they<br />
cannot easily be seen with untrained eyes. Our children<br />
were only 3-4 years old when they began collecting jellyfish<br />
with specially made short nets; they had become as<br />
efficient as an average adult by the age of 8; and through<br />
high school they continued to be great helpers in my project.<br />
<br />
<br />
Before beginning a collection, we filled buckets about<br />
half-full with seawater and placed them strategically along<br />
the edge of pier, then gathered jellyfish until the buckets<br />
were completely full. When a dense stream of animals<br />
was passing the dock, we could collect at a rate of 5-10<br />
jellyfish per minute. When all the buckets were filled, we<br />
poured off some water to about 80% capacity, and then<br />
covered each bucket with a plastic bag to prevent seawater<br />
from spilling during transportation. The buckets-each<br />
crammed with about 100 jellyfish in very little waterwere<br />
then packed into the trunk of a car (which could<br />
accommodate 12 buckets) and rushed to the lab. More<br />
buckets were usually transported to the lab on a Boston<br />
Whaler by one of the assistants. Once at the lab, and before<br />
any rings were cut, the jellyfish were kept in aquaria to<br />
revive. In this manner, we were able to collect an average<br />
of 3000-4000 jellyfish each day at the town dock.<br />
<br />
[[Image:El caso de las Medusas.jpg|300px|center]]<br />
<br />
The town dock was very good for jellyfish fishing, but<br />
there were some problems. Often we found too many<br />
boats at the dockside; this decreased the open space where<br />
we could collect jellyfish. When the loading area, located<br />
halfway along the main dock, was fully occupied, we had<br />
to carry the heavy buckets of jellyfish all the way to our<br />
car, which would be parked more than 200 yards away.<br />
The biggest problem, however, was that there were too<br />
many boat people who asked us questions. “What are you<br />
doing?” “ What are you collecting?’ “How do you use<br />
them?’ Almost every passerby felt obliged to ask us a<br />
question while we were busily collecting. Most people were<br />
satisfied by our simple reply: “These are for scientific research.”<br />
Some people persisted until they had received a<br />
complete explanation of our research.<br />
<br />
<br />
I cannot forget a funny exchange that took place one<br />
early morning. An old lady poked her head out from the<br />
window of a small boat, looked at the jellyfish on my net,<br />
and asked me, “How do you cook them?”<br />
<br />
I answered, “We don’t cook those jellyfish.”<br />
<br />
She gazed at me distastefully, “Do you eat them raw?”<br />
and her head disappeared.<br />
<br />
“No! We don’t eat them!” But my reply was too late.<br />
<br />
<center><html><br />
Back to&nbsp;<a href="https://2009.igem.org/Team:Valencia/A_short_story"><span font-color="#047DB5" font-size:"12pt">Discovery of Aequorin </font></a>&nbsp;&nbsp;| The Town Dock | &nbsp;&nbsp;Go to <a href="https://2009.igem.org/Team:Valencia/The_Jellyfish_Factory"><font color="#047DB5"> The Jellyfish Factory </font></a><br />
</div><br />
</html></center></div>Emiliohttp://2009.igem.org/Team:Valencia/The_Town_DockTeam:Valencia/The Town Dock2009-10-22T01:21:26Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
<br />
#content{<br />
height:2600px;<br />
}<br />
</style><br />
</html><br />
<br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; font-size:10pt; font-family: Verdana"><br />
<br />
<span style="color:black; align:justify; font-size:11pt; font-family: Verdana"><br />
<br />
== '''The Town Dock''' ==<br />
<br><br />
<br />
In 1962, using the methods that had worked in the<br />
previous year, we obtained an additional amount of aequorin<br />
and began to study various aspects of the molecule,<br />
including its application in the measurement of calcium<br />
ions. We also wanted to know the mechanism of the luminescence<br />
reaction and the structure of the light-emitting<br />
chromophore. But our efforts to achieve these goals were<br />
soon blocked by an insuperable difficulty. When various<br />
methods were used to break down the molecules of aequorin,<br />
the first step of the reaction was always an intramolecular<br />
chemical change; so it was impossible to isolate<br />
intact chromophores. We therefore decided to postpone<br />
further study on the light-emitting mechanism.<br />
<br />
<br />
In 1967, Ridgway and Ashley reported their observation,<br />
with the aid of microinjected aequorin, of transient<br />
Ca2+ signals in single muscle fibers of the barnacle. It was<br />
the first report on the use of aequorin in studying intracellular<br />
calcium, and it was soon followed by hundreds<br />
of papers. Because the importance of aequorin was now<br />
evident, we wanted to study the chemistry of the luminescence<br />
reaction. Although the structure of the native<br />
light-emitting chromophore seemed intractable, I thought<br />
that the structure of the chromophore after the luminescence<br />
reaction could be determined. For a structural study<br />
of the chromophore, I estimated that 100-200 mg of pure<br />
aequorin would be needed in a single experiment. About<br />
'''50,000 jellyfish (2.5 tons)''' would be needed to produce<br />
this amount of aequorin. But to process 50,000 jellyfish<br />
in one summer, we would have to collect and cut at least<br />
3000 of the animals each day, allowing for days of bad<br />
weather and poor fishing. This was a workload that could<br />
not be accomplished by collecting jellyfish at the lab dock<br />
and cutting ring with scissors at a rate of one ring per<br />
minute.<br />
<br />
[[Image:Medusas-pesca-japon.jpg|300px|center]]<br />
<br />
<br />
We resumed the jellyfish operation at Friday Harbor<br />
in the summer of 1967, not anticipating that it would<br />
continue for the next 20 years. To collect more jellyfish,<br />
we expanded our fishing ground beyond the lab dock,<br />
adding the Chevron dock (a small commercial pier), the<br />
town dock (public pier), and the shipyard (a covered boat<br />
storage), and we used a car to move around and to transport<br />
the buckets ofjellyfish. When the current carried the<br />
stream ofjellyfish far beyond the docks, we also used rowboats<br />
to collect jellyfish, a tricky activity that occasionally<br />
caused a collector to fall into very cold seawater. The<br />
Chevron dock was our favorite place during the first 2-3<br />
years, because there was a part of it where a large number<br />
ofjellyfish would stack up on an early morning tide. We<br />
had to be careful, however, not to make noise that might<br />
awaken sleeping people on the boats.<br />
<br />
<br />
The town dock was very small-almost nonexistentin<br />
the late ’60s; but then it was rapidly expanded. By 1975,<br />
the dock had been extended far enough into the bay to<br />
intersect with the main jellyfish stream, and it then became<br />
a highly favorable spot for fishing. Indeed, the town dock<br />
with its large sign saying “Port of Friday Harbor” became<br />
our main fishing ground, and the collection became much<br />
easier than before. We harvested jellyfish every morning<br />
and evening. The collectors were usually my wife, our son<br />
and daughter, a couple of assistants, and me. Dr. and<br />
Mrs. Johnson also helped for the first several years. Because<br />
the jellyfish are nearly transparent in seawater, they<br />
cannot easily be seen with untrained eyes. Our children<br />
were only 3-4 years old when they began collecting jellyfish<br />
with specially made short nets; they had become as<br />
efficient as an average adult by the age of 8; and through<br />
high school they continued to be great helpers in my project.<br />
<br />
<br />
Before beginning a collection, we filled buckets about<br />
half-full with seawater and placed them strategically along<br />
the edge of pier, then gathered jellyfish until the buckets<br />
were completely full. When a dense stream of animals<br />
was passing the dock, we could collect at a rate of 5-10<br />
jellyfish per minute. When all the buckets were filled, we<br />
poured off some water to about 80% capacity, and then<br />
covered each bucket with a plastic bag to prevent seawater<br />
from spilling during transportation. The buckets-each<br />
crammed with about 100 jellyfish in very little waterwere<br />
then packed into the trunk of a car (which could<br />
accommodate 12 buckets) and rushed to the lab. More<br />
buckets were usually transported to the lab on a Boston<br />
Whaler by one of the assistants. Once at the lab, and before<br />
any rings were cut, the jellyfish were kept in aquaria to<br />
revive. In this manner, we were able to collect an average<br />
of 3000-4000 jellyfish each day at the town dock.<br />
<br />
[[Image:El caso de las Medusas.jpg|300px|center]]<br />
<br />
The town dock was very good for jellyfish fishing, but<br />
there were some problems. Often we found too many<br />
boats at the dockside; this decreased the open space where<br />
we could collect jellyfish. When the loading area, located<br />
halfway along the main dock, was fully occupied, we had<br />
to carry the heavy buckets of jellyfish all the way to our<br />
car, which would be parked more than 200 yards away.<br />
The biggest problem, however, was that there were too<br />
many boat people who asked us questions. “What are you<br />
doing?” “ What are you collecting?’ “How do you use<br />
them?’ Almost every passerby felt obliged to ask us a<br />
question while we were busily collecting. Most people were<br />
satisfied by our simple reply: “These are for scientific research.”<br />
Some people persisted until they had received a<br />
complete explanation of our research.<br />
<br />
<br />
I cannot forget a funny exchange that took place one<br />
early morning. An old lady poked her head out from the<br />
window of a small boat, looked at the jellyfish on my net,<br />
and asked me, “How do you cook them?”<br />
<br />
I answered, “We don’t cook those jellyfish.”<br />
<br />
She gazed at me distastefully, “Do you eat them raw?”<br />
and her head disappeared.<br />
<br />
“No! We don’t eat them!” But my reply was too late.<br />
<br />
<center><html><br />
Back to&nbsp;<a href="https://2009.igem.org/Team:Valencia/A_short_story"><span font-color="#047DB5" font-size:"12pt">Discovery of Aequorin </font></a>&nbsp;&nbsp;| The Town Dock | &nbsp;&nbsp;Go to <a href="https://2009.igem.org/Team:Valencia/The_Jellyfish_Factory"><font color="#047DB5"> The Jellyfish Factory </font></a><br />
</div><br />
</html></center></div>Emiliohttp://2009.igem.org/Team:Valencia/Hardware/iLCDTeam:Valencia/Hardware/iLCD2009-10-22T01:09:47Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 2200px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; font-size:10pt; font-family: Verdana"><br />
=='''iLCD: LEC array'''==<br />
<br><br />
We have characterized the light response of yeast to electrical pulse stimulation and according to that characterization we have established the refreshing time in approximately 10 s. (see [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam/Results the experimental results section]). After that, we considered to control an array of 96 totally independent pixels (or cell cultures), in such a way that they can work cooperatively creating '''animated pictures'''. This system constitutes the first screen that works with living cells.<br> <br><br />
<br />
Two problems must be solved before we can have our iLCD: controlling each pixel of the 96-wells array and being able to control the cooperative work of each pixel in response to a given input.<br><br><br />
1) '''Building the 96 pixels support'''.<br />
<br />
In order to be able to send the desired voltage to the 96 outputs '''we substituted the soundcard as a source of voltage by a 24 channel-wide [http://sine.ni.com/nips/cds/view/p/lang/en/nid/201630 acquisition data card]''' able to selectively '''controlling the input of amplitude- and time-varying electrical pulses'''. As the card has 24 outputs and we want to control 96 pixels an electronic circuit allowing the identification of each pixel with the combinatorial of 20 outputs has been implemented (20 outputs allow the identification of up to 100 pixels). ''These pulses are the signal for the coordinated switch on and off of an array of pixels'' (they can be Diodes, LEDs, or Cells, LECs or any other device which responds to a voltage).<br />
<br><br><br />
[[Image: V_ScreenCircuit.jpg|500px|center]]<br />
<br><br />
2) '''Controlling the system'''.<br />
<br />
In order to be able to control the adquisiton data card in such a way that it allows a '''coordinated response of the different pixels''', a LabVIEW program has been implemented. The program divides each desired image (jpg file) in 96 parts. Depending on the colour intensity of each part, our program sends simultaneously through the data acquisition card (connected to the laptop through a USB port) a voltage signal that permits the activation of the corresponding pixels. A scheme of the algorithm is shown in the picture<br />
<br />
[[Image: V_NinoMoving.gif|450px|center]]<br />
<br><br />
<br />
'''The system is capable of transmiting several images to the pixels, allowing the reproduction of different images resulting in animated black and white movies.'''<br />
<br />
<br />
<br><br><br />
<br />
== iLCD recipe ==<br />
<br />
<br />
Material you will need in order to build your own iLCD:<br />
<br />
- a laptop<br />
<br />
- a data acquisition card National Instruments 6501 USB (or anyone with the same characteristics)<br />
<br />
- our LabView program<br />
<br />
- images you want to animate<br />
<br />
- [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam Light Emitting Cells (LECs)]<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/Hardware/iLCDTeam:Valencia/Hardware/iLCD2009-10-22T01:09:01Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 2200px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px; font-size:10pt; font-family: Verdana"><br />
=='''iLCD: LEC array'''==<br />
<br><br />
We have characterized the light response of yeast to electrical pulse stimulation and according to that characterization we have established the refreshing time in approximately 10 s. (see [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam/Results the experimental results section]). After that, we considered to control an array of 96 totally independent pixels (or cell cultures), in such a way that they can work cooperatively creating '''animated pictures'''. This system constitutes the first screen that works with living cells.<br> <br><br />
<br />
Two problems must be solved before we can have our iLCD: controlling each pixel of the 96-wells array and being able to control the cooperative work of each pixel in response to a given input.<br><br><br />
1) '''Building the 96 pixels support'''.<br />
<br />
In order to be able to send the desired voltage to the 96 outputs '''we substituted the soundcard as a source of voltage by a 24 channel-wide [http://sine.ni.com/nips/cds/view/p/lang/en/nid/201630 acquisition data card]''' able to selectively '''controlling the input of amplitude- and time-varying electrical pulses'''. As the card has 24 outputs and we want to control 96 pixels an electronic circuit allowing the identification of each pixel with the combinatorial of seven outputs has been implemented (20 outputs allow the identification of up to 100 pixels). ''These pulses are the signal for the coordinated switch on and off of an array of pixels'' (they can be Diodes, LEDs, or Cells, LECs or any other device which responds to a voltage).<br />
<br><br><br />
[[Image: V_ScreenCircuit.jpg|500px|center]]<br />
<br><br />
2) '''Controlling the system'''.<br />
<br />
In order to be able to control the adquisiton data card in such a way that it allows a '''coordinated response of the different pixels''', a LabVIEW program has been implemented. The program divides each desired image (jpg file) in 96 parts. Depending on the colour intensity of each part, our program sends simultaneously through the data acquisition card (connected to the laptop through a USB port) a voltage signal that permits the activation of the corresponding pixels. A scheme of the algorithm is shown in the picture<br />
<br />
[[Image: V_NinoMoving.gif|450px|center]]<br />
<br><br />
<br />
'''The system is capable of transmiting several images to the pixels, allowing the reproduction of different images resulting in animated black and white movies.'''<br />
<br />
<br />
<br><br><br />
<br />
== iLCD recipe ==<br />
<br />
<br />
Material you will need in order to build your own iLCD:<br />
<br />
- a laptop<br />
<br />
- a data acquisition card National Instruments 6501 USB (or anyone with the same characteristics)<br />
<br />
- our LabView program<br />
<br />
- images you want to animate<br />
<br />
- [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam Light Emitting Cells (LECs)]<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-22T00:27:30Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 4250px;<br />
}<br />
</style><br />
</html><br />
<br />
<br />
<div style="position:relative; margin-top:-295px; margin-left:190px; width:700px; font-family: Verdana;" align="justify"><br />
<br><br />
='''Experimental results'''=<br />
<br><br />
Our ultimate goal was to make a bio-screen made with cellular pixels (LECs). But, before to be able to build this iLCD, we had to study the behaviour of one single LEC. Therefore, we focused on the electrical excitation of our transformed yeasts.<br />
<br />
This is the behaviour that stands as the cornerstone of our project. '''With a serie of voltage inputs, we accomplished a series of light emissions'''. No exciting light was needed, only aequorin, coelenterazine (the prosthetic group) and Ca<sup>2+</sup>.<br />
<br />
[[Image:Valencia_Grafica_continu_2_pics.jpg|600 px|center]]<br />
<br />
Arrows indicate when voltage was applied: 16V during 5 seconds applied at 300 seconds (5 minutes) and 600 seconds (10 minutes).<br />
*'''WT''' indicates our LEC: our aequorin-engineered yeast, with coelenterazine and wild-type calcium channels<br />
*'''WT -coe''' indicates the same yeast, without the addition of coelenterazine.<br />
<br />
As we can observe, '''only our LEC is excited when electric current is applied'''. Withour coelenterazine there is no response to that stimulus.<br />
<br />
==Conclusions of the study==<br />
<br><br />
We have investigated a set of '''different voltages and times in order to precisely know how our system respons to electric current. Knowing this, we could control it properly. <br />
<br />
We will show and explain here the '''major results''', for a thorough description of the behaviour of the aequorin light emission system please refer to the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Characterization page'''] or to the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 '''Registry'''].<br />
<br><br />
===Controls===<br />
<br><br />
In every single experiment in a molecular biology laboratory, one has to bear in mind the use of negative controls for every logical step of the hypothesis.<br />
Therefore, we have taken advantage of the different experimental designs that were available: we had several calcium channel knock outs (''mid1'' and ''ch1''), as well as functional inhibitors of the calcium channels (KCl) and divalent ion quelant (EDTA).<br />
<br />
All these designs were used in order to reject the idea of looking to an artifact.<br />
[[Image:Comparació_disc.jpg|700 px|center]]<br />
<br />
This graph shows the behaviour of a set of designs after the supply of a 4V shock.<br />
