http://2009.igem.org/wiki/index.php?title=Special:Contributions/Ocortes&feed=atom&limit=50&target=Ocortes&year=&month=2009.igem.org - User contributions [en]2024-03-28T23:20:30ZFrom 2009.igem.orgMediaWiki 1.16.5http://2009.igem.org/Team:Alberta/Project/Modeling/FindMinimalGenomesTeam:Alberta/Project/Modeling/FindMinimalGenomes2009-10-22T00:41:29Z<p>Ocortes: </p>
<hr />
<div> function [MinimalGenomes, UnEssentialGeneLists, Models] = FindMinimalGenomes(TheModel, NumberOfMinGenomes, FinalGrowthRate, <br>IterationsPerList, FirstThreshold)<br />
%NumberOfMinGenomes: Number of minimal genomes you want the code to find (since there are many possible minimal genomes)<br />
%FinalGrowthRate: is what the final growth rate will apporximately be. Lower values result in a lower final<br />
%growth rate, but this allows for more genes to be deleted (resulting in a smaller allowable minimal genome).<br />
%FirstThreshold: This is the threshold growth rate for the first iteration of gene deletions.<br />
<br />
disp('May take 5 mins per NumberOfMinGenomes (default is 1 list)')<br />
solutionI = optimizeCbModel(TheModel);<br />
InitialGrowthRate = solutionI.f;<br />
<br />
%Input/Output Error Checking<br />
<br />
if nargout == 0<br />
error('You must have at least 1 output argument! For example: MinGenomes = FindMinimalGenomes(model)')<br />
end<br />
if nargin >=3<br />
if FinalGrowthRate > InitialGrowthRate<br />
disp(['FinalGrowthRate (set by you): ' num2str(FinalGrowthRate)]);<br />
error('The FinalGrowthRate must be less than the InitialGrowthRate')<br />
end<br />
end<br />
if nargin >=4<br />
if IterationsPerList < 1<br />
error('IterationsPerList must be greater than or equal to 1!')<br />
end<br />
end<br />
if nargin == 5<br />
if FirstThreshold >= InitialGrowthRate<br />
error('FirstThreshold must be less than the InitialGrowthRate')<br />
end<br />
end<br />
<br />
%Initialization of variables<br />
<br />
switch nargin<br />
case 1<br />
FinalGrowthRate = 0.2;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
n = 2; IterationsPerList = n+1 ; % n = 2 results in 3 iterations of gene filtering. <br />
NumberOfMinGenomes = 1;<br />
case 2<br />
FinalGrowthRate = 0.2;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
n = 2; IterationsPerList = n+1 ; <br />
case 3<br />
FinalGrowthRate;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
n = 2; IterationsPerList = n+1; <br />
case 4<br />
if rem(IterationsPerList,1) ~= 0<br />
error('IterationsPerList must be an integer')<br />
end<br />
FinalGrowthRate;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
if IterationsPerList == 1<br />
n = 0.000000001; %Causes only 1 iteration & prevents division by 0 (which only Chuck Norris can do).<br />
else<br />
n = IterationsPerList-1;<br />
end<br />
case 5<br />
if rem(IterationsPerList,1) ~= 0<br />
error('IterationsPerList must be an integer')<br />
end<br />
FinalGrowthRate;<br />
FirstThreshold;<br />
if IterationsPerList == 1<br />
n = 0.000000001; %to cause only 1 iteration & to prevent division by 0<br />
else<br />
n = IterationsPerList-1;<br />
if FirstThreshold < FinalGrowthRate<br />
error('FirstThreshold must be greater than FinalGrowthRate')<br />
end<br />
end<br />
otherwise<br />
error('Too many input arguments! Sorry, try again!')<br />
end<br />
<br />
ThreshDrop = (FirstThreshold-(FinalGrowthRate)-0.0001)/n; <br />
MinimalGenomes = cell(1,NumberOfMinGenomes);<br />
UnEssentialGeneLists = cell(1,NumberOfMinGenomes);<br />