<br />
* '''WT''' is our wild type luminiscent cell, with coelenterazine and fully working calcium channels<br />
<br />
* '''mid1''' is a knock out for a calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''cch1''' is another knock out mutant for a calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''' is a divalent ion quelant, so Ca2+ is quenched and not useful for the light emission, although every compound necessary for the reaction is present.<br />
<br />
* '''SD +coe''' is growth media with coelenterazine, just to be sure that without cells we had no light.<br />
<br />
* '''SD''' is plain growth media.<br />
<br />
* '''yeast -coe''' is our wild type luminiscent cell, without coelenterazine, the prosthetic group that is needed for the light emission.<br />
<br />
Three kinds of behaviour stem out of this experiment: no light at all, some light emission and full light emission.<br />
* ''no light at all'' is the case of '''SD +coe''','''SD''' and '''yeast -coe''' where there is a lack of at least one of the compnents of the LEC. <br />
* ''some light emission'' is the case of '''mid1''', '''cch1''' and '''EDTA''' where all the LEC components are present, but free calcium in the cell is somehow constrained.<br />
* ''full light emission'' is the case of '''WT''' where all the components of the LEC are presents and calcium channels are fully open.<br />
<br><br />
===Voltage===<br />
<br><br />
Varying voltage and exciting time, we can have a variety of responses (arrows indicate electric current supply):<br />
<center><br />
{|<br />
|[[Image:1,5V 10s.jpg|center|450px]]<br />
|-<br />
|[[Image:4,5V 5s.jpg|center|450px]]<br />
|}<br />
</center><br />
<br />
===Supply time===<br />
<br><br />
Varying the electric current time supply we can study the influence of this variable in our system. Here we see that if we apply too much time the system is overdosed...<br />
<br />
[[Image:6V variats disc.jpg|500px|center]]<br />
<br />
===Repetition===<br />
<br><br />
Our idea was to have a screen, that is '''to have several images sequentially''', in order to see animated pictures. So we studied the different voltage times in a sequence of power applications to one LEC.<br />
[[Image:Manteniment resposta disc.jpg|center|600px]]<br />
<br />
===Refreshing rate===<br />
<br><br />
Finally, we were looking for the shortest refreshing rate as possible, so to have something close to a ''real'' screen.<br />
[[Image:24V 0,5s.jpg|center|500 px]]<br />
<br />
We have accomplished a refreshing rate of 12 seconds with a supply of 24V in 0,5 seconds.<br />
<br />
<br />
Again, if you find yourself hungry of knowledge, please find much more information on the aequorin and the study we have made upon it on the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Parts Characterization'''] page or on the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 '''Registry'''].</div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-22T00:27:00Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 4000px;<br />
}<br />
</style><br />
</html><br />
<br />
<br />
<div style="position:relative; margin-top:-295px; margin-left:190px; width:700px; font-family: Verdana;" align="justify"><br />
<br><br />
='''Experimental results'''=<br />
<br><br />
Our ultimate goal was to make a bio-screen made with cellular pixels (LECs). But, before to be able to build this iLCD, we had to study the behaviour of one single LEC. Therefore, we focused on the electrical excitation of our transformed yeasts.<br />
<br />
This is the behaviour that stands as the cornerstone of our project. '''With a serie of voltage inputs, we accomplished a series of light emissions'''. No exciting light was needed, only aequorin, coelenterazine (the prosthetic group) and Ca<sup>2+</sup>.<br />
<br />
[[Image:Valencia_Grafica_continu_2_pics.jpg|600 px|center]]<br />
<br />
Arrows indicate when voltage was applied: 16V during 5 seconds applied at 300 seconds (5 minutes) and 600 seconds (10 minutes).<br />
*'''WT''' indicates our LEC: our aequorin-engineered yeast, with coelenterazine and wild-type calcium channels<br />
*'''WT -coe''' indicates the same yeast, without the addition of coelenterazine.<br />
<br />
As we can observe, '''only our LEC is excited when electric current is applied'''. Withour coelenterazine there is no response to that stimulus.<br />
<br />
==Conclusions of the study==<br />
<br><br />
We have investigated a set of '''different voltages and times in order to precisely know how our system respons to electric current. Knowing this, we could control it properly. <br />
<br />
We will show and explain here the '''major results''', for a thorough description of the behaviour of the aequorin light emission system please refer to the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Characterization page'''] or to the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 '''Registry'''].<br />
<br><br />
===Controls===<br />
<br><br />
In every single experiment in a molecular biology laboratory, one has to bear in mind the use of negative controls for every logical step of the hypothesis.<br />
Therefore, we have taken advantage of the different experimental designs that were available: we had several calcium channel knock outs (''mid1'' and ''ch1''), as well as functional inhibitors of the calcium channels (KCl) and divalent ion quelant (EDTA).<br />
<br />
All these designs were used in order to reject the idea of looking to an artifact.<br />
[[Image:Comparació_disc.jpg|700 px|center]]<br />
<br />
This graph shows the behaviour of a set of designs after the supply of a 4V shock.<br />
<br />
* '''WT''' is our wild type luminiscent cell, with coelenterazine and fully working calcium channels<br />
<br />
* '''mid1''' is a knock out for a calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''cch1''' is another knock out mutant for a calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''' is a divalent ion quelant, so Ca2+ is quenched and not useful for the light emission, although every compound necessary for the reaction is present.<br />
<br />
* '''SD +coe''' is growth media with coelenterazine, just to be sure that without cells we had no light.<br />
<br />
* '''SD''' is plain growth media.<br />
<br />
* '''yeast -coe''' is our wild type luminiscent cell, without coelenterazine, the prosthetic group that is needed for the light emission.<br />
<br />
Three kinds of behaviour stem out of this experiment: no light at all, some light emission and full light emission.<br />
* ''no light at all'' is the case of '''SD +coe''','''SD''' and '''yeast -coe''' where there is a lack of at least one of the compnents of the LEC. <br />
* ''some light emission'' is the case of '''mid1''', '''cch1''' and '''EDTA''' where all the LEC components are present, but free calcium in the cell is somehow constrained.<br />
* ''full light emission'' is the case of '''WT''' where all the components of the LEC are presents and calcium channels are fully open.<br />
<br><br />
===Voltage===<br />
<br><br />
Varying voltage and exciting time, we can have a variety of responses (arrows indicate electric current supply):<br />
<center><br />
{|<br />
|[[Image:1,5V 10s.jpg|center|450px]]<br />
|-<br />
|[[Image:4,5V 5s.jpg|center|450px]]<br />
|}<br />
</center><br />
<br />
===Supply time===<br />
<br><br />
Varying the electric current time supply we can study the influence of this variable in our system. Here we see that if we apply too much time the system is overdosed...<br />
<br />
[[Image:6V variats disc.jpg|500px|center]]<br />
<br />
===Repetition===<br />
<br><br />
Our idea was to have a screen, that is '''to have several images sequentially''', in order to see animated pictures. So we studied the different voltage times in a sequence of power applications to one LEC.<br />
[[Image:Manteniment resposta disc.jpg|center|600px]]<br />
<br />
===Refreshing rate===<br />
<br><br />
Finally, we were looking for the shortest refreshing rate as possible, so to have something close to a ''real'' screen.<br />
[[Image:24V 0,5s.jpg|center|500 px]]<br />
<br />
We have accomplished a refreshing rate of 12 seconds with a supply of 24V in 0,5 seconds.<br />
<br />
<br />
Again, if you find yourself hungry of knowledge, please find much more information on the aequorin and the study we have made upon it on the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Parts Characterization'''] page or on the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 '''Registry'''].</div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-22T00:26:43Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 5000px;<br />
}<br />
</style><br />
</html><br />
<br />
<br />
<div style="position:relative; margin-top:-295px; margin-left:190px; width:700px; font-family: Verdana;" align="justify"><br />
<br><br />
='''Experimental results'''=<br />
<br><br />
Our ultimate goal was to make a bio-screen made with cellular pixels (LECs). But, before to be able to build this iLCD, we had to study the behaviour of one single LEC. Therefore, we focused on the electrical excitation of our transformed yeasts.<br />
<br />
This is the behaviour that stands as the cornerstone of our project. '''With a serie of voltage inputs, we accomplished a series of light emissions'''. No exciting light was needed, only aequorin, coelenterazine (the prosthetic group) and Ca<sup>2+</sup>.<br />
<br />
[[Image:Valencia_Grafica_continu_2_pics.jpg|600 px|center]]<br />
<br />
Arrows indicate when voltage was applied: 16V during 5 seconds applied at 300 seconds (5 minutes) and 600 seconds (10 minutes).<br />
*'''WT''' indicates our LEC: our aequorin-engineered yeast, with coelenterazine and wild-type calcium channels<br />
*'''WT -coe''' indicates the same yeast, without the addition of coelenterazine.<br />
<br />
As we can observe, '''only our LEC is excited when electric current is applied'''. Withour coelenterazine there is no response to that stimulus.<br />
<br />
==Conclusions of the study==<br />
<br><br />
We have investigated a set of '''different voltages and times in order to precisely know how our system respons to electric current. Knowing this, we could control it properly. <br />
<br />
We will show and explain here the '''major results''', for a thorough description of the behaviour of the aequorin light emission system please refer to the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Characterization page'''] or to the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 '''Registry'''].<br />
<br><br />
===Controls===<br />
<br><br />
In every single experiment in a molecular biology laboratory, one has to bear in mind the use of negative controls for every logical step of the hypothesis.<br />
Therefore, we have taken advantage of the different experimental designs that were available: we had several calcium channel knock outs (''mid1'' and ''ch1''), as well as functional inhibitors of the calcium channels (KCl) and divalent ion quelant (EDTA).<br />
<br />
All these designs were used in order to reject the idea of looking to an artifact.<br />
[[Image:Comparació_disc.jpg|700 px|center]]<br />
<br />
This graph shows the behaviour of a set of designs after the supply of a 4V shock.<br />
<br />
* '''WT''' is our wild type luminiscent cell, with coelenterazine and fully working calcium channels<br />
<br />
* '''mid1''' is a knock out for a calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''cch1''' is another knock out mutant for a calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''' is a divalent ion quelant, so Ca2+ is quenched and not useful for the light emission, although every compound necessary for the reaction is present.<br />
<br />
* '''SD +coe''' is growth media with coelenterazine, just to be sure that without cells we had no light.<br />
<br />
* '''SD''' is plain growth media.<br />
<br />
* '''yeast -coe''' is our wild type luminiscent cell, without coelenterazine, the prosthetic group that is needed for the light emission.<br />
<br />
Three kinds of behaviour stem out of this experiment: no light at all, some light emission and full light emission.<br />
* ''no light at all'' is the case of '''SD +coe''','''SD''' and '''yeast -coe''' where there is a lack of at least one of the compnents of the LEC. <br />
* ''some light emission'' is the case of '''mid1''', '''cch1''' and '''EDTA''' where all the LEC components are present, but free calcium in the cell is somehow constrained.<br />
* ''full light emission'' is the case of '''WT''' where all the components of the LEC are presents and calcium channels are fully open.<br />
<br><br />
===Voltage===<br />
<br><br />
Varying voltage and exciting time, we can have a variety of responses (arrows indicate electric current supply):<br />
<center><br />
{|<br />
|[[Image:1,5V 10s.jpg|center|450px]]<br />
|-<br />
|[[Image:4,5V 5s.jpg|center|450px]]<br />
|}<br />
</center><br />
<br />
===Supply time===<br />
<br><br />
Varying the electric current time supply we can study the influence of this variable in our system. Here we see that if we apply too much time the system is overdosed...<br />
<br />
[[Image:6V variats disc.jpg|500px|center]]<br />
<br />
===Repetition===<br />
<br><br />
Our idea was to have a screen, that is '''to have several images sequentially''', in order to see animated pictures. So we studied the different voltage times in a sequence of power applications to one LEC.<br />
[[Image:Manteniment resposta disc.jpg|center|600px]]<br />
<br />
===Refreshing rate===<br />
<br><br />
Finally, we were looking for the shortest refreshing rate as possible, so to have something close to a ''real'' screen.<br />
[[Image:24V 0,5s.jpg|center|500 px]]<br />
<br />
We have accomplished a refreshing rate of 12 seconds with a supply of 24V in 0,5 seconds.<br />
<br />
<br />
Again, if you find yourself hungry of knowledge, please find much more information on the aequorin and the study we have made upon it on the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Parts Characterization'''] page or on the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 '''Registry'''].</div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ResultsTeam:Valencia/WetLab/YeastTeam/Results2009-10-22T00:26:18Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3000px;<br />
}<br />
</style><br />
</html><br />
<br />
<br />
<div style="position:relative; margin-top:-295px; margin-left:190px; width:700px; font-family: Verdana;" align="justify"><br />
<br><br />
='''Experimental results'''=<br />
<br><br />
Our ultimate goal was to make a bio-screen made with cellular pixels (LECs). But, before to be able to build this iLCD, we had to study the behaviour of one single LEC. Therefore, we focused on the electrical excitation of our transformed yeasts.<br />
<br />
This is the behaviour that stands as the cornerstone of our project. '''With a serie of voltage inputs, we accomplished a series of light emissions'''. No exciting light was needed, only aequorin, coelenterazine (the prosthetic group) and Ca<sup>2+</sup>.<br />
<br />
[[Image:Valencia_Grafica_continu_2_pics.jpg|600 px|center]]<br />
<br />
Arrows indicate when voltage was applied: 16V during 5 seconds applied at 300 seconds (5 minutes) and 600 seconds (10 minutes).<br />
*'''WT''' indicates our LEC: our aequorin-engineered yeast, with coelenterazine and wild-type calcium channels<br />
*'''WT -coe''' indicates the same yeast, without the addition of coelenterazine.<br />
<br />
As we can observe, '''only our LEC is excited when electric current is applied'''. Withour coelenterazine there is no response to that stimulus.<br />
<br />
==Conclusions of the study==<br />
<br><br />
We have investigated a set of '''different voltages and times in order to precisely know how our system respons to electric current. Knowing this, we could control it properly. <br />
<br />
We will show and explain here the '''major results''', for a thorough description of the behaviour of the aequorin light emission system please refer to the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Characterization page'''] or to the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K222000 '''Registry'''].<br />
<br><br />
===Controls===<br />
<br><br />
In every single experiment in a molecular biology laboratory, one has to bear in mind the use of negative controls for every logical step of the hypothesis.<br />
Therefore, we have taken advantage of the different experimental designs that were available: we had several calcium channel knock outs (''mid1'' and ''ch1''), as well as functional inhibitors of the calcium channels (KCl) and divalent ion quelant (EDTA).<br />
<br />
All these designs were used in order to reject the idea of looking to an artifact.<br />
[[Image:Comparació_disc.jpg|700 px|center]]<br />
<br />
This graph shows the behaviour of a set of designs after the supply of a 4V shock.<br />
<br />
* '''WT''' is our wild type luminiscent cell, with coelenterazine and fully working calcium channels<br />
<br />
* '''mid1''' is a knock out for a calcium channel. Light is not observed because Ca2+ can’t enter into the cell and bind to the aequorin-coelenterazine complex.<br />
<br />
* '''cch1''' is another knock out mutant for a calcium channel, so the absence of light can be explainned in the same way.<br />
<br />
* '''EDTA''' is a divalent ion quelant, so Ca2+ is quenched and not useful for the light emission, although every compound necessary for the reaction is present.<br />
<br />
* '''SD +coe''' is growth media with coelenterazine, just to be sure that without cells we had no light.<br />
<br />
* '''SD''' is plain growth media.<br />
<br />
* '''yeast -coe''' is our wild type luminiscent cell, without coelenterazine, the prosthetic group that is needed for the light emission.<br />
<br />
Three kinds of behaviour stem out of this experiment: no light at all, some light emission and full light emission.<br />
* ''no light at all'' is the case of '''SD +coe''','''SD''' and '''yeast -coe''' where there is a lack of at least one of the compnents of the LEC. <br />
* ''some light emission'' is the case of '''mid1''', '''cch1''' and '''EDTA''' where all the LEC components are present, but free calcium in the cell is somehow constrained.<br />
* ''full light emission'' is the case of '''WT''' where all the components of the LEC are presents and calcium channels are fully open.<br />
<br><br />
===Voltage===<br />
<br><br />
Varying voltage and exciting time, we can have a variety of responses (arrows indicate electric current supply):<br />
<center><br />
{|<br />
|[[Image:1,5V 10s.jpg|center|450px]]<br />
|-<br />
|[[Image:4,5V 5s.jpg|center|450px]]<br />
|}<br />
</center><br />
<br />
===Supply time===<br />
<br><br />
Varying the electric current time supply we can study the influence of this variable in our system. Here we see that if we apply too much time the system is overdosed...<br />
<br />
[[Image:6V variats disc.jpg|500px|center]]<br />
<br />
===Repetition===<br />
<br><br />
Our idea was to have a screen, that is '''to have several images sequentially''', in order to see animated pictures. So we studied the different voltage times in a sequence of power applications to one LEC.<br />
[[Image:Manteniment resposta disc.jpg|center|600px]]<br />
<br />
===Refreshing rate===<br />
<br><br />
Finally, we were looking for the shortest refreshing rate as possible, so to have something close to a ''real'' screen.<br />
[[Image:24V 0,5s.jpg|center|500 px]]<br />
<br />
We have accomplished a refreshing rate of 12 seconds with a supply of 24V in 0,5 seconds.<br />
<br />
<br />
Again, if you find yourself hungry of knowledge, please find much more information on the aequorin and the study we have made upon it on the [https://2009.igem.org/Team:Valencia/Parts/Characterization '''Parts Characterization'''] page or on the [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Valencia&Done=1 '''Registry'''].</div>Emiliohttp://2009.igem.org/Team:Valencia/Project/ResultsTeam:Valencia/Project/Results2009-10-21T23:58:03Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<br><br><br><br><br><br />
<br />
<div align="justify" style="position:relative; margin-top:-350px; width:700px; margin-left:200px; font-size:10pt; font-family:Verdana;"><br />
=='''Achievements'''==<br />
[[Image:V_PantaNino.gif|400px|center]]<br />
<br />
We have:<br><br />
<ol><li>We advanced Bioelectronics enabling bidirectional communication of monocellular organisms and electronic components.<br><br></li><br />
<li>Built a fast and responsive 'digital imaging' system based on living cells.<br><br></li><br />
<li>Characterized a new part: [https://2009.igem.org/Team:Valencia/Parts/Characterization ''BBa_K222000 (Aequorin)''].<br><br></li><br />
<li>We have developed an [https://2009.igem.org/Team:Valencia/Hardware experimental system] which is able to apply a precise voltage (between 0V-24V) during a precise interval of time (with a precision up to 20 ms.) controlled by a computer. The [https://2009.igem.org/Team:Valencia/Hardware experimental device] was integrated with a continuous luminometer in order to measure the light emission as a function of these parameters.<br><br></li><br />
<li>Developped an impressive [https://2009.igem.org/Team:Valencia/Human Human Practices] part of the project. Resulting in the publication of the book [https://2009.igem.org/Team:Valencia/Human Sins, Ethics and Biology]<br><br></li><br />
<li>Helped TUDelft and NTU-Singapore whith their respectives surveys. We have also helped to Paris Team answering their questions about their iPhone application<br><br></li><br />
<br />
</ol><br />
</div><br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/Project/ResultsTeam:Valencia/Project/Results2009-10-21T23:57:15Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<br><br><br><br><br><br />
<br />
<div align="justify" style="position:relative; margin-top:-350px; width:700px; margin-left:200px; font-size:10pt; font-family:Verdana;"><br />
=='''Achievements'''==<br />
[[Image:V_PantaNino.gif|400px|center]]<br />
<br />
We have:<br><br />
<ol><li>We advanced Bioelectronics enabling bidirectional communication of monocellular organisms and electronic components.<br><br></li><br />
<li>Built a fast and responsive 'digital imaging' system based on living cells.<br><br></li><br />
<li>Characterized a new part: [https://2009.igem.org/Team:Valencia/Parts/Characterization ''BBa_K222000 (Aequorin)''].<br><br></li><br />
<li>We have developed an experimental system which is able to apply a precise voltage (between 0V-24V) during a precise interval of time (with a precision up to 20 ms.) controlled by a computer (https://2009.igem.org/Team:Valencia/Hardware). The [https://2009.igem.org/Team:Valencia/Hardware experimental device] was integrated with a continuous luminometer in order to measure the light emission as a function of these parameters.<br><br></li><br />
<li>Developped an impressive [https://2009.igem.org/Team:Valencia/Human Human Practices] part of the project. Resulting in the publication of the book [https://2009.igem.org/Team:Valencia/Human Sins, Ethics and Biology]<br><br></li><br />
<li>Helped TUDelft and NTU-Singapore whith their respectives surveys. We have also helped to Paris Team answering their questions about their iPhone application<br><br></li><br />
<br />
</ol><br />
</div><br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/Project/ResultsTeam:Valencia/Project/Results2009-10-21T23:43:26Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<br />
<br><br><br><br><br><br />
<br />
<div align="justify" style="position:relative; margin-top:-350px; width:700px; margin-left:200px; font-size:10pt; font-family:Verdana;"><br />
=='''Achievements'''==<br />
[[Image:V_PantaNino.gif|400px|center]]<br />
<br />
We have:<br><br />
<ol><li>We advanced Bioelectronics enabling bidirectional communication of monocellular organisms and electronic components.<br><br></li><br />
<li>Built a fast and responsive 'digital imaging' system based on living cells.<br><br></li><br />
<li>Characterized a new part: [https://2009.igem.org/Team:Valencia/Parts/Characterization ''BBa_K222000 (Aequorin)''].<br><br></li><br />
<li>Built a home-made yet professionally accurate [https://2009.igem.org/Team:Valencia/Hardware system to control] cells behaviour through electrical stimuli.<br><br></li><br />
<li>Developped an impressive [https://2009.igem.org/Team:Valencia/Human Human Practices] part of the project. Resulting in the publication of the book [https://2009.igem.org/Team:Valencia/Human Sins, Ethics and Biology]<br><br></li><br />
<li>Helped TUDelft and NTU-Singapore whith their respectives surveys. We have also helped to Paris Team answering their questions about their iPhone application<br><br></li><br />
<br />
</ol><br />
</div><br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:32:53Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 2200px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-260px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
'''Other appaerances in press'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''Videochat'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
'''At TV'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ExperimentalTeam:Valencia/WetLab/YeastTeam/Experimental2009-10-21T23:31:53Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 8150px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<br />
<div align="justify" style="position:relative; top:-250px; margin-left:190px; width:700px; font-size:10pt; font-family: Verdana;"><br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<center> <br />
__NOTOC__<br />
{| <br />
!Methods<br />
!Protocols<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#GELDOC|GelDoc]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Measurement of citoplasmic Ca2+ increase in S. cerevisiae|Citoplasmic Ca<sup>2+</sup> burst]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#PIPPETE ENLARGER|Pippete Enlarger]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing inserts by PCR|BioBrick PCR protocol]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROPHOTOMETER|Spectrophotometer]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing vectors|Preparing vectors]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROFLUORIMETER|Spectrofluorimeter]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Ligating BioBricks into plasmids|Ligation]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#LUMINOMETER|Luminometer]]<br />
|-<br />
|width="200px"| <br />
|width="200px"| <br />
|}<br />
</center><br><br />
=='''Experimental methods'''==<br />
<br />
<br><br />
To make measurements properly and determinate luminiscence levels, we needed a luminometer. But we couldn’t use one before September. So, if we didn’t want to waste our limited time, we decided to try with other machines.<br />
<br />
This way, we had dt ideas, and we thought a GelDoc camera, an espectophotometer and a espectofluorimeter could be useful for us, at least to determinate the presence/absence of the luminiscence. <br />
<br />
===GELDOC===<br />
<br />
[[Image:Igem2b.JPG|center|400 px|]]<br />
<br><br />
<br />
<br />
That was the first idea we got. It consisted to try to capture the luminiscence produced by our yeast with the camera that is normaly used to take gel photos. We thought that if we increased exposure time, we could acumulate enough luminiscence produced in time to see it, at the photo. <br />
<br />
We put our yeast after the different steps of our protocol in a multi-hole plaque and add the alcaline input. Fastly, we used to close the GelDoc door, but we had doubts about the velocity of the response, and we couldn’t be inside the GelDoc to start the measure at the same time we make the input. In order to make sure our yeasts weren’t making light too fast, we designed a very simple but precise mechanism. We called it PippeteEnlarger.<br />
<br><br />
<br />
===PIPPETE ENLARGER===<br />
<br />
[[Image:Igem1.JPG|thumb|center|500 px|]]<br />
<br />
The Pippete Enlarger is easy to assemble using a pippete, a thin tube and two pippete tips: one has to fit into the tub (so size tip deppends on size tub) and the another one has to be the proper tip to take the volume we want.<br />
<br />
So, we will explain the mechanisme in the way we did it. We needed to make an input of 30 microliters of KOH without open the door. We had to enlarge the pippete to put the tip in the correct hole with the closed door and trigger the mechanism out of the GelDoc. We decided to full the tube with KOH, make pressure in one of the extrems of the tube, preventing by capilarity the liquid go away, and connect the pippete with an intermediary tip in the other extrem (the volume had to be already prefixed). The extrem we were pressing could be released at this point, so we could put the correct tip (in our chase, a yellow tip) to catch the desired volume. Before to be loaded with 30 microliters of KOH, we fixed the tip in the hole we wanted, we closed the door and carry on the pippete outside the GelDoc.<br />
<br />
We were ready to start the measurement, making sure we increased enough the exposure time. Then, we pulled out the 30 microlitres actioning the pippete. It was surprisingly acurate!!! The volume was almost exactly, with 1 or 2 microliters of error. We dind’t got any result.<br />
We could rule out, then, the possibility that our yeasts produce light meanwhile we were putting them in the GelDoc, or we were closing the door...<br />
<br />
GelDoc camera was not an efficient way to detect our luminiscence, so we thought perhaps a spectrophotometer was a more addient machine.<br />
<br />
===SPECTROPHOTOMETER===<br />
<br />
[[Image:Igem19.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem8.JPG|thumb|left|315 px|]]<br />
<br />
Altough an spectophotometer is a machine that measures how cloudy a sample is, by emitting a ray of light, we can “trick” the machine. Sticking a piece of silver paper in one of the faces of the little tank, we prevent the ray of light cross the sample. The idea is to measure only the light produced by the sample, not the “crossing light”.<br />
<br />
We didn’t obtain any result, but that was probably because the spectrophotometer has been designed to detect a very located light ray, not a difused light produced by a bioluminiscent sample.<br />
<br />
===SPECTROFLUORIMETER===<br />
<br />
<br />
[[Image:Igem9.JPG|thumb|center|500 px|]]<br />
<br />
[[Image:MedidafluorimetroVII.jpg|thumb|right|315 px|]]<br />
<br />
[[Image:MedidafluorimetroVI.jpg|thumb|left|315 px|]]<br />
<br />
[[Image:Igem13.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem17.JPG|thumb|left|315 px|]]<br />
<br />
Spectrofluorimeter measures the fluorescence of a sample. That’s because it has the same problem of the spectrophotometer. However, we found that it’s more sensible (it detects a great quantity of noise). So we thought it could be a more proper machine to our purposes.<br />
<br />
We designed a similar experiment, covering the place where the ray of light is emited, in order to measure only the bioluminiscence produced by our yeasts.<br />
<br />
We didn’t obtain any result. But we were worried about the speed of the reaction another time. Then, we decided to rule out the possibility as we did it with the GelDoc: starting the measure before adding the alkaline input.<br />
But this machine was different, so we designed a different experiment.<br />
<br />
We found a hole (normaly closed) in the tap, just uppon the the place where the sample is. Using a piece of termaflex, we crossed it with the pippete, and put it in the hole, isolating the overture and preventing light got in and artefact our result. Another time, that was extremely acurate, and when we closed the door, the tip went exactly to the point where our sample was placed.<br />
This way, we started to measure before adding the input. Next, we pulled out hte 30 microliters of KOH in the little tank. We got depressed when we didn’t obtain results. But for this time, we were in September, and the luminometer was available for us.<br />
<br />
In some days, our hard work was going to give us nice surprises.<br><br><br />
<br />
===LUMINOMETER===<br />
<br><br />
At last, we found a luminometer at Instituto de química molecular aplicada at UPV. Luminometers are more sensible and have more precision than espectrophotometer and espectrofluorimeter. Luminometer is ideal to work with aequorin, but was difficult to us to find one (we were looking for one and found two ^^).<br />
<br />
There are two types of luminometers: continuous and discontinuous. The discontinuous make punctual measures, in our case every 30 seconds. The continuous measures continuously, every second. Is important to note that we use two different luminometer, provided by different manufacturers. For this reasons we can't compare directly the results obtained with one luminometer with the results of the other. According this, we only compare results in the same graph if they were obtained with the same luminometer. However, an increase (or not) in the luminosity, means the same at two luminometers and the experiments are complementary and reaffirms our conclusions. <br />
<br />
Each luminometer has its own protocol.<br />
<br />
First, we work with a discontinous luminometer. It measures every 30 seconds. We make a lot of measurements, trying to optimize the electrical input with the light generation. It's connected to a computer, where we see the value of luminescence. To measure luminescence, luminometer have a Elisa plate, where we put our yeasts. After, we introduce the Elisa plate into luminometer and click Start on computer. After 15 seconds we have the measure of luminosity.<br />
<br />
After, in the same department, we used a continuous luminometer. This is better because measures instantly, every second and the results obtained are more reliable. With this two luminometer we make the caracterization of ''Aequorin'' and obtained the results that demonstrate that we were right. WE CAN CREATE A CELL-BASED BIOSCREEN. Continuous luminometer have a cuvette where we put the cells. The cuvette must be very closed. We devise a system to applicate the electrical stimulus when the cuvette is closed. This luminometer also have a computer, but it was very old!<br />
<br />
[[Image:HiTech! val.jpg|center|315 px]]<br />
<br />
<br />
With the discontinuous luminometer, we couldn't measure live, so we didn't desinged any kind of natural-light-protector for the sample while we were measuring.<br />
<br />
[[Image:Valencia_luminometer.JPG|left|300 px]]However, in order to make measurements with the continuous luminometer, we needed to prevent light entering inside the machine, as in all the other cases, just at the moment of the input. In that particular device, we had to be extremely accurate: our continuous luminometer is very sensitive and natural light disables it when the sensor gets too dilated. When that happens, the luminometer needs about a week to return to its proper state.<br />
We built a structure similar to a protective helmet made of termaflex, with a little hole where the cables cross it, and put that construction on the top of the measurement point, where our sample must be placed. Any entrance of light was prevented and we measured luminiscence without problems<br />
<br><br><br><br><br><br><br><br />
==Protocols==<br />
===Measurement of citoplasmic Ca<sup>2+</sup> increase in <i>S. cerevisiae</i>===<br />
<br />
<br />
Modified from the original Denis and Cyert (2002) JCB 156; 29-34. <br />
<br />
'''Material'''<br />
* pEVP11[AEQ] plasmid: apoaequorina expression (Batiza et al.(1996) J.Biol.Chem. 271: 23357-62). <br />
* Coelenterazine solution: Diluted coelenterazine until 590μM in satured N2 metanol. This compound is extremely photosensible and it's inhibited by O<sup>2</sup>. Kept at –20ºC. <br />
** Note: We bought Coelenterazine, Native (CLZn) 50 μg Ref. C-2230 de SIGMA. We put N2 gas into metanol during 5 minutes, and we added inmediately 200μL to the 50μg of coelenterazine. <br />
<br />
* Luminometer. <br />
* Luminometer tubes and ELISA plaques. <br />
<br />
'''Procedure'''<br />
# We recieved pEVP11[AEQ] aequorin transformed yeast from Joaquin Arinyo. <br />
# We let growing up o/n in SD lacking Leu medium to maintain plasmid expression. <br />
# After incubation, measure OD a 660nm y calculate the necessary volum to obtain in 250μL a final OD of 1,8. Put that volum into an eppendorf tube with a hole in its tap. <br />
# Centrifugate 1 minute at 13000rpm. <br />
# Discard the supernatant. <br />
# Resuspend the pellet into 250μL of fresh medium with coelenterazine 2μM (aprox. 3,5μL of coelenterazinestock solution / μL de medio). <br />
# Incubate during 5,5 horas at ambient temperature, in agitation and keeping in the darkness. <br />
# Centrifugate 1 minute at 13000rpm. Discard the supernatant and resuspend in SD lacking Leu fresh medium without coelenterazine (see the proper volum below *). <br />
# Wait 15 min (yeast luminiscence is increased due to a peak of Ca2+ is induced by the glucose (Nakajimashimada et al. (1991) PNAS 88; 6878-82). <br />
# Measure basal luminiscence during 15 minutes. <br />
# Add the correct reactive volum to induce luminiscence. <br />
<br />
In the case of alcaline induction: <br />
<br />
8. Add 170μL of medium. <br />
<br />
9. Add 30μL of KOH 100mM. <br />
<br />
Other stress types: <br />
<br />
*NaCl: 30μL NaCl 5M (0,75M final). <br />
*CaCl<sub>2</sub>: 30μL CaCl<sub>2</sub> 1.33M (200mM final). <br />
*KCl: 30μL KCl 100mM. <br />
<br />
Note: yeasts should be treated sequentialy and in the same way to obtain reproducible results.<br />
<br />
===Preparing inserts by PCR=== <br />
<br />
Total DNA was extracted from our yeast strains.<br><br />
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br><br />
<br />
And our oligos (EcoRI and XbaI sites in bold) were:<br><br />
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br><br />
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br><br />
<br />
<br />
PCR was conducted as follows:<br><br />
<br />
<ol>A first denaturation cycle<br />
<br />
<ol>94º 3min</ol><br />
<br />
Followed by 30 amplification cycles: <br />
<br />
<ol>94º 30s<br><br />
<br />
55º 1min<br><br />
<br />
72º 1min<br></ol><br />
<br />
And a final extension step:<br />
<br />
<ol>72º 7min</ol><br />
<br />
<br />
<br />
[[Image:Gelaeq.JPG]]<br />
<br />
Results:<br><br />
<br />
1 = wt (1 microlitre)<br><br />
2 = wt (2 microlitres)<br><br />
3 = Cch1 (1 microlitre)<br><br />
4 = Mid1 (1 microlitre)<br><br />
5 = Negative Control<br><br />
6 = Possitive Control<br><br />
(We used the same MWM)<br><br />
<br />
Amplicon has 600 pb's.<br />
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> <br />
<br />
Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br><br />
<br />
===Preparing vectors===<br />
<br />
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL10-Gold Ultracompetent Cells of Stratagene. We selected transformed cells in a LB + ampicillin medium plaques. <br><br />
<br />
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br><br />
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br><br />
<br />
===Ligating BioBricks into plasmids===<br />
<br />
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br><br />
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br><br />
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br><br />
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br></div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeam/ExperimentalTeam:Valencia/WetLab/YeastTeam/Experimental2009-10-21T23:31:38Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 8250px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<br />
<div align="justify" style="position:relative; top:-250px; margin-left:190px; width:700px; font-size:10pt; font-family: Verdana;"><br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<center> <br />
__NOTOC__<br />
{| <br />
!Methods<br />
!Protocols<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#GELDOC|GelDoc]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Measurement of citoplasmic Ca2+ increase in S. cerevisiae|Citoplasmic Ca<sup>2+</sup> burst]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#PIPPETE ENLARGER|Pippete Enlarger]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing inserts by PCR|BioBrick PCR protocol]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROPHOTOMETER|Spectrophotometer]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Preparing vectors|Preparing vectors]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#SPECTROFLUORIMETER|Spectrofluorimeter]]<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#Ligating BioBricks into plasmids|Ligation]]<br />
|-<br />
|align="left"|[[Team:Valencia/WetLab/YeastTeam/Experimental#LUMINOMETER|Luminometer]]<br />
|-<br />
|width="200px"| <br />
|width="200px"| <br />
|}<br />
</center><br><br />
=='''Experimental methods'''==<br />
<br />
<br><br />
To make measurements properly and determinate luminiscence levels, we needed a luminometer. But we couldn’t use one before September. So, if we didn’t want to waste our limited time, we decided to try with other machines.<br />
<br />
This way, we had dt ideas, and we thought a GelDoc camera, an espectophotometer and a espectofluorimeter could be useful for us, at least to determinate the presence/absence of the luminiscence. <br />
<br />
===GELDOC===<br />
<br />
[[Image:Igem2b.JPG|center|400 px|]]<br />
<br><br />
<br />
<br />
That was the first idea we got. It consisted to try to capture the luminiscence produced by our yeast with the camera that is normaly used to take gel photos. We thought that if we increased exposure time, we could acumulate enough luminiscence produced in time to see it, at the photo. <br />
<br />
We put our yeast after the different steps of our protocol in a multi-hole plaque and add the alcaline input. Fastly, we used to close the GelDoc door, but we had doubts about the velocity of the response, and we couldn’t be inside the GelDoc to start the measure at the same time we make the input. In order to make sure our yeasts weren’t making light too fast, we designed a very simple but precise mechanism. We called it PippeteEnlarger.<br />
<br><br />
<br />
===PIPPETE ENLARGER===<br />
<br />
[[Image:Igem1.JPG|thumb|center|500 px|]]<br />
<br />
The Pippete Enlarger is easy to assemble using a pippete, a thin tube and two pippete tips: one has to fit into the tub (so size tip deppends on size tub) and the another one has to be the proper tip to take the volume we want.<br />
<br />
So, we will explain the mechanisme in the way we did it. We needed to make an input of 30 microliters of KOH without open the door. We had to enlarge the pippete to put the tip in the correct hole with the closed door and trigger the mechanism out of the GelDoc. We decided to full the tube with KOH, make pressure in one of the extrems of the tube, preventing by capilarity the liquid go away, and connect the pippete with an intermediary tip in the other extrem (the volume had to be already prefixed). The extrem we were pressing could be released at this point, so we could put the correct tip (in our chase, a yellow tip) to catch the desired volume. Before to be loaded with 30 microliters of KOH, we fixed the tip in the hole we wanted, we closed the door and carry on the pippete outside the GelDoc.<br />
<br />
We were ready to start the measurement, making sure we increased enough the exposure time. Then, we pulled out the 30 microlitres actioning the pippete. It was surprisingly acurate!!! The volume was almost exactly, with 1 or 2 microliters of error. We dind’t got any result.<br />
We could rule out, then, the possibility that our yeasts produce light meanwhile we were putting them in the GelDoc, or we were closing the door...<br />
<br />
GelDoc camera was not an efficient way to detect our luminiscence, so we thought perhaps a spectrophotometer was a more addient machine.<br />
<br />
===SPECTROPHOTOMETER===<br />
<br />
[[Image:Igem19.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem8.JPG|thumb|left|315 px|]]<br />
<br />
Altough an spectophotometer is a machine that measures how cloudy a sample is, by emitting a ray of light, we can “trick” the machine. Sticking a piece of silver paper in one of the faces of the little tank, we prevent the ray of light cross the sample. The idea is to measure only the light produced by the sample, not the “crossing light”.<br />
<br />
We didn’t obtain any result, but that was probably because the spectrophotometer has been designed to detect a very located light ray, not a difused light produced by a bioluminiscent sample.<br />
<br />
===SPECTROFLUORIMETER===<br />
<br />
<br />
[[Image:Igem9.JPG|thumb|center|500 px|]]<br />
<br />
[[Image:MedidafluorimetroVII.jpg|thumb|right|315 px|]]<br />
<br />
[[Image:MedidafluorimetroVI.jpg|thumb|left|315 px|]]<br />
<br />
[[Image:Igem13.JPG|thumb|right|315 px|]]<br />
<br />
[[Image:Igem17.JPG|thumb|left|315 px|]]<br />
<br />
Spectrofluorimeter measures the fluorescence of a sample. That’s because it has the same problem of the spectrophotometer. However, we found that it’s more sensible (it detects a great quantity of noise). So we thought it could be a more proper machine to our purposes.<br />
<br />
We designed a similar experiment, covering the place where the ray of light is emited, in order to measure only the bioluminiscence produced by our yeasts.<br />
<br />
We didn’t obtain any result. But we were worried about the speed of the reaction another time. Then, we decided to rule out the possibility as we did it with the GelDoc: starting the measure before adding the alkaline input.<br />
But this machine was different, so we designed a different experiment.<br />
<br />
We found a hole (normaly closed) in the tap, just uppon the the place where the sample is. Using a piece of termaflex, we crossed it with the pippete, and put it in the hole, isolating the overture and preventing light got in and artefact our result. Another time, that was extremely acurate, and when we closed the door, the tip went exactly to the point where our sample was placed.<br />
This way, we started to measure before adding the input. Next, we pulled out hte 30 microliters of KOH in the little tank. We got depressed when we didn’t obtain results. But for this time, we were in September, and the luminometer was available for us.<br />
<br />
In some days, our hard work was going to give us nice surprises.<br><br><br />
<br />
===LUMINOMETER===<br />
<br><br />
At last, we found a luminometer at Instituto de química molecular aplicada at UPV. Luminometers are more sensible and have more precision than espectrophotometer and espectrofluorimeter. Luminometer is ideal to work with aequorin, but was difficult to us to find one (we were looking for one and found two ^^).<br />
<br />
There are two types of luminometers: continuous and discontinuous. The discontinuous make punctual measures, in our case every 30 seconds. The continuous measures continuously, every second. Is important to note that we use two different luminometer, provided by different manufacturers. For this reasons we can't compare directly the results obtained with one luminometer with the results of the other. According this, we only compare results in the same graph if they were obtained with the same luminometer. However, an increase (or not) in the luminosity, means the same at two luminometers and the experiments are complementary and reaffirms our conclusions. <br />
<br />
Each luminometer has its own protocol.<br />
<br />
First, we work with a discontinous luminometer. It measures every 30 seconds. We make a lot of measurements, trying to optimize the electrical input with the light generation. It's connected to a computer, where we see the value of luminescence. To measure luminescence, luminometer have a Elisa plate, where we put our yeasts. After, we introduce the Elisa plate into luminometer and click Start on computer. After 15 seconds we have the measure of luminosity.<br />
<br />
After, in the same department, we used a continuous luminometer. This is better because measures instantly, every second and the results obtained are more reliable. With this two luminometer we make the caracterization of ''Aequorin'' and obtained the results that demonstrate that we were right. WE CAN CREATE A CELL-BASED BIOSCREEN. Continuous luminometer have a cuvette where we put the cells. The cuvette must be very closed. We devise a system to applicate the electrical stimulus when the cuvette is closed. This luminometer also have a computer, but it was very old!<br />
<br />
[[Image:HiTech! val.jpg|center|315 px]]<br />
<br />
<br />
With the discontinuous luminometer, we couldn't measure live, so we didn't desinged any kind of natural-light-protector for the sample while we were measuring.<br />
<br />
[[Image:Valencia_luminometer.JPG|left|300 px]]However, in order to make measurements with the continuous luminometer, we needed to prevent light entering inside the machine, as in all the other cases, just at the moment of the input. In that particular device, we had to be extremely accurate: our continuous luminometer is very sensitive and natural light disables it when the sensor gets too dilated. When that happens, the luminometer needs about a week to return to its proper state.<br />
We built a structure similar to a protective helmet made of termaflex, with a little hole where the cables cross it, and put that construction on the top of the measurement point, where our sample must be placed. Any entrance of light was prevented and we measured luminiscence without problems<br />
<br><br><br><br><br><br><br><br />
==Protocols==<br />
===Measurement of citoplasmic Ca<sup>2+</sup> increase in <i>S. cerevisiae</i>===<br />
<br />
<br />
Modified from the original Denis and Cyert (2002) JCB 156; 29-34. <br />
<br />
'''Material'''<br />
* pEVP11[AEQ] plasmid: apoaequorina expression (Batiza et al.(1996) J.Biol.Chem. 271: 23357-62). <br />
* Coelenterazine solution: Diluted coelenterazine until 590μM in satured N2 metanol. This compound is extremely photosensible and it's inhibited by O<sup>2</sup>. Kept at –20ºC. <br />
** Note: We bought Coelenterazine, Native (CLZn) 50 μg Ref. C-2230 de SIGMA. We put N2 gas into metanol during 5 minutes, and we added inmediately 200μL to the 50μg of coelenterazine. <br />
<br />
* Luminometer. <br />
* Luminometer tubes and ELISA plaques. <br />
<br />
'''Procedure'''<br />
# We recieved pEVP11[AEQ] aequorin transformed yeast from Joaquin Arinyo. <br />
# We let growing up o/n in SD lacking Leu medium to maintain plasmid expression. <br />
# After incubation, measure OD a 660nm y calculate the necessary volum to obtain in 250μL a final OD of 1,8. Put that volum into an eppendorf tube with a hole in its tap. <br />
# Centrifugate 1 minute at 13000rpm. <br />
# Discard the supernatant. <br />
# Resuspend the pellet into 250μL of fresh medium with coelenterazine 2μM (aprox. 3,5μL of coelenterazinestock solution / μL de medio). <br />
# Incubate during 5,5 horas at ambient temperature, in agitation and keeping in the darkness. <br />
# Centrifugate 1 minute at 13000rpm. Discard the supernatant and resuspend in SD lacking Leu fresh medium without coelenterazine (see the proper volum below *). <br />
# Wait 15 min (yeast luminiscence is increased due to a peak of Ca2+ is induced by the glucose (Nakajimashimada et al. (1991) PNAS 88; 6878-82). <br />
# Measure basal luminiscence during 15 minutes. <br />
# Add the correct reactive volum to induce luminiscence. <br />
<br />
In the case of alcaline induction: <br />
<br />
8. Add 170μL of medium. <br />
<br />
9. Add 30μL of KOH 100mM. <br />
<br />
Other stress types: <br />
<br />
*NaCl: 30μL NaCl 5M (0,75M final). <br />
*CaCl<sub>2</sub>: 30μL CaCl<sub>2</sub> 1.33M (200mM final). <br />
*KCl: 30μL KCl 100mM. <br />
<br />
Note: yeasts should be treated sequentialy and in the same way to obtain reproducible results.<br />
<br />
===Preparing inserts by PCR=== <br />
<br />
Total DNA was extracted from our yeast strains.<br><br />
AEQ was amplified by PCR using oligonucleotides matching the sequence and bearing the appropriate Biobrick prefix and suffix.<br><br />
<br />
And our oligos (EcoRI and XbaI sites in bold) were:<br><br />
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’<br><br />
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’<br><br />
<br />
<br />
PCR was conducted as follows:<br><br />
<br />
<ol>A first denaturation cycle<br />
<br />
<ol>94º 3min</ol><br />
<br />
Followed by 30 amplification cycles: <br />
<br />
<ol>94º 30s<br><br />
<br />
55º 1min<br><br />
<br />
72º 1min<br></ol><br />
<br />
And a final extension step:<br />
<br />
<ol>72º 7min</ol><br />
<br />
<br />
<br />
[[Image:Gelaeq.JPG]]<br />
<br />
Results:<br><br />
<br />
1 = wt (1 microlitre)<br><br />
2 = wt (2 microlitres)<br><br />
3 = Cch1 (1 microlitre)<br><br />
4 = Mid1 (1 microlitre)<br><br />
5 = Negative Control<br><br />
6 = Possitive Control<br><br />
(We used the same MWM)<br><br />
<br />
Amplicon has 600 pb's.<br />
We used wt 1 microlitre of PCR amplification product (career 1) to build the AEQ BioBrick.<br> <br />
<br />
Firstly, we purified the DNA from the agarosa (High Pure PCR Product Purification Kit, Roche). Later, amplicons were digested (H buffer) with EcoRI y XbaI.<br><br />
<br />
===Preparing vectors===<br />
<br />
Competent cells were transformed with pSB1A3 with the J04450 insert (present in the kit plate 1, hole 1K from the 2009 plasmid backbone distribution kit). We used the transformation protocol of XL10-Gold Ultracompetent Cells of Stratagene. We selected transformed cells in a LB + ampicillin medium plaques. <br><br />
<br />
The following day, we selected red colonies, those that had the plasmid, and plasmids were extracted with the High pure miniprep plasmid isolation kit (ROCHE) <br><br />
Plasmid were digested with EcoRI and XbaI, in the same way we digested PCR result.<br><br />
<br />
===Ligating BioBricks into plasmids===<br />
<br />
Both plasmids and inserts were run into 0.8% 0.5X TBE agarose gels and DNA bands excised with a clean scalpel. DNA was extracted from agarose blocks (ultra clean gel spin, DNA purification Kit, MO BIO laboratories).<br><br />
T4 Ligase was used to ligate inserts and vectors for 1 h at room temperature (2X quick buffer was used).<br><br />
Competent cells were transformed and resulting colonies (Amp LB) screened with Fw and Rv primers to confirm the presence of inserts. <br><br />
pSB1AK3 containing UCP-1, 175-deleted and 76-deleted were sent to the Registry <br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:30:34Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 2200px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-250px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
'''Other appaerances in press'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''Videochat'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
'''At TV'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:25:50Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
'''Other appaerances in press'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''Videochat'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
'''At TV'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:23:28Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
'''Other links'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''Videochat'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
'''At TV'''<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:21:14Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
=='''Link'''==<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
=='''Videochat'''==<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
=='''At TV'''==<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:20:02Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:20pt; font-family: Verdana"><br />
<br />
<br />
=='''Link'''==<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''<u>Videochat</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
'''<u>At TV</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:19:30Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:20pt; font-family: Verdana"><br />
<br />
<br />
'''<u>LINKS</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''<u>Videochat</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
'''<u>At TV</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:17:29Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:20pt; font-family: Verdana"><br />
<br />
<br />
'''<u>LINKS</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''<u>VIDEOCHAT</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
'''<u>AT TV :D</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:16:54Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''In The Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
Angeles is behind the culture!!!<br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:20pt; font-family: Verdana"><br />
<br />
<br />
'''<u>LINKS</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''<u>VIDEOCHAT</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
'''<u>AT TV :D</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/NewsTeam:Valencia/News2009-10-21T23:16:34Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 3550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; top:-270px; margin-left:190px; width:700px; color:black; font-size:10pt; font-family: Verdana"><br />
<br />
<br />
<br />
== '''IN THE Media''' ==<br />
<br> <br />
<br />
[[Image:Sic prensa.jpg|600px]]<br />
<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
Angeles is behind the culture!!!<br />
<br />
<br />
[[Image:Press1.jpg|600px]]<br />
<br />
<br />
<span style="color:black; align:justify; font-size:20pt; font-family: Verdana"><br />
<br />
<br />
'''<u>LINKS</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.neoteo.com/televisores-hechos-con-celulas-16191.neo<br />
<br />
http://noticias.terra.es/local/2009/0603/actualidad/estudiantes-valencianos-de-la-upv-y-la-uv-crearan-una-pantalla-de-television-a-partir-de-celulas.aspx<br />
<br />
http://www.adn.es/local/valencia/20090603/NWS-0423-Estudiantes-valencianos-television-pantalla-crearan.html<br />
<br />
http://www.elmundo.es/elmundo/2009/06/03/television/1244024480.html<br />
<br />
http://www.lasprovincias.es/valencia/20090603/mas-actualidad/tecnologia/estudiantes-crearan-pantalla-television-200906031148.html<br />
<br />
http://www.levante-emv.com/secciones/noticia.jsp?pRef=2009060300_40_597302__Tecnologia-Estudiantes-valencianos-crearan-pantalla-television-partir-celulas<br />
<br />
http://www.dailynews.rs/news/2009/08/valencia-students-used-jellyfish-to-create-a-tv-screen/<br />
<br />
'''<u>VIDEOCHAT</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://videochat.lasprovincias.es/videochat.php?videochat=iGEM09<br />
<br />
<br />
<br />
'''<u>AT TV :D</u>'''<br />
<span style="color:black; align:justify; font-size:10pt; font-family: Verdana"><br />
<br />
http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Unos-investigadores-intentan-crear-una-pantalla-television-partir-medusas/8149310<br />
<br />
http://www.rtvv.es/video/video_informa.asp?id=16092009_pixel.flv<br />
<br />
<br><br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/homeTeam:Valencia/home2009-10-21T23:10:38Z<p>Emilio: </p>
<hr />
<div><html><link rel="stylesheet" href="https://2009.igem.org/Team:Valencia/Prueba2<br />
title=User:Emilio/valencia.css&action=raw&ctype=text/css" type="text/css"></html><br />
<br />
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<title>iGEM 2009 Valencia</title><br />
<!-- <link rel="stylesheet" href="https://2009.igem.org/User:Emilio/valencia.css" type="text/css" charset="utf-8" /> --><br />
<br />
<style><br />
<br />
html {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
body.mediawiki {<br />
background:#000 url(https://static.igem.org/mediawiki/2009/5/51/ValenciaBordeado4.JPG) <br />
top center repeat-y ; font-size:8pt; font-family: Verdana; color:#202020;<br />
}<br />
<br />
#content { <br />
background-color: #FFFFFF<br />
}<br />
<br />
}<br />
#bodyContent {}<br />
h1.firstHeading, #top {display:none;}<br />
<br />
<br />
body {<br />
background: #00868B; <br />
color: #00868B;<br />
font: 11px verdana, sans-serif;<br />
margin: 0px;<br />
padding: 20px 0px 20px 0px;<br />
}<br />
a {<br />
color: #000000;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
a:hover {<br />
color: #185B85;<br />
text-decoration: underline;<br />
}<br />
img {<br />
border: 0px;<br />
}<br />
#wrapper {<br />
width: 778px;<br />
margin: auto;<br />
text-align: left;<br />
}<br />
#header p {<br />
font-size:18px;<br />
font-style:italic;<br />
color:#FFFFFF;<br />
font-family:Georgia, "Times New Roman", Times, serif;<br />
}<br />
#header p.more {<br />
padding-right: 2px;<br />
}<br />
#header {<br />
height: 320px;<br />
background: url(https://static.igem.org/mediawiki/2009/4/43/Valencia_Fimagen.jpg) no-repeat;<br />
}<br />
#header div {<br />
padding: 130px 413px 10px 30px;<br />
}<br />
#header p {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
#header a {<br />
color:#FFFFFF;<br />
}<br />
#nav {<br />
width: 840px;<br />
height: 48px;<br />
margin: 0px 0px 0px 20px;<br />
background-image:url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif);<br />
background-repeat:repeat-x;<br />
display:block;<br />
float:left;<br />
<br />
}<br />
#nav a {<br />
font-size:18px;<br />
font-style:italic;<br />
color:#260403;<br />
font-family:Georgia, "Times New Roman", Times, serif;<br />
margin: 12px 0px 10px 0px;<br />
padding: 0px 20px 0px 20px;<br />
display:inline;<br />
float:left;<br />
border-right-width: 2px;<br />
border-right-style: inset;<br />
border-right-color: #76644f;<br />
}<br />
#nav a:hover {<br />
color:#862e06;<br />
text-decoration:none;<br />
}<br />
.lastchild {<br />
border-right: none 0px !important;<br />
}<br />
#body {<br />
background: url(https://static.igem.org/mediawiki/2009/b/b0/ValenciaBody_bgblanco.JPG) repeat-y;<br />
clear: both;<br />
width: 100%;<br />
}<br />
#body-top {<br />
background: url(https://static.igem.org/mediawiki/2009/e/ed/ValenciaBody_topblancogris.JPG) no-repeat;<br />
}<br />
#body-bot {<br />
background: bottom url(https://static.igem.org/mediawiki/2009/1/18/ValenciaBody_botblanco.GIF) no-repeat;<br />
padding: 21px 25px 15px 42px;<br />
}<br />
#about-box {<br />
float: left;<br />
width: 315px;<br />
}<br />
#about-box ul {<br />
margin-left: 8px;<br />
}<br />
#express-box {<br />
float: right;<br />
width: 327px;<br />
}<br />
#foot {<br />
width: 738px;<br />
margin-left: 20px;<br />
background: url(https://static.igem.org/mediawiki/2009/f/f3/ValenciaFoot_bgblanco2.JPG) repeat-y;<br />
}<br />
#foot-top {<br />
background: url(https://static.igem.org/mediawiki/2009/6/6d/Valenciafoottopblanco6.JPG) no-repeat;<br />
}<br />
#foot-bot {<br />
background: bottom url(https://static.igem.org/mediawiki/2009/9/96/ValenciaFoot_botblanco.GIF) no-repeat;<br />
padding: 13px 21px 12px 28px;<br />
}<br />
#what-box {<br />
float: left;<br />
width: 284px;<br />
}<br />
#what-box img.left {<br />
margin-left: 10px;<br />
}<br />
#what-box ul {<br />
float: left;<br />
margin-left: 2px;<br />
width: 380px;<br />
}<br />
#news-box {<br />
float: right;<br />
width: 316px;<br />
}<br />
#news-box ul {<br />
float: left;<br />
margin-left: 2px;<br />
width: 184px;<br />
}<br />
#footer {<br />
margin: 14px;<br />
text-align: center;<br />
}<br />
h2 {<br />
margin: 0px;<br />
padding: 0px 0px 10px 0px;<br />
font:Arial, Helvetica, sans-serif;<br />
font-size:20px;<br />
font-style:italic;<br />
<br />
color:#862e06;<br />
}<br />
h2 b{<br />
color:#341c12;<br />
}<br />
<br />
ul {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
li {<br />
margin: 0px;<br />
padding: 0px 0px 5px 20px;<br />
list-style: none;<br />
background: 0px 3px url(https://static.igem.org/mediawiki/2009/e/e3/ValenciaBullet2.gif) no-repeat;<br />
}<br />
p {<br />
margin-top: 0px;<br />
margin-bottom: 10px;<br />
}<br />
div.narrow-text {<br />
margin-right: 18px;<br />
}<br />
img.left {<br />
float: left;<br />
padding-right: 14px;<br />
padding-bottom: 16px;<br />
}<br />
#body p.more {<br />
padding-top: 6px;<br />
}<br />
#news-box p.more {<br />
padding-top: 0px;<br />
margin-top: 0px;<br />
}<br />
p.more {<br />
text-align: right;<br />
}<br />
.clear {<br />
clear: both;<br />
}<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
function mouseOverMore()<br />
{<br />
document.getElementById("b30").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore()<br />
{<br />
document.getElementById("b30").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
function mouseOverMore1()<br />
{<br />
document.getElementById("b31").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore1()<br />
{<br />
document.getElementById("b31").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
function mouseOverMore2()<br />
{<br />
document.getElementById("b32").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore2()<br />
{<br />
document.getElementById("b32").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
function mouseOverMore3()<br />
{<br />
document.getElementById("b33").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore3()<br />
{<br />
document.getElementById("b33").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
</script><br />
<br />
<br />
</head><br />
<br />
<body><br />
<br />
<div id="wrapper"><br />
<div id="header"><br />
<div><br />
<p> A “bio-screen” of voltage-activated cells, where every “cellular pixel” produces light. Using electrical signals instead of chemical stimulation, we are able to see animated pictures!</p><br />
<br />
<br />
</div><br />
</div><br />
</html>{{Template:Valencia09iGEM65}}<br />
<html><br />
<div id="body"><br />
<div id="body-top"><br />
<div id="body-bot"><br />
<div id="about-box" align="justify"><br />
<h2><b>Project</b> description</h2><br />
<a href="https://2009.igem.org/Team:Valencia/Project" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/e/ed/V_SoloNinoMini.gif" width="100" height="75" alt="iLCD Project" class="left"> </a><br />
<p>Engineered yeasts able to sense and respond to electrical signals are build (what we call <b>LEC</b>). Thanks to a homemade device these <b>LEC</b>s work cooperatively in such a way that they are able to reproduce images in movement, building up a "bio-screen" for the first time in history. </p><br />
<br><br />
<center><br />
<i><br />
"As Lumières revolutioned the photography world, Valencia Team revolutions the bacterial photography world"</i><br />
</center><br />
<br> <br />
<!-- <ul><br />
<li> <a href="https://2009.igem.org/Team:Valencia/WetLab/YeastTeam">LEC construction</a>. </li><br />
<li> <a href="https://2009.igem.org/Team:Valencia/Modelling">LEC characterization</a>. </li><br />
<li> <a href="https://2009.igem.org/Team:Valencia/Hardware">LEC Integration in the first iLCD.</a> </li><br />
</ul><br />
--><br />
<br><br />
<p class="more"><br />
<br />
<a href="https://2009.igem.org/Team:Valencia/Project" target="_top" onmouseover="mouseOverMore()"<br />
onmouseout="mouseOutMore()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b30" /></a><br />
<br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<div id="express-box" align="justify"><br />
<h2><b>Human Practices</b> Report</h2><br />
<a href="https://2009.igem.org/Team:Valencia/Human" target="_blank"><img src="https://static.igem.org/mediawiki/2009/b/b7/V_SinsMini.png" width="115" height="90" alt="Human Practices" class="left"></a><br />
<br />
<p>Sins, Ethics and Biology, a Comprehensive Approach is more than a review on Human Practices and Synthetic Biology it emcompasses:</p><br />
<p> Classical review revising more than <b>50 scientific reports</b> on Human Practices.</p><br />
<p> The first <b>comparative analysis</b> of previous iGEM HP projects.</p><br />
<p><b>Interviews</b> with well known experts.</p><br />
<p>The <b>largest survey</b> on ethics and synthetic biology ever made.</p><br />
<p class="more"><br />
<br />
<a href="https://2009.igem.org/Team:Valencia/Human" target="_top" onmouseover="mouseOverMore1()"<br />
onmouseout="mouseOutMore1()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b31" /></a><br />
<br />
</p><br />
</div><br />
<div class="clear"></div><br />
</div><br />
</div><br />
</div><br />
<div id="foot"><br />
<div id="foot-top"><br />
<div id="foot-bot"><br />
<div id="about-box" align="justify"><br />
<h2><b>Valencia </b> Team </h2><br />
<a href="https://2009.igem.org/Team:Valencia/TeamVal" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/1/17/V_miniequip3.png" width="112" height="83" alt="Team Valencia" class="left"> </a><br />
<ul><br />
<p>Integrated by students from the two main Valencia Universities (<a href="http://www.upv.es">UPV</a> and <a href="http://www.uv.es">UV</a>).</p> <br />
<p>We gathered an eminent <b>multidisciplinary</b> group:</p><br />
<p>4 Biologist, 3 Mechanical Engineers and 2 Biotech</p><br />
With a great repercusion in the <a href="https://2009.igem.org/Team:Valencia/News">national media</a>! <br />
</ul><br />
<p class="more clear"><br />
<br />
<a href="https://2009.igem.org/Team:Valencia/TeamVal" target="_top" onmouseover="mouseOverMore2()"<br />
onmouseout="mouseOutMore2()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b32" /></a><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="news-box" align="justify"><br />
<h2><b>Acknowledgements</b></h2><br />
<a href="https://2009.igem.org/Team:Valencia/Acknowledgements" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/1/1c/V_Acknow.png" width="112" height="90" alt="Acknowledgements" class="left"> </a><br />
<p>This work has not been possible without the help of several Institutions and Research groups.</p><br />
<p>From Valencia Team, we would like to thank to all that people that allow us to pass this summer working on this mind-blowing project</p><br />
<p>To see all of them... </p><br />
<br><br />
<p class="more clear"> <br />
<a href="https://2009.igem.org/Team:Valencia/Acknowledgements" target="_top" onmouseover="mouseOverMore3()"<br />
onmouseout="mouseOutMore3()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b33" /></a><br />
<br />
</p><br />
</div><br />
<div class="clear"></div><br />
</div><br />
</div><br />
</div><br />
<div id="footer"><br />
<p>&copy; iGEM Valencia 2009</p><br />
</div><br />
</div><br />
</body><br />
<br />
<br />
</html></div>Emiliohttp://2009.igem.org/Team:Valencia/homeTeam:Valencia/home2009-10-21T23:09:52Z<p>Emilio: </p>
<hr />
<div><html><link rel="stylesheet" href="https://2009.igem.org/Team:Valencia/Prueba2<br />
title=User:Emilio/valencia.css&action=raw&ctype=text/css" type="text/css"></html><br />
<br />
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8"/><br />
<br />
<title>iGEM 2009 Valencia</title><br />
<!-- <link rel="stylesheet" href="https://2009.igem.org/User:Emilio/valencia.css" type="text/css" charset="utf-8" /> --><br />
<br />
<style><br />
<br />
html {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
body.mediawiki {<br />
background:#000 url(https://static.igem.org/mediawiki/2009/5/51/ValenciaBordeado4.JPG) <br />
top center repeat-y ; font-size:8pt; font-family: Verdana; color:#202020;<br />
}<br />
<br />
#content { <br />
background-color: #FFFFFF<br />
}<br />
<br />
}<br />
#bodyContent {}<br />
h1.firstHeading, #top {display:none;}<br />
<br />
<br />
body {<br />
background: #00868B; <br />
color: #00868B;<br />
font: 11px verdana, sans-serif;<br />
margin: 0px;<br />
padding: 20px 0px 20px 0px;<br />
}<br />
a {<br />
color: #000000;<br />
font-weight: bold;<br />
text-decoration: none;<br />
}<br />
a:hover {<br />
color: #185B85;<br />
text-decoration: underline;<br />
}<br />
img {<br />
border: 0px;<br />
}<br />
#wrapper {<br />
width: 778px;<br />
margin: auto;<br />
text-align: left;<br />
}<br />
#header p {<br />
font-size:18px;<br />
font-style:italic;<br />
color:#FFFFFF;<br />
font-family:Georgia, "Times New Roman", Times, serif;<br />
}<br />
#header p.more {<br />
padding-right: 2px;<br />
}<br />
#header {<br />
height: 320px;<br />
background: url(https://static.igem.org/mediawiki/2009/4/43/Valencia_Fimagen.jpg) no-repeat;<br />
}<br />
#header div {<br />
padding: 130px 413px 10px 30px;<br />
}<br />
#header p {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
#header a {<br />
color:#FFFFFF;<br />
}<br />
#nav {<br />
width: 840px;<br />
height: 48px;<br />
margin: 0px 0px 0px 20px;<br />
background-image:url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif);<br />
background-repeat:repeat-x;<br />
display:block;<br />
float:left;<br />
<br />
}<br />
#nav a {<br />
font-size:18px;<br />
font-style:italic;<br />
color:#260403;<br />
font-family:Georgia, "Times New Roman", Times, serif;<br />
margin: 12px 0px 10px 0px;<br />
padding: 0px 20px 0px 20px;<br />
display:inline;<br />
float:left;<br />
border-right-width: 2px;<br />
border-right-style: inset;<br />
border-right-color: #76644f;<br />
}<br />
#nav a:hover {<br />
color:#862e06;<br />
text-decoration:none;<br />
}<br />
.lastchild {<br />
border-right: none 0px !important;<br />
}<br />
#body {<br />
background: url(https://static.igem.org/mediawiki/2009/b/b0/ValenciaBody_bgblanco.JPG) repeat-y;<br />
clear: both;<br />
width: 100%;<br />
}<br />
#body-top {<br />
background: url(https://static.igem.org/mediawiki/2009/e/ed/ValenciaBody_topblancogris.JPG) no-repeat;<br />
}<br />
#body-bot {<br />
background: bottom url(https://static.igem.org/mediawiki/2009/1/18/ValenciaBody_botblanco.GIF) no-repeat;<br />
padding: 21px 25px 15px 42px;<br />
}<br />
#about-box {<br />
float: left;<br />
width: 315px;<br />
}<br />
#about-box ul {<br />
margin-left: 8px;<br />
}<br />
#express-box {<br />
float: right;<br />
width: 327px;<br />
}<br />
#foot {<br />
width: 738px;<br />
margin-left: 20px;<br />
background: url(https://static.igem.org/mediawiki/2009/f/f3/ValenciaFoot_bgblanco2.JPG) repeat-y;<br />
}<br />
#foot-top {<br />
background: url(https://static.igem.org/mediawiki/2009/6/6d/Valenciafoottopblanco6.JPG) no-repeat;<br />
}<br />
#foot-bot {<br />
background: bottom url(https://static.igem.org/mediawiki/2009/9/96/ValenciaFoot_botblanco.GIF) no-repeat;<br />
padding: 13px 21px 12px 28px;<br />
}<br />
#what-box {<br />
float: left;<br />
width: 284px;<br />
}<br />
#what-box img.left {<br />
margin-left: 10px;<br />
}<br />
#what-box ul {<br />
float: left;<br />
margin-left: 2px;<br />
width: 380px;<br />
}<br />
#news-box {<br />
float: right;<br />
width: 316px;<br />
}<br />
#news-box ul {<br />
float: left;<br />
margin-left: 2px;<br />
width: 184px;<br />
}<br />
#footer {<br />
margin: 14px;<br />
text-align: center;<br />
}<br />
h2 {<br />
margin: 0px;<br />
padding: 0px 0px 10px 0px;<br />
font:Arial, Helvetica, sans-serif;<br />
font-size:20px;<br />
font-style:italic;<br />
<br />
color:#862e06;<br />
}<br />
h2 b{<br />
color:#341c12;<br />
}<br />
<br />
ul {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
li {<br />
margin: 0px;<br />
padding: 0px 0px 5px 20px;<br />
list-style: none;<br />
background: 0px 3px url(https://static.igem.org/mediawiki/2009/e/e3/ValenciaBullet2.gif) no-repeat;<br />
}<br />
p {<br />
margin-top: 0px;<br />
margin-bottom: 10px;<br />
}<br />
div.narrow-text {<br />
margin-right: 18px;<br />
}<br />
img.left {<br />
float: left;<br />
padding-right: 14px;<br />
padding-bottom: 16px;<br />
}<br />
#body p.more {<br />
padding-top: 6px;<br />
}<br />
#news-box p.more {<br />
padding-top: 0px;<br />
margin-top: 0px;<br />
}<br />
p.more {<br />
text-align: right;<br />
}<br />
.clear {<br />
clear: both;<br />
}<br />
</style><br />
<br />
<script type="text/javascript"><br />
<br />
function mouseOverMore()<br />
{<br />
document.getElementById("b30").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore()<br />
{<br />
document.getElementById("b30").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
function mouseOverMore1()<br />
{<br />
document.getElementById("b31").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore1()<br />
{<br />
document.getElementById("b31").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
function mouseOverMore2()<br />
{<br />
document.getElementById("b32").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore2()<br />
{<br />
document.getElementById("b32").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
function mouseOverMore3()<br />
{<br />
document.getElementById("b33").src="https://static.igem.org/mediawiki/2009/7/79/ButtMore_off.gif"<br />
}<br />
function mouseOutMore3()<br />
{<br />
document.getElementById("b33").src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif"<br />
}<br />
<br />
</script><br />
<br />
<br />
</head><br />
<br />
<body><br />
<br />
<div id="wrapper"><br />
<div id="header"><br />
<div><br />
<p> A “bio-screen” of voltage-activated cells, where every “cellular pixel” produces light. Using electrical signals instead of chemical stimulation, we are able to see animated pictures!</p><br />
<br />
<br />
</div><br />
</div><br />
</html>{{Template:Valencia09iGEM65}}<br />
<html><br />
<div id="body"><br />
<div id="body-top"><br />
<div id="body-bot"><br />
<div id="about-box" align="justify"><br />
<h2><b>Project</b> description</h2><br />
<a href="https://2009.igem.org/Team:Valencia/Project" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/e/ed/V_SoloNinoMini.gif" width="100" height="75" alt="iLCD Project" class="left"> </a><br />
<p>Engineered yeasts able to sense and respond to electrical signals are build (what we call <b>LEC</b>). Thanks to a homemade device these <b>LEC</b>s work cooperatively in such a way that they are able to reproduce images in movement, building up a "bio-screen" for the first time in history. </p><br />
<br><br />
<center><br />
<i><br />
"As Lumières revolutioned the photography world, Valencia Team revolutions the bacterial photography world"</i><br />
</center><br />
<br> <br />
<!-- <ul><br />
<li> <a href="https://2009.igem.org/Team:Valencia/WetLab/YeastTeam">LEC construction</a>. </li><br />
<li> <a href="https://2009.igem.org/Team:Valencia/Modelling">LEC characterization</a>. </li><br />
<li> <a href="https://2009.igem.org/Team:Valencia/Hardware">LEC Integration in the first iLCD.</a> </li><br />
</ul><br />
--><br />
<br><br />
<p class="more"><br />
<br />
<a href="https://2009.igem.org/Team:Valencia/Project" target="_top" onmouseover="mouseOverMore()"<br />
onmouseout="mouseOutMore()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b30" /></a><br />
<br />
</p><br />
<br />
<br />
</div><br />
<br />
<br />
<div id="express-box" align="justify"><br />
<h2><b>Human Practices</b> Report</h2><br />
<a href="https://2009.igem.org/Team:Valencia/Human" target="_blank"><img src="https://static.igem.org/mediawiki/2009/b/b7/V_SinsMini.png" width="115" height="90" alt="Human Practices" class="left"></a><br />
<br />
<p>Sins, Ethics and Biology, a Comprehensive Approach is more than a review on Human Practices and Synthetic Biology it emcompasses:</p><br />
<p> Classical review revising more than <b>50 scientific reports</b> on Human Practices.</p><br />
<p> The first <b>comparative analysis</b> of previous iGEM HP projects.</p><br />
<p><b>Interviews</b> with well known experts.</p><br />
<p>The <b>largest survey</b> on ethics and synthetic biology ever made.</p><br />
<p class="more"><br />
<br />
<a href="https://2009.igem.org/Team:Valencia/Human" target="_top" onmouseover="mouseOverMore1()"<br />
onmouseout="mouseOutMore1()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b31" /></a><br />
<br />
</p><br />
</div><br />
<div class="clear"></div><br />
</div><br />
</div><br />
</div><br />
<div id="foot"><br />
<div id="foot-top"><br />
<div id="foot-bot"><br />
<div id="about-box" align="justify"><br />
<h2><b>Valencia </b> Team </h2><br />
<a href="https://2009.igem.org/Team:Valencia/TeamVal" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/1/17/V_miniequip3.png" width="112" height="83" alt="Team Valencia" class="left"> </a><br />
<ul><br />
<p>Integrated by students from the two main Valencia Universities (<a href="http://www.upv.es">UPV</a> and <a href="http://www.uv.es">UV</a>).</p> <br />
<p>We gathered an eminent <b>multidisciplinary</b> group:</p><br />
<p>4 Biologist, 3 Mechanical Engineers and 2 Biotech</p><br />
With a great repercusion in the <a href="https://2009.igem.org/Team:Valencia/News">national media</a>! <br />
</ul><br />
<p class="more clear"><br />
<br />
<a href="https://2009.igem.org/Team:Valencia/TeamVal" target="_top" onmouseover="mouseOverMore2()"<br />
onmouseout="mouseOutMore2()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b32" /></a><br />
<br />
</p><br />
<br />
<br />
</div><br />
<div id="news-box" align="justify"><br />
<h2><b>Acknowledgements</b></h2><br />
<a href="https://2009.igem.org/Team:Valencia/Acknowledgements" target="_blank"> <img src="https://static.igem.org/mediawiki/2009/1/1c/V_Acknow.png" width="112" height="90" alt="Acknowledgements" class="left"> </a><br />
<p>This work has not been possible without the help of several Institutions and Research groups.</p><br />
<p>From Valencia Team, we would like to thank to all that people that allow us to pass this summer working on this mind-blowing project</p><br />
<p>To see all of them... </p><br />
<p class="more clear"> <br />
<a href="https://2009.igem.org/Team:Valencia/Acknowledgements" target="_top" onmouseover="mouseOverMore3()"<br />
onmouseout="mouseOutMore3()"><br />
<img border="0" src="https://static.igem.org/mediawiki/2009/e/e2/ButtMore_on.gif" width="80" height="25" alt="More" id="b33" /></a><br />
<br />
</p><br />
</div><br />
<div class="clear"></div><br />
</div><br />
</div><br />
</div><br />
<div id="footer"><br />
<p>&copy; iGEM Valencia 2009</p><br />
</div><br />
</div><br />
</body><br />
<br />
<br />
</html></div>Emiliohttp://2009.igem.org/Team:Valencia/experimentalbiblioTeam:Valencia/experimentalbiblio2009-10-21T23:03:56Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1755px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-260px; margin-left:190px; width:700px"><br />
<br />
=='''Complementary Bibliography to the Experiments'''==<br />
<br><br />
<br />
* Viladevall, et al. (2004) Characterization of the calcium-mediated response to alkaline stress in Saccharomyces cerevisiae. The Journal of Biological Chemistry. 279(42) 43614-43624.<br />
<br />
* Locke EG, et al. (2000) A homolog of voltage-gated Ca(2+) channels stimulated by depletion of secretory Ca(2+) in yeast. Mol Cell Biol. 20(18):6686-94.<br />
<br />
* Halachmi D, Eilam Y. (1996) Elevated cytosolic free Ca2+ concentrations and massive Ca2+ accumulation within vacuoles, in yeast mutant lacking PMR1, a homolog of Ca2+ -ATPase. FEBS Lett.392(2) 194-200.<br />
<br />
* Halachmi D, Eilam Y. (1993) Calcium homeostasis in yeast cells exposed to high concentrations of calcium. Roles of vacuolar H(+)-ATPase and cellular ATP : FEBS Lett. 18;316(1) 73-78.<br />
<br />
* Noma S, Iida K, Iida H. (2005) Polarized morphogenesis regulator Spa2 is required for the function of putative stretch-activated Ca2+-permeable channel component Mid1 in Saccharomyces cerevisiae. Eukaryot Cell. 4(8) 1353-1363.<br />
<br />
* Min Liu and Angie Gelli (2008) Elongation Factor 3, EF3, Associates with the Calcium Channel Cch1 and Targets Cch1 to the Plasma Membrane in Cryptococcus neoformans Eukaryot Cell. 7(7) 1118-1126.</div>Emiliohttp://2009.igem.org/Team:Valencia/experimentalbiblioTeam:Valencia/experimentalbiblio2009-10-21T23:03:24Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1755px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-260px; margin-left:190px; width:700px"><br />
<br />
=='''Complementary Bibliography to the Experiments'''==<br />
<br><br />
<br />
* Viladevall, et al. (2004) Characterization of the calcium-mediated response to alkaline stress in Saccharomyces cerevisiae. The Journal of Biological Chemistry. 279(42) 43614-43624.<br />
<br />
* Locke EG, et al. (2000) A homolog of voltage-gated Ca(2+) channels stimulated by depletion of secretory Ca(2+) in yeast. Mol Cell Biol. 20(18):6686-94<br />
<br />
* Halachmi D, Eilam Y. (1996) Elevated cytosolic free Ca2+ concentrations and massive Ca2+ accumulation within vacuoles, in yeast mutant lacking PMR1, a homolog of Ca2+ -ATPase. FEBS Lett.392(2) 194-200<br />
<br />
* Halachmi D, Eilam Y. (1993) Calcium homeostasis in yeast cells exposed to high concentrations of calcium. Roles of vacuolar H(+)-ATPase and cellular ATP : FEBS Lett. 18;316(1) 73-78.<br />
<br />
* Noma S, Iida K, Iida H. (2005) Polarized morphogenesis regulator Spa2 is required for the function of putative stretch-activated Ca2+-permeable channel component Mid1 in Saccharomyces cerevisiae. Eukaryot Cell. 4(8) 1353-1363<br />
<br />
* Min Liu and Angie Gelli (2008) Elongation Factor 3, EF3, Associates with the Calcium Channel Cch1 and Targets Cch1 to the Plasma Membrane in Cryptococcus neoformans Eukaryot Cell. 7(7) 1118-1126</div>Emiliohttp://2009.igem.org/Team:Valencia/experimentalbiblioTeam:Valencia/experimentalbiblio2009-10-21T23:02:19Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1755px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px"><br />
<br />
=='''Complementary Bibliography to the Experiments'''==<br />
<br><br />
* Viladevall, et al. (2004) Characterization of the calcium-mediated response to alkaline stress in Saccharomyces cerevisiae. The Journal of Biological Chemistry. 279(42) 43614-43624.<br />
<br />
* Locke EG, et al. (2000) A homolog of voltage-gated Ca(2+) channels stimulated by depletion of secretory Ca(2+) in yeast. Mol Cell Biol. 20(18):6686-94<br />
<br />
* Halachmi D, Eilam Y. (1996) Elevated cytosolic free Ca2+ concentrations and massive Ca2+ accumulation within vacuoles, in yeast mutant lacking PMR1, a homolog of Ca2+ -ATPase. FEBS Lett.392(2) 194-200<br />
<br />
* Halachmi D, Eilam Y. (1993) Calcium homeostasis in yeast cells exposed to high concentrations of calcium. Roles of vacuolar H(+)-ATPase and cellular ATP : FEBS Lett. 18;316(1) 73-78.<br />
<br />
* Noma S, Iida K, Iida H. (2005) Polarized morphogenesis regulator Spa2 is required for the function of putative stretch-activated Ca2+-permeable channel component Mid1 in Saccharomyces cerevisiae. Eukaryot Cell. 4(8) 1353-1363<br />
<br />
* Min Liu and Angie Gelli (2008) Elongation Factor 3, EF3, Associates with the Calcium Channel Cch1 and Targets Cch1 to the Plasma Membrane in Cryptococcus neoformans Eukaryot Cell. 7(7) 1118-1126</div>Emiliohttp://2009.igem.org/Team:Valencia/experimentalbiblioTeam:Valencia/experimentalbiblio2009-10-21T23:01:54Z<p>Emilio: New page: {{Template:Valencia09iGEM23}} <html> <style> #content{ height: 1755px; } </style> </html> <br> <div align="justify" style="position:relative; margin-top:-250px; margin-l...</p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1755px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px"><br />
<br />
==Complementary Bibliography to the Experiments ==<br />
<br />
* Viladevall, et al. (2004) Characterization of the calcium-mediated response to alkaline stress in Saccharomyces cerevisiae. The Journal of Biological Chemistry. 279(42) 43614-43624.<br />
<br />
* Locke EG, et al. (2000) A homolog of voltage-gated Ca(2+) channels stimulated by depletion of secretory Ca(2+) in yeast. Mol Cell Biol. 20(18):6686-94<br />
<br />
* Halachmi D, Eilam Y. (1996) Elevated cytosolic free Ca2+ concentrations and massive Ca2+ accumulation within vacuoles, in yeast mutant lacking PMR1, a homolog of Ca2+ -ATPase. FEBS Lett.392(2) 194-200<br />
<br />
* Halachmi D, Eilam Y. (1993) Calcium homeostasis in yeast cells exposed to high concentrations of calcium. Roles of vacuolar H(+)-ATPase and cellular ATP : FEBS Lett. 18;316(1) 73-78.<br />
<br />
* Noma S, Iida K, Iida H. (2005) Polarized morphogenesis regulator Spa2 is required for the function of putative stretch-activated Ca2+-permeable channel component Mid1 in Saccharomyces cerevisiae. Eukaryot Cell. 4(8) 1353-1363<br />
<br />
* Min Liu and Angie Gelli (2008) Elongation Factor 3, EF3, Associates with the Calcium Channel Cch1 and Targets Cch1 to the Plasma Membrane in Cryptococcus neoformans Eukaryot Cell. 7(7) 1118-1126</div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeamTeam:Valencia/WetLab/YeastTeam2009-10-21T22:57:26Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1755px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px"><br />
<br />
== '''WetLab Overview''' ==<br />
<br />
<br><br />
<!--At WetLab we are working with '''yeasts''' in order to create each and everyone of the cell-pixels of our bioscreen. Since we want to make yeasts shine, we are using an aequorin-transformed yeast strains.<br />
<br />
<br />
'''Aequorin''' is a luminiscent protein that originally was isolated from luminescent jellyfish ''Aequorea''. It can also find in other species of ''Aequorea'' and in many other marine organisms. For more information about de discovery of aequorin, read [https://2009.igem.org/Team:Valencia/A_short_story '''A short story of Aequorin'''], written by [https://2009.igem.org/Team:Valencia/A_short_story/Osamu Osamu Shimomura]. This is an interesting and entertaining text. You should read it. No doubt!<br />
<br />
<br />
To make light, Aequorin uses '''coelenterazine''' as its cofactor. Aequorin also needs the binding of Ca<SUP>2+</SUP> to produce light. You can see the complete reaction in the next picture:--><br />
<br />
The project our team imagined is about controlling electrically genetically engineered cells to induce a desired behavior. In particular, our Project had the ambitious goal of making LECs (Light Emitting Cells).<br />
<br />
In order to do so, we have worked with a bioluminiscent protein named aequorin. Aequorin is present in jellyfish and it is responsible of the emission of Light by these marine invertebrates. In order for aequorin to produce Light, this protein has to be coupled to a prostetic group: coelenterazine. Coelenterazine is oxidized when calcium ions bind to the aequorin-coelenterazine complex and, as a result, light is emitted. This is not a fluorescent reaction, as aequorin do not need to be excited with UV light.<br />
<br />
<html><center><img src="https://static.igem.org/mediawiki/2009/9/96/Aquorin_reaction.gif" WIDTH="464" HEIGHT="268"></center></html><br />
<br />
<br />
But since we did not want to work with jellyfishes in the lab, we used budding yeast, Saccharomyces cerevisiae, as a simple host for our experiments. We used a genetically modified yeast strain expressing aequorin. This strain has been reported to produce light through a calcium channel-based system in response to a chemical stimulation.<br />
<br />
But our aim was to control electrically our LECs, so we tried to induce a membrane depolarization by supplying electricity to our yeasts and open voltage-dependent calcium channels to produce a calcium entry to cytosol and, as a result, get light emission. <br />
<br />
<br />
<!--We will use a '''chemical input''' like KOH (alkali shock) to open '''Ca<SUP>2+</SUP> channels''' in the yeasts' membrane (Viladevall L, et al. J Biol Chem. (2004) 279 43614–43624), then Ca<SUP>2+</SUP> will enter into the cells and we will get '''light''' as an '''output'''. We have a [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam/Protocols protocol] and diferent [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam/Experimental experimental designs] to try to reproduce the Arinyo's experiment.<br />
<br />
If we succed in this, we will try to reproduce the same response with an '''electrical stimulus''', using some hardware built by ourselves. We will use an electrical input to open the Ca<SUP>2+</SUP> channels. We hope that we see light by this metod.--><br />
<br />
<html><center><img src="https://static.igem.org/mediawiki/2009/5/5d/Aquorin_in_action.jpg" WIDTH="350" HEIGHT="280"></center></html><br />
<br />
<br />
In summary, we designed a yeast-based system for the production of light through a jellyfish protein sensitive to calcium. Since calcium enters the cytoplasm through voltage channels, it is theoretically possible to have light emission under electrical control. If this was possible, a biological display made of aequorin-expressing yeasts as living pixels could be constructed.<br />
<br />
Some interesting bibliography used to develop this part of the project and that can be very interesting is found [https://2009.igem.org/wiki/index.php?title=Team:Valencia/experimentalbiblio here]<br />
<br />
<br />
</div><br />
<br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/WetLab/YeastTeamTeam:Valencia/WetLab/YeastTeam2009-10-21T22:57:02Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1755px;<br />
}<br />
</style><br />
</html><br />
<br><br />
<div align="justify" style="position:relative; margin-top:-250px; margin-left:190px; width:700px"><br />
<br />
== '''WetLab Overview''' ==<br />
<br />
<br><br />
<!--At WetLab we are working with '''yeasts''' in order to create each and everyone of the cell-pixels of our bioscreen. Since we want to make yeasts shine, we are using an aequorin-transformed yeast strains.<br />
<br />
<br />
'''Aequorin''' is a luminiscent protein that originally was isolated from luminescent jellyfish ''Aequorea''. It can also find in other species of ''Aequorea'' and in many other marine organisms. For more information about de discovery of aequorin, read [https://2009.igem.org/Team:Valencia/A_short_story '''A short story of Aequorin'''], written by [https://2009.igem.org/Team:Valencia/A_short_story/Osamu Osamu Shimomura]. This is an interesting and entertaining text. You should read it. No doubt!<br />
<br />
<br />
To make light, Aequorin uses '''coelenterazine''' as its cofactor. Aequorin also needs the binding of Ca<SUP>2+</SUP> to produce light. You can see the complete reaction in the next picture:--><br />
<br />
The project our team imagined is about controlling electrically genetically engineered cells to induce a desired behavior. In particular, our Project had the ambitious goal of making LECs (Light Emitting Cells).<br />
<br />
In order to do so, we have worked with a bioluminiscent protein named aequorin. Aequorin is present in jellyfish and it is responsible of the emission of Light by these marine invertebrates. In order for aequorin to produce Light, this protein has to be coupled to a prostetic group: coelenterazine. Coelenterazine is oxidized when calcium ions bind to the aequorin-coelenterazine complex and, as a result, light is emitted. This is not a fluorescent reaction, as aequorin do not need to be excited with UV light.<br />
<br />
<html><center><img src="https://static.igem.org/mediawiki/2009/9/96/Aquorin_reaction.gif" WIDTH="464" HEIGHT="268"></center></html><br />
<br />
<br />
But since we did not want to work with jellyfishes in the lab, we used budding yeast, Saccharomyces cerevisiae, as a simple host for our experiments. We used a genetically modified yeast strain expressing aequorin. This strain has been reported to produce light through a calcium channel-based system in response to a chemical stimulation.<br />
<br />
But our aim was to control electrically our LECs, so we tried to induce a membrane depolarization by supplying electricity to our yeasts and open voltage-dependent calcium channels to produce a calcium entry to cytosol and, as a result, get light emission. <br />
<br />
<br />
<!--We will use a '''chemical input''' like KOH (alkali shock) to open '''Ca<SUP>2+</SUP> channels''' in the yeasts' membrane (Viladevall L, et al. J Biol Chem. (2004) 279 43614–43624), then Ca<SUP>2+</SUP> will enter into the cells and we will get '''light''' as an '''output'''. We have a [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam/Protocols protocol] and diferent [https://2009.igem.org/Team:Valencia/WetLab/YeastTeam/Experimental experimental designs] to try to reproduce the Arinyo's experiment.<br />
<br />
If we succed in this, we will try to reproduce the same response with an '''electrical stimulus''', using some hardware built by ourselves. We will use an electrical input to open the Ca<SUP>2+</SUP> channels. We hope that we see light by this metod.--><br />
<br />
<html><center><img src="https://static.igem.org/mediawiki/2009/5/5d/Aquorin_in_action.jpg" WIDTH="350" HEIGHT="280"></center></html><br />
<br />
<br />
In summary, we designed a yeast-based system for the production of light through a jellyfish protein sensitive to calcium. Since calcium enters the cytoplasm through voltage channels, it is theoretically possible to have light emission under electrical control. If this was possible, a biological display made of aequorin-expressing yeasts as living pixels could be constructed.<br />
<br />
<br />
</div><br />
Some interesting bibliography used to develop this part of the project and that can be very interesting is found [https://2009.igem.org/wiki/index.php?title=Team:Valencia/experimentalbiblio here]<br />
<br><br><br></div>Emiliohttp://2009.igem.org/Team:Valencia/modellingbiblioTeam:Valencia/modellingbiblio2009-10-21T22:53:40Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1500px;<br />
}<br />
</style><br />
</html><br />
<br />
<div style="position:relative; margin-left: 175px; top:-250px; height:2700px; width:700px; color:black; font-size:10pt; font-family:Verdana" align="justify"><br />
<br><br />
<br />
=='''Recommended Bibliography for the Modelling Part'''==<br />
<br />
* Methods in Neuronal Modeling: From Synapses to Networks. Koch, Christof; Segev, Idan (ISBN: 0262111330 / 0-262-11133-0).<br />
<br />
* Parag G. Patil, David L. Brody, and David T. Yue (1998) Preferential Closed-State Inactivation<br />
of Neuronal Calcium Channels. Neuron, Vol. 20, 1027–1038.<br />
<br />
* Ronald F. Fox (1997) Stochastic Versions of the Hodgkin-Huxley Equations. Biophysical Journal Volume 72, 2068-2074.<br />
<br />
* William A. Catterall (2000) STRUCTURE AND REGULATION OF VOLTAGE-GATED Ca2+ CHANNELS. Annu. Rev. Cell Dev. Biol. 16:521–55.<br />
<br />
* Jiangjun Cui et al. Simulating calcium influx and free calcium concentrations in yeast. Cell Calcium 45 (2009) 123–132.</div>Emiliohttp://2009.igem.org/Team:Valencia/modellingbiblioTeam:Valencia/modellingbiblio2009-10-21T22:53:17Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1500px;<br />
}<br />
</style><br />
</html><br />
<br />
<div style="position:relative; margin-left: 175px; top:-250px; height:2700px; width:700px; color:black; font-size:10pt; font-family:Verdana" align="justify"><br />
<br><br />
<br />
==Recommended Bibliography for the Modelling Part==<br />
<br />
* Methods in Neuronal Modeling: From Synapses to Networks. Koch, Christof; Segev, Idan (ISBN: 0262111330 / 0-262-11133-0).<br />
<br />
* Parag G. Patil, David L. Brody, and David T. Yue (1998) Preferential Closed-State Inactivation<br />
of Neuronal Calcium Channels. Neuron, Vol. 20, 1027–1038.<br />
<br />
* Ronald F. Fox (1997) Stochastic Versions of the Hodgkin-Huxley Equations. Biophysical Journal Volume 72, 2068-2074.<br />
<br />
* William A. Catterall (2000) STRUCTURE AND REGULATION OF VOLTAGE-GATED Ca2+ CHANNELS. Annu. Rev. Cell Dev. Biol. 16:521–55.<br />
<br />
* Jiangjun Cui et al. Simulating calcium influx and free calcium concentrations in yeast. Cell Calcium 45 (2009) 123–132.</div>Emiliohttp://2009.igem.org/Team:Valencia/modellingbiblioTeam:Valencia/modellingbiblio2009-10-21T22:52:39Z<p>Emilio: New page: {{Template:Valencia09iGEM23}} <html> <style> #content{ height: 1500px; } </style> </html> <div style="position:relative; margin-left: 175px; top:-245px; height:2700px; ...</p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1500px;<br />
}<br />
</style><br />
</html><br />
<br />
<div style="position:relative; margin-left: 175px; top:-245px; height:2700px; width:700px; color:black; font-size:10pt; font-family:Verdana" align="justify"><br />
<br><br />
<br />
==Recommended Bibliography for the Modelling Part==<br />
<br />
Methods in Neuronal Modeling: From Synapses to Networks. Koch, Christof; Segev, Idan (ISBN: 0262111330 / 0-262-11133-0)<br />
<br />
Parag G. Patil, David L. Brody, and David T. Yue (1998) Preferential Closed-State Inactivation<br />
of Neuronal Calcium Channels. Neuron, Vol. 20, 1027–1038.<br />
<br />
Ronald F. Fox (1997) Stochastic Versions of the Hodgkin-Huxley Equations. Biophysical Journal Volume 72, 2068-2074.<br />
<br />
William A. Catterall (2000) STRUCTURE AND REGULATION OF VOLTAGE-GATED Ca2+ CHANNELS. Annu. Rev. Cell Dev. Biol. 16:521–55.<br />
<br />
Jiangjun Cui et al. Simulating calcium influx and free calcium concentrations in yeast. Cell Calcium 45 (2009) 123–132.</div>Emiliohttp://2009.igem.org/Team:Valencia/ModellingTeam:Valencia/Modelling2009-10-21T22:49:45Z<p>Emilio: </p>
<hr />
<div>{{Template:Valencia09iGEM23}}<br />
<html><br />
<style><br />
#content{<br />
height: 1550px;<br />
}<br />
</style><br />
</html><br />
<br />
<br><br />
<div align="justify" style="position:relative; margin-top:-260px; margin-left:190px; width:700px; font-size:10pt; font-family: Verdana"><br />
== '''Modelling''' ==<br />
<br><br />
<br />
Our aim in this part of the Project is the development of a model which describes how intracellular calcium concentration changes in time when we apply electrical stimulation, this is, a potential difference across the plasma membrane. We have considered very interesting to make different approaches to this problem: on the one hand, a deterministic model of the calcium influx through the voltage-dependent calcium channels (VDCCs) of excitable cells (neurons and muscle cells) and yeasts -based on the Hodgkin-Huxley model modified by Yamada et al [ISBN:0262111330]-, and, on the other hand, we have included stochastic methods for a further study of these gates, particularly of its activation/inactivation. We are working hard to offer you this model in an easy and clear way, also trying to allow you to interact with the system.<br />
<br><br><br />
*'''What are VDCCs?'''<br />
<br />
Living cells are surrounded by semipermeable membranes containing specialized proteins providing for exchange of various atoms and molecules between extracellular and intracellular spaces. Two basic mechanisms of <b>transmembrane transport</b> have been recognized: carriers and channels.<br />
<br />
[[Image:V_VDCCs.gif|300px|center]]<br />
<br />
Carriers, such as the Ca<sup>2+</sup> pump, Na<sup>+</sup>-Ca<sup>2+</sup> exchanger, or Na<sup>+</sup>-K<sup>+</sup> pump, transport ions against concentration and/or electrical gradients are coupled to metabolic energy consumption. Membrane <b>channels</b> are viewed as pores, which, when opened, allow passive transport downhill the electric and/or concentration gradients. Opening of a channel can be accomplished in two ways:<br><br />
#by binding of a specific ligand either directly to the channel or to another membrane protein coupled to the channel <br><br />
#by a change in <b>transmembrane voltage</b>.<br />
The first pathway is characteristic for ligand-gated channels, such as the glutamate or acetylcholine receptors. The second pathway activates the so-called <b>voltage-gated channels</b>. The foundation of biophysical analyses of voltage-gated ion channels was laid in the pioneering works of <b>Hodgkin and Huxley</b> in the 1930s and culminated in the 1950s by formulating the Hodgkin-Huxley model of action potential (Hodgkin and Huxley, 1952 [PMC1392413]). <br><br />
<b>Voltage-gated calcium channels</b> were first identified by Fatt and Katz (1953) [PMC1366030] in crustacean muscle. Then it was discovered that there are different channel subtypes in excitable cells and, some years later, it was accepted that there are analog calcium channels in yeast plasma membrane.<br />
<br><br><br />
<!--<br />
*'''Modelling Ionic Current Flow through VDCCs'''<br><br />
If we assume that the whole calcium currents occur through this calcium channels and that the instantaneous current-voltage relation is linear, we can describe the ionic current <i>I<sub>Ca</sub></i> by the Ohm's law:<br><br />
<br />
[[Image:eq1.jpg|center]]<br />
<br />
Where <i>g</i> is the conductance associated with the channel, <i>V</i> is the transmembrane potential and <i>E<sub>Ca</sub></i> is the Nerst potential, related to the different ionic concentration inside and outside the cell.<br />
<br><br />
Considering that these channels are only permeable to calcium and have two states -open or closed-, the total conductance associated with the population of VDCCs can be expressed as the maximal conductance [[Image:gbarra.jpg]] times the fraction of all channels that are open. This fraction is determined by hypothetical activation and inactivation variables <i>m</i> and <i>h</i>, which depend on voltage and time:<br />
<br />
[[Image:eq2.jpg|center]]<br />
[[Image:2.1.jpg|center]]<br />
<br />
[[Image:Minf.jpg]] is the steady-state value of ''m'' and [[Image:Taum.jpg]] is the time constant. They are defined functions of voltage:<br />
<br />
[[Image:2.1.1.jpg|center]]<br />
[[Image:2.1.2.jpg|center]]<br />
<br />
<br />
<br />
<br />
<br />
[[Image:2.2.jpg|center]]<br />
[[Image:2.3.jpg|center]]<br />
<br />
<i>K</i> is the halfway inactivation concentration and <i>[Ca<sup>2+</sup>]<sub>o</sub></i> is the constant extracellular calcium concentration.<br />
<br />
<br />
Now, we have to model how transmembrane potential changes in time. To do this, we can consider the following membrane-equivalent electrial circuit, where all ionic currents involved in initiation and propagation of the action potential are represented:<br />
<br />
[[Image:V_circuit.gif|center]]<br />
<br />
We can know the transmembrane potential at any time after applying an electrical input by solving this equation:<br />
<br />
[[Image:eq3.jpg|center]]<br />
<br />
However, we have assumed that our stimulus triggers the excitatory post-synaptic potential (EPSP), so it's not necessary to solve the previous equation. But modelling the calcium influx is only the first step...<br />
<br><br><br />
*'''Modelling Free Intracellular Calcium Concentration'''<br><br />
The change in free intracellular calcium concentration is mostly due to the influx of calcium ions described above, but there are several factors which also contribute. For instance, we have considered calcium buffers and calcium remove by membrane pumps.<br />
<br />
**<u>Calcium current</u><br><br />
The relation between the calcium inward current <i>I<sub>Ca</sub></i> and the change in intracellular calcium concentration is given by:<br />
<br />
[[Image:eq4.jpg|center]]<br />
<br />
<i>F</i> is the Faraday's constant, <i>[Ca<sup>2+</sup>]</i> is the calcium concentration just below the plasma membrane and <i>Vol</i> is the cell volume considered. <br />
<br />
[[Image:V_CaCurrent.jpg|250px|center]]<br />
<br />
**<u>Calcium buffers</u><br />
At this point we have taken into account the presence of calcium buffers such as calmodulin, calcineurin, calbindin, and other ones in the cell. To make the model easier, we have assumed that calcium binds to a single binding site on a single buffer as it is expressed here:<br />
<br />
[[Image:V_Buffer.jpg|150px|center]]<br />
<br />
<i>f</i> and <i>b</i> are the forward and backward rates of the binding reaction:<br />
<br />
[[Image:eq5.jpg|center]]<br />
<br />
[[Image:V_Buffer2.jpg|300px|center]]<br />
<br />
**<u>Calcium pumps</u><br />
Once the buffering system has reduced the amount of free intracellular calcium, the remaining calcium ions must be removed from the cell in order to maintain calcium homeostasis. We have described the behaviour of calcium pumps by the following first-order equation:<br />
<br />
[[Image:eq6.jpg|center]]<br />
<br />
Where <i>[Ca<sup>2+</sup>]<sub>eq</sub></i> is the equilibrium concentration of the pump, <i>[Ca<sup>2+</sup>]</i> is the calcium concentration in the shell just below the membrane and <i>t<sub>pump</sub></i> is the pump's time constant, which depends on voltage:<br />
<br />
[[Image:6.1.jpg|center]]<br />
<br />
[[Image:V_Pump.jpg|200px|center]]<br />
<br />
We have neglected the intracellular diffusion of calcium due to the different concentrations between the inner perimembranal area and deeper areas of the citoplasm, we have considered that the calcium release from intracellular organelles (for instance, endoplasmic reticulum and mitochondria) may reduce these concentration differences. Thus, we assume the calcium concentration just below the plasma membrane as whole intracellular calcium.--><br />
<br />
Some recommended bibliography for this part of the project can be consulted [https://2009.igem.org/Team:Valencia/modellingbiblio here]<br />
<br />
<!-- <div style="position:absolute;top:250px;left:120px"> --><br />
<!-- [[Image:CommingsoonProject.jpg|300px]] --><br />
<!-- </div> --></div>Emiliohttp://2009.igem.org/Template:Valencia09iGEM65Template:Valencia09iGEM652009-10-21T22:32:24Z<p>Emilio: </p>
<hr />
<div><center><html><br />
<style><br />
<br />
<br />
<br />
/*-----------------------------------------------------------------------------------------------*/<br />
div.MenuBar ul li ul.DropDownMenu {<br />
display: none; /* Hides all drop-down menus. */<br />
<br />
}<br />
/*<br />
li:hover works in IE7 and FF2.<br />
a:hover works in IE6 and FF2.<br />
a:hover breaks li:hover in FF2.<br />
*/<br />
div.MenuBar ul li:hover ul.DropDownMenu li ul.SideMenu,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a ul.SideMenu {<br />
display: none; /* Hides all side menus. */<br />
}<br />
/*------------------------------------------------------------------------------------- Menu Bar */<br />
<br />
div.MenuBar {<br />
font: arial, verdana, sans-serif;<br />
height: 31px;<br />
width: 728px;<br />
/*width: 100%;*/<br />
margin: 0;<br />
border-top: 0;<br />
border-right: 0;<br />
border-left: 0;<br />
padding: 0;<br />
background: red; <br />
}<br />
<br />
div.MenuBar ul {<br />
font: arial, verdana, sans-serif;<br />
text-align: center; <br />
list-style-type: none;<br />
margin: 0em auto;<br />
padding: 0;<br />
background: red;<br />
}<br />
div.MenuBar ul li {<br />
font: arial, helvetica, sans-serif;<br />
display: block;<br />
padding: 0;<br />
margin: 0;<br />
font-size: 1.3em;<br />
float: left;<br />
background: none;<br />
text-align: center;<br />
width: 142px;<br />
position: relative; /* Sets the positioning context for each drop-down menu. */<br />
}<br />
<br />
div.MenuBar ul li a {<br />
font: arial, helvetica, sans-serif;<br />
display: block;<br />
background: none;<br />
height: 23px; /* Keep height + padding-top + padding-bottom sync with the menu bar height. */<br />
color: #000000;<br />
padding-top: 5px;<br />
padding-bottom: 5px;<br />
padding-left: 0.5em; /* Sets the left space between top-level items. */<br />
padding-right: 0.5em; /* Sets the right space between top-level items. */<br />
text-decoration: none;<br />
}<br />
<br />
/*------------------------------------------------------------------------------ Drop-Down Menus */<br />
div.MenuBar ul li:hover ul.DropDownMenu,<br />
div.MenuBar ul li a:hover ul.DropDownMenu {<br />
display: block;<br />
width: 7.5em; /* Drop-down menu width.<br />
Use MenuTailor.css to customize. */<br />
height: 1em;<br />
padding: 1px; /* Sets the drop-down menu "effective border" width. */<br />
position: absolute; <br />
top: 23px; /* Places the drop-down menu under the menu bar.<br />
Keep it sync with the menu bar height. */<br />
left: 0; /* Aligns the drop-down menu to its top-level item. */<br />
background-color: #2b3238; /* Selected item. */<br />
color: red;<br />
<br />
}<br />
div.MenuBar ul li:hover ul.DropDownMenu li a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a {<br />
width: 7.5em; /* Keep it sync with the drop-down menu width.<br />
Use MenuTailor.css to customize. */<br />
height: 1em;<br />
padding-left: 0;<br />
padding-right: 0;<br />
background-color: #2b3238; /* Selected item. */<br />
color: red;<br />
}<br />
ul.DropDownMenu li a span {<br />
display: block;<br />
padding-left: 0.25em; /* Sets the left space of each drop-down menu item. */<br />
padding-right: 0.25em; /* Sets the right space of each drop-down menu item. */<br />
text-align: right; /* Aligns the >> symbol to the right. */<br />
}<br />
ul.DropDownMenu li a span span {<br />
float: left; /* Aligns the text (back) to the left. */<br />
font: 12px arial, helvetica, sans-serif; /* Required for IE55. */<br />
height: 20px;<br />
color: red;<br />
}<br />
/*----------------------------------------------------------------------------------- Side Menus */<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {<br />
display: block;<br />
width: 10.5em; /* Side menu width.<br />
Use MenuTailor.css to customize. */<br />
height: 1.25em;<br />
padding: 2px; /* Sets the side menu "effective border" width. */<br />
position: absolute;<br />
top: -7.5px; /* Aligns the side menu to its drop-down menu item.<br />
Keep it sync with the side menu "effective border" width. */<br />
left: 9.75em; /* Places the side menu to the right of the drop-down menu.<br />
Keep it sync with the drop-down menu width.<br />
Use MenuTailor.css to customize. */<br />
}<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {<br />
width: 10.5em; /* Keep it sync with the side menu width.<br />
Use MenuTailor.css to customize. */<br />
height: 1.25em;<br />
font: 12px arial, helvetica, sans-serif; /* Required for IE55. */<br />
left: 9.75em; /* Places the side menu to the right of the drop-down menu.<br />
Keep it sync with the drop-down menu width.<br />
Use MenuTailor.css to customize. */<br />
}<br />
div.MenuBar ul li ul.DropDownMenu li ul.SideMenu li a span {<br />
padding-left: 0.5em; /* Sets the left space of each side menu item. */<br />
padding-right: 0.1em; /* Sets the right space of each side menu item. */<br />
text-align: left;<br />
font: 12px arial, helvetica, sans-serif; /* Required for IE55. */<br />
left: 9.75em; /* Places the side menu to the right of the drop-down menu.<br />
Keep it sync with the drop-down menu width.<br />
Use MenuTailor.css to customize. */<br />
}<br />
/*----------------------------------------------------------------------------- Browser Specific */<br />
* html div.MenuBar {<br />
position: relative; /* For IE55 and IE6.<br />
Hidden (* html) from non-IE browsers. */<br />
}<br />
* html div.MenuBar ul li a {<br />
float: left; /* For IE55 and IE6.<br />
Breaks O9.<br />
Hidden (* html) from non-IE browsers. */<br />
}<br />
* html ul.DropDownMenu li a:hover {<br />
cursor: hand; /* For IE55.<br />
Hidden (* html) from non-IE browsers. */<br />
}<br />
ul.DropDownMenu li a:hover {<br />
cursor: pointer; /* For IE6 and IE7.<br />
Hidding it (* html) from non-IE browsers breaks IE7! */<br />
}<br />
* html div.MenuBar a:hover {<br />
text-decoration: none; /* For IE55 and IE6.<br />
Hidden (* html) from non-IE browsers. */<br />
}<br />
* html div.MenuBar ul li table,<br />
* html div.MenuBar ul li table td {<br />
border: 0px none; /* For IE55 and IE6.<br />
Hidden (* html) from non-IE browsers. */<br />
}<br />
/*------------------------------------------------------------------------------- Default Colors */<br />
div.MenuBar {<br />
background-color: Menu;<br />
border-bottom: 0px ButtonShadow;<br />
}<br />
div.MenuBar a {<br />
background-color: none; /* Top-level unselected items. */<br />
color: red;<br />
}<br />
div.MenuBar ul li:hover a,<br />
div.MenuBar ul li a:hover {<br />
color:red;<br />
background-color: none; /* Top-level selected item. */<br />
color: red;<br />
}<br />
/*...............................................................................................*/<br />
div.MenuBar ul li:hover ul.DropDownMenu,<br />
div.MenuBar ul li a:hover ul.DropDownMenu {<br />
background-color: none; /* Sets the drop-down menu "effective border" color. */<br />
}<br />
div.MenuBar ul li:hover ul.DropDownMenu li a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a {<br />
background-color: none; Drop-down menu unselected items.<br />
Sets the drop-down menu "effective background" color. */<br />
color: none;<br />
}<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover {<br />
background-color: none; /* Drop-down menu selected item. */<br />
color: none;<br />
}<br />
/*...............................................................................................*/<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {<br />
background-color: none; /* Sets the side menu "effective border" color. */<br />
}<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {<br />
background-color: none; /* Side menu unselected items.<br />
Sets the side menu "effective background" color. */<br />
color: none;<br />
}<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {<br />
background-color: Highlight; /* Side menu selected item. */<br />
color: red; <br />
}<br />
/*-----------------------------------------------------------------------------------------------*/<br />
/*Script-Free 3-Level Menu 1.2 Tailor<br />
www.CesarDaniel.info<br />
/*-------------------------------------------------------------------------------------- General */<br />
body {<br />
background: white;<br />
color: #2b3238;<br />
margin: 0;<br />
border: 0;<br />
padding: 0;<br />
}<br />
<br />
<br />
div.MenuBar {<br />
font: 13px arial, helvetica, sans-serif;<br />
}<br />
div.MenuBar ul {<br />
font: 13px arial, helvetica, sans-serif; /* Required for IE55. */<br />
}<br />
/*--------------------------------------------------------------------------------------- Colors */<br />
div.MenuBar {<br />
background-color: #b0b0b0; /* Selected item. */<br />
color: none;<br />
border-bottom: 1px solid ButtonShadow;<br />
}<br />
div.MenuBar a,<br />
div.MenuBar ul li:hover ul.DropDownMenu li a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a,<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {<br />
background-color: red; /* Selected item. */<br />
color: red;<br />
}<br />
div.MenuBar ul li:hover a,<br />
div.MenuBar ul li a:hover,<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover a,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover,<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {<br />
background-color: red; /* Selected item. */<br />
color: #24006B;<br />
}<br />
div.MenuBar ul li:hover ul.DropDownMenu,<br />
div.MenuBar ul li a:hover ul.DropDownMenu,<br />
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,<br />
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {<br />
background-color: red; /* Sets the drop-down and side menus "effective border" color. */<br />
}<br />
/*--------------------------------------------------------------------------------------- Widths */<br />
/*<br />
<br />
/*<br />
Menu Bar 1<br />
Drop-Down Menu #2<br />
*/<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4,<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4 li a,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4 li a {<br />
width: 11em; /* Drop-down menu width. */<br />
}<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5,<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5 li a,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5 li a {<br />
width: 12em; /* Drop-down menu width. */<br />
}<br />
<br />
/*...............................................................................................*/<br />
/*<br />
Menu Bar 1<br />
Drop-Down Menu #2<br />
Side Menu #1<br />
*/<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 {<br />
left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.<br />
Keep it sync with the drop-down menu width. */<br />
}<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1,<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1 li a,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 li a {<br />
width: 10em; /* Side menu width. */<br />
}<br />
/*...............................................................................................*/<br />
/*<br />
Menu Bar 1<br />
Drop-Down Menu #2<br />
Side Menu #2<br />
*/<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 {<br />
left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.<br />
Keep it sync with the drop-down menu width. */<br />
}<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2,<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2 li a,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 li a {<br />
width: 10em; /* Side menu width. */<br />
}<br />
/*...............................................................................................*/<br />
/*<br />
Menu Bar 1<br />
Drop-Down Menu #2<br />
Side Menu #3<br />
*/<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 {<br />
left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.<br />
Keep it sync with the drop-down menu width. */<br />
}<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3,<br />
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3 li a,<br />
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 li a {<br />
width: 10em; /* Side menu width. */<br />
}<br />
/*...............................................................................................*/<br />
<br />
</style><br />
<br />
<br />
<body><br />
<br />
<div class='MenuBar' id="navi"><br />
<ul><br />
<li><br />
<a href="https://2009.igem.org/Team:Valencia/home" style="font-weight: bold; background: url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif)">Home<br />
<!--[if gt IE 6]><!--></a><!--<![endif]--><br />
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--><br />
<!--[if lte IE 6]></td></tr></table></a><![endif]--><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:Valencia/TeamVal" style="font-weight: bold; background: url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif)">Team<!--<br />
[if gt IE 6]><!--></a><!--<![endif]--><br />
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--><br />
<!--[if lte IE 6]></td></tr></table></a><![endif]--><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:Valencia/Project" style="font-weight: bold; background: url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif)">Project<!--[if gt IE 6]><!--></a><!--<![endif]--><br />
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--><br />
<!--[if lte IE 6]></td></tr></table></a><![endif]--><br />
</li><br />
<br />
<li style="width: 160px"><br />
<a href="https://2009.igem.org/Team:Valencia/Human" style="font-weight: bold; background: url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif)">Human Practices<!--[if gt IE 6]><!--></a><!--<![endif]--><br />
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--><br />
<!--[if lte IE 6]></td></tr></table></a><![endif]--><br />
</li><br />
<li><br />
<br />
<a href="https://2009.igem.org/Team:Valencia/Project/Results" style="font-weight: bold; background: url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif)">Achievements<br />
<!--[if gt IE 6]><!--></a><!--<![endif]--><br />
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]--><br />
<!--[if lte IE 6]></td></tr></table></a><![endif]--><br />
</li><br />
<br />
<br />
<br />
</ul><br />
<br />
</div><br />
</body><br />
</html><br />
</center></div>Emiliohttp://2009.igem.org/Template:Valencia09iGEM23Template:Valencia09iGEM232009-10-21T22:31:17Z<p>Emilio: </p>
<hr />
<div>__NOTOC__<br />
<html><br />
<head><br />
<style type="text/css"><br />
<br />
body.mediawiki {background:#000 url(https://static.igem.org/mediawiki/2009/5/51/ValenciaBordeado4.JPG) top center repeat-y;<br />
font-family:Gill Sans / Gill Sans MT, 'Lucida Sans Unicode', 'Lucida Grande', sans-serif; color:#202020;}<br />
<br />
<br />
#content { <br />
background-color: white; <br />
height: 1500px; <br />
}<br />
<br />
<br />
#header {<br />
width: 964px;<br />
height: 340px;<br />
position: relative;<br />
text-decoration: none;<br />
top:7px;<br />
left:7px;<br />
background: url(https://static.igem.org/mediawiki/2009/3/3c/Valencia_Portadita.jpg) no-repeat left top;<br />
}<br />
<br />
<!-- /*reset*/ --><br />
p {<br />
margin:0;<br />
}<br />
<br />
.editsection {<br />
font-size: 75%;<br />
font-weight: bold;<br />
}<br />
<br />
body {<br />
background: white;<br />
font-family: Tahoma,Helvetica,Arial,Verdana,sans-serif;<br />
line-height: 1.5;<br />
color: #222;<br />
<br />
}<br />
<br />
/* hide table of contents */<br />
toc {<br />
display: none;<br />
}<br />
<br />
h1 {<br />
font-size: 160%;<br />
}<br />
<br />
/* add margin beneath a paragraph */<br />
p {<br />
margin-bottom: 10px;<br />
} <br />
<br />
.today {<br />
background-color: #ccc;<br />
}<br />
/* link color */<br />
a, a:visited {<br />
color: #27809f;<br />
}<br />
a:hover {<br />
color: #00a7e7;<br />
text-decoration: none;<br />
}<br />
ul {<br />
margin-bottom: 5px;<br />
}<br />
<br />
#element {<br />
overflow: hidden;<br />
}<br />
<br />
.gallery {<br />
max-width: 550px;<br />
margin: 10px 2px !important;<br />
}<br />
<br />
.gallerytext {<br />
text-align: left;<br />
}<br />
.footnote {<br />
text-align: left;<br />
font-size: smaller;<br />
}<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* menu left */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
#menu {<br />
width: 158px;<br />
margin: 10px 13px 0 7px;<br />
position: relative;<br />
float: left;<br />
}<br />
<br />
#menu a {<br />
display: block;<br />
background: #0174DF url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif) no-repeat center left;<br />
color: #FFFFFF;<br />
padding: 5px 0 5px 5px;<br />
margin: 0 0 1px 0;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:hover {<br />
color: #000000;<br />
background: #58ACFA url(https://static.igem.org/mediawiki/2009/6/65/Back2.gif) repeat center left;<br />
}<br />
<br />
#menu .selflink {<br />
display: block;<br />
background: #FFCC66 url(https://static.igem.org/mediawiki/2009/6/65/Back2.gif) repeat center left;<br />
color: #000000;<br />
font-weight: normal;<br />
padding: 5px 0 5px 5px;<br />
margin: 0 0 1px 0;<br />
text-decoration: none;<br />
}<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* content area */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* general stuff */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
/*turn off title at top.*/<br />
.firstHeading{width: 0px;<br />
height: 0px;<br />
margin-bottom: 0px;<br />
display: none;<br />
position: relative;<br />
top:0;<br />
left:0;<br />
margin:0;<br />
<br />
} <br />
<br />
#contentSub {display:none;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
body{margin:0;<br />
padding:0;}<br />
<br />
.noborder{border-top:0px;}<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* sidebar right */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
#sidebar {<br />
width: 172px;<br />
margin: 20px 7px 0 13px;<br />
position: relative;<br />
float: left;<br />
text-align: right;<br />
}<br />
<br />
#sidebar_extra {<br />
margin-top: 0px;<br />
}<br />
<br />
#sidebar ul {<br />
padding: 0;<br />
margin: 0;<br />
list-style: none;<br />
}<br />
<br />
.section_box {<br />
margin: 0px;<br />
padding: 5px;<br />
border: 1px dashed #FF6600;<br />
background: #FFFFFF;<br />
}<br />
.subtitle {<br />
padding-bottom: 6px;<br />
font-size: 14px;<br />
font-weight: bold;<br />
color: #08088A;<br />
font-family: Verdana<br />
<br />
}<br />
<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* menu left */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
a.side-link:link, a.side-link:active, a.side-link:visited, a.side-link:hover{border:1px solid #ececec}<br />
<br />
#content{<br />
padding: 0px 10px 0px 0px; <br />
}<br />
#footer-box {<br />
background: white;<br />
font-size:14px;<br />
border-color: white;<br />
font-family: Verdana;<br />
width: 963px;<br />
margin-left: 143px;<br />
} <br />
<br />
</style><br />
</head><br />
<br />
</html><br />
<!-- *** HEADER *** --><br />
<div id="header"><br />
<div id="header_left"><span class="plainlinks">[https://2009.igem.org/Team:Valencia/home &nbsp; ]</span></div><br />
<div id="header_middle"><span class="plainlinks">[https://2009.igem.org/Team:Valencia/home &nbsp; ]</span></div><br />
<div id="header_bar_link"><br />
</div></div><!--end header--><br />
<html><br />
<!-- *** LEFTSIDEMENU *** --><br />
<div id="menu" background-color:#bfe2f9;> <br />
<br />
</html><br />
<span style="align:center; font-size:10pt; font-family: Verdana"> <br />
[[Team:Valencia/home | Home]]<br />
[[Team:Valencia/Project | Project description]]<br />
[[Team:Valencia/Project/Results | Achievements]]<br />
<br />
<div class="subtitle">Team</div><br />
[[Team:Valencia/TeamVal | The Team]]<br />
[[Team:Valencia/LabPictures | Gallery of Pics]]<br />
[[Team:Valencia/Universities | The Universities]]<br />
[[Team:Valencia/Acknowledgements | Acknowledgements]]<br />
<br />
<div class="subtitle">LEC construction: WetLab</div><br />
[[Team:Valencia/WetLab/YeastTeam | Overview]]<br />
[[Team:Valencia/WetLab/YeastTeam/Experimental | Material and Methods]]<br />
[[Team:Valencia/WetLab/YeastTeam/Results | Experimental Results]]<br />
[[Team:Valencia/A_short_story | Discovery of Aequorin]]<br />
<br />
<div class="subtitle">LEC analysis: Modelling</div><br />
[[Team:Valencia/Modelling | Overview]]<br />
[[Team:Valencia/OurModel | Model Description]]<br />
[[Team:Valencia/Simulations | Simulations]]<br />
[[Team:Valencia/StochasticApproach | Stochastic Approach]]<br />
<br />
<div class="subtitle">iLCD construction</div><br />
[[Team:Valencia/Hardware | LEC activation]]<br />
[[Team:Valencia/Hardware/iLCD | iLCD: LEC array]]<br />
<br />
<div class="subtitle">Human Practices</div><br />
[[Team:Valencia/Human | Ethics Overwiew]]<br />
[[Team:Valencia/Human_Practice/Medalls | Medals]]<br />
[[Team:Valencia/safety | Safety]]<br />
[[Team:Valencia/Definitions | Survey's SB definitions]]<br />
<br />
<div class="subtitle">Parts</div><br />
[[Team:Valencia/Parts | Submitted BioBricks]]<br />
[[Team:Valencia/Parts/Characterization | Characterization]]<br />
[[Team:Valencia/Notebook | Notebook]]<br />
<html><br />
</div><br />
<!--end links div--><br />
</div><br />
<!--end leftsidemenu--><br />
</html><br />
<br />
<br />
<html><br />
<br />
<body><br />
<div style="position:relative; top:1020px; left:-241px;"><br />
<div id = "clustrback" style="margin: 200 auto; width:298px; height:219px; overflow:hidden"><br />
<a href="http://www3.clustrmaps.com/counter/maps.php?url=https://2009.igem.org/Team:Valencia" style="width:160px; display:block; margin: 0 auto;" id="clustrMapsLink"> <br />
<img src="http://www3.clustrmaps.com/counter/index2.php?url=https://2009.igem.org/Team:Valencia" style="border:1px; margin: 200 auto; alt="Locations of visitors to iGEM09 Valencia" title="Locations of visitors to iGEM09 Valencia" id="clustrMapsImg" class="reflect rheight60 ropacity60"/><br />
</a><br />
</div><br />
</div><br />
<div><br />
<br />
</div><br />
</body><br />
</html></div>Emiliohttp://2009.igem.org/Template:Valencia09iGEM23Template:Valencia09iGEM232009-10-21T22:29:26Z<p>Emilio: </p>
<hr />
<div>__NOTOC__<br />
<html><br />
<head><br />
<style type="text/css"><br />
<br />
body.mediawiki {background:#000 url(https://static.igem.org/mediawiki/2009/5/51/ValenciaBordeado4.JPG) top center repeat-y;<br />
font-family:Gill Sans / Gill Sans MT, 'Lucida Sans Unicode', 'Lucida Grande', sans-serif; color:#202020;}<br />
<br />
<br />
#content { <br />
background-color: white; <br />
height: 1500px; <br />
}<br />
<br />
<br />
#header {<br />
width: 964px;<br />
height: 340px;<br />
position: relative;<br />
text-decoration: none;<br />
top:7px;<br />
left:7px;<br />
background: url(https://static.igem.org/mediawiki/2009/3/3c/Valencia_Portadita.jpg) no-repeat left top;<br />
}<br />
<br />
<!-- /*reset*/ --><br />
p {<br />
margin:0;<br />
}<br />
<br />
.editsection {<br />
font-size: 75%;<br />
font-weight: bold;<br />
}<br />
<br />
body {<br />
background: white;<br />
font-family: Tahoma,Helvetica,Arial,Verdana,sans-serif;<br />
line-height: 1.5;<br />
color: #222;<br />
<br />
}<br />
<br />
/* hide table of contents */<br />
toc {<br />
display: none;<br />
}<br />
<br />
h1 {<br />
font-size: 160%;<br />
}<br />
<br />
/* add margin beneath a paragraph */<br />
p {<br />
margin-bottom: 10px;<br />
} <br />
<br />
.today {<br />
background-color: #ccc;<br />
}<br />
/* link color */<br />
a, a:visited {<br />
color: #27809f;<br />
}<br />
a:hover {<br />
color: #00a7e7;<br />
text-decoration: none;<br />
}<br />
ul {<br />
margin-bottom: 5px;<br />
}<br />
<br />
#element {<br />
overflow: hidden;<br />
}<br />
<br />
.gallery {<br />
max-width: 550px;<br />
margin: 10px 2px !important;<br />
}<br />
<br />
.gallerytext {<br />
text-align: left;<br />
}<br />
.footnote {<br />
text-align: left;<br />
font-size: smaller;<br />
}<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* menu left */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
#menu {<br />
width: 158px;<br />
margin: 10px 13px 0 7px;<br />
position: relative;<br />
float: left;<br />
}<br />
<br />
#menu a {<br />
display: block;<br />
background: #0174DF url(https://static.igem.org/mediawiki/2009/0/09/Bg2.gif) no-repeat center left;<br />
color: #FFFFFF;<br />
padding: 5px 0 5px 5px;<br />
margin: 0 0 1px 0;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:hover {<br />
color: #000000;<br />
background: #58ACFA url(https://static.igem.org/mediawiki/2009/6/65/Back2.gif) repeat center left;<br />
}<br />
<br />
#menu .selflink {<br />
display: block;<br />
background: #FFCC66 url(https://static.igem.org/mediawiki/2009/6/65/Back2.gif) repeat center left;<br />
color: #000000;<br />
font-weight: normal;<br />
padding: 5px 0 5px 5px;<br />
margin: 0 0 1px 0;<br />
text-decoration: none;<br />
}<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* content area */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* general stuff */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
/*turn off title at top.*/<br />
.firstHeading{width: 0px;<br />
height: 0px;<br />
margin-bottom: 0px;<br />
display: none;<br />
position: relative;<br />
top:0;<br />
left:0;<br />
margin:0;<br />
<br />
} <br />
<br />
#contentSub {display:none;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
body{margin:0;<br />
padding:0;}<br />
<br />
.noborder{border-top:0px;}<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* sidebar right */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
#sidebar {<br />
width: 172px;<br />
margin: 20px 7px 0 13px;<br />
position: relative;<br />
float: left;<br />
text-align: right;<br />
}<br />
<br />
#sidebar_extra {<br />
margin-top: 0px;<br />
}<br />
<br />
#sidebar ul {<br />
padding: 0;<br />
margin: 0;<br />
list-style: none;<br />
}<br />
<br />
.section_box {<br />
margin: 0px;<br />
padding: 5px;<br />
border: 1px dashed #FF6600;<br />
background: #FFFFFF;<br />
}<br />
.subtitle {<br />
padding-bottom: 6px;<br />
font-size: 14px;<br />
font-weight: bold;<br />
color: #08088A;<br />
font-family: Verdana<br />
<br />
}<br />
<br />
<br />
/*----------------------------------------------------------------------------*/<br />
/* menu left */<br />
/*----------------------------------------------------------------------------*/<br />
<br />
a.side-link:link, a.side-link:active, a.side-link:visited, a.side-link:hover{border:1px solid #ececec}<br />
<br />
#content{<br />
padding: 0px 10px 0px 0px; <br />
}<br />
#footer-box {<br />
background: white;<br />
font-size:14px;<br />
border-color: white;<br />
font-family: Verdana;<br />
width: 963px;<br />
margin-left: 143px;<br />
} <br />
<br />
</style><br />
</head><br />
<br />
</html><br />
<!-- *** HEADER *** --><br />
<div id="header"><br />
<div id="header_left"><span class="plainlinks">[https://2009.igem.org/Team:Valencia &nbsp; ]</span></div><br />
<div id="header_middle"><span class="plainlinks">[https://2009.igem.org/Team:Valencia &nbsp; ]</span></div><br />
<div id="header_bar_link"><br />
</div></div><!--end header--><br />
<html><br />
<!-- *** LEFTSIDEMENU *** --><br />
<div id="menu" background-color:#bfe2f9;> <br />
<br />
</html><br />
<span style="align:center; font-size:10pt; font-family: Verdana"> <br />
[[Team:Valencia/home | Home]]<br />
[[Team:Valencia/Project | Project description]]<br />
[[Team:Valencia/Project/Results | Achievements]]<br />
<br />
<div class="subtitle">Team</div><br />
[[Team:Valencia/TeamVal | The Team]]<br />
[[Team:Valencia/LabPictures | Gallery of Pics]]<br />
[[Team:Valencia/Universities | The Universities]]<br />
[[Team:Valencia/Acknowledgements | Acknowledgements]]<br />
<br />
<div class="subtitle">LEC construction: WetLab</div><br />
[[Team:Valencia/WetLab/YeastTeam | Overview]]<br />
[[Team:Valencia/WetLab/YeastTeam/Experimental | Material and Methods]]<br />
[[Team:Valencia/WetLab/YeastTeam/Results | Experimental Results]]<br />
[[Team:Valencia/A_short_story | Discovery of Aequorin]]<br />
<br />
<div class="subtitle">LEC analysis: Modelling</div><br />
[[Team:Valencia/Modelling | Overview]]<br />
[[Team:Valencia/OurModel | Model Description]]<br />
[[Team:Valencia/Simulations | Simulations]]<br />
[[Team:Valencia/StochasticApproach | Stochastic Approach]]<br />
<br />
<div class="subtitle">iLCD construction</div><br />
[[Team:Valencia/Hardware | LEC activation]]<br />
[[Team:Valencia/Hardware/iLCD | iLCD: LEC array]]<br />
<br />
<div class="subtitle">Human Practices</div><br />
[[Team:Valencia/Human | Ethics Overwiew]]<br />
[[Team:Valencia/Human_Practice/Medalls | Medals]]<br />
[[Team:Valencia/safety | Safety]]<br />
[[Team:Valencia/Definitions | Survey's SB definitions]]<br />
<br />
<div class="subtitle">Parts</div><br />
[[Team:Valencia/Parts | Submitted BioBricks]]<br />
[[Team:Valencia/Parts/Characterization | Characterization]]<br />
[[Team:Valencia/Notebook | Notebook]]<br />
<html><br />
</div><br />
<!--end links div--><br />
</div><br />
<!--end leftsidemenu--><br />
</html><br />
<br />
<br />
<html><br />
<br />
<body><br />
<div style="position:relative; top:1020px; left:-241px;"><br />
<div id = "clustrback" style="margin: 200 auto; width:298px; height:219px; overflow:hidden"><br />
<a href="http://www3.clustrmaps.com/counter/maps.php?url=https://2009.igem.org/Team:Valencia" style="width:160px; display:block; margin: 0 auto;" id="clustrMapsLink"> <br />
<img src="http://www3.clustrmaps.com/counter/index2.php?url=https://2009.igem.org/Team:Valencia" style="border:1px; margin: 200 auto; alt="Locations of visitors to iGEM09 Valencia" title="Locations of visitors to iGEM09 Valencia" id="clustrMapsImg" class="reflect rheight60 ropacity60"/><br />
</a><br />
</div><br />
</div><br />
<div><br />
<br />
</div><br />
</body><br />
</html></div>Emilio