TheModelOriginal = TheModel;<br />
Models = cell(1);<br />
<br />
disp(['Initial Growth Rate is ' num2str(InitialGrowthRate)])<br />
disp(['Final Growth Rate will be ~ ' num2str(FinalGrowthRate)])<br />
disp(['First of ' num2str(IterationsPerList) ' growth rate thresholds is ' num2str(FirstThreshold)])<br />
disp(['The growth rate threshold will drop by this amount for every iteration: ' num2str(ThreshDrop)])<br />
disp(['Number of iterations for every list is ' num2str(IterationsPerList)])<br />
w = 1;<br />
<br />
%Algorithm to find minimal genomes.<br />
<br />
while w<=NumberOfMinGenomes<br />
disp(['FINDING MINIMAL GENOME LIST: ' num2str(w) ' of ' num2str(NumberOfMinGenomes)]);<br />
<br />
geneList = cell(1);<br />
geneListTEST = cell(1);<br />
d = 1;<br />
k = 1;<br />
f = FirstThreshold;<br />
<br />
%this part shuffles the TheModel list for randomization<br />
<br />
RandomGeneList = cell(1,length(TheModelOriginal.genes));<br />
random = randperm(length(TheModel.genes))';<br />
<br />
for x = (1:length(TheModel.genes))<br />
RandomGeneList(x) = TheModelOriginal.genes(random(x));<br />
end<br />
<br />
while f >= FinalGrowthRate<br />
disp(['Performing iteration #' num2str(k) '. Threshold growth rate for this iteration of deletions is <br> ' num2str(f) ' ...']);<br />
for c = (1:length(RandomGeneList)) <br />
match = zeros(length(RandomGeneList));<br />
for a = (1:length(geneList)) %check if gene already on geneList. if so, skip analysis<br />
if strcmp(geneList(a),RandomGeneList(c)) == 1 <br />
match(a) = 1;<br />
else<br />
match(a) = 0;<br />
end<br />
end<br />
<br />
%This part decides whether or not to permanently knockout a gene<br />
<br />
if sum(match) == 0 %if gene does not exist in geneList yet, test its deletion<br />
geneListTEST(d) = RandomGeneList(c);<br />
<br />
deltamodel = deleteModelGenes(TheModelOriginal,geneListTEST); <br />
solution = optimizeCbModel(deltamodel);<br />
<br />
if solution.f > f %"if the deletion causes satisfactory growth, commit gene to geneList<br />
geneList(d) = geneListTEST(d); <br />
%F(d) = solution.f; <br />
d = d+1;<br />
end <br />
end<br />
end<br />
disp(['Genes Deleted So Far for this List is: ' num2str(length(geneList))])<br />
f = f-ThreshDrop;<br />
k = k+1;<br />
end<br />
<br />
UnEssentialGeneLists{w} = geneList';<br />
<br />
%This part "inverts" the unessential list of genes to obtain the essential list (the minimal genome).<br />
<br />
InvertThis = UnEssentialGeneLists{w};<br />
WithThis = TheModel.genes;<br />
InvertedList = cell(1); <br />
<br />
Match=zeros(length(WithThis));<br />
for a = (1:length(InvertThis))<br />
for b = (1:length(WithThis))<br />
if strcmp(InvertThis(a), WithThis(b)) == 1<br />
Match(b) = 1;<br />
end<br />
end<br />
end<br />
<br />
d = 1; <br />
for c=(1:length(WithThis))<br />
if Match(c) == 0<br />
InvertedList(d) = WithThis(c);<br />
d = d+1;<br />
end<br />
end<br />
MinimalGenomes{w} = InvertedList'<br />
<br />
if nargout > 2<br />
Models{w} = deleteModelGenes(TheModelOriginal, geneList);<br />
end<br />
w = w+1;<br />
end<br />
<br />
if nargout > 2<br />
disp('Reassign a model of interest like this: modelMinimal = Models{3}, except replace "Models" with your 3rd output <br> argument.')<br />
end<br />
<br />
%University of Alberta 2009 iGEM Team<br />
%Project BioBytes<br />
%EricB</div>Ocorteshttp://2009.igem.org/Team:Alberta/Project/Modeling/FindMinimalGenomesTeam:Alberta/Project/Modeling/FindMinimalGenomes2009-10-22T00:36:25Z<p>Ocortes: </p>
<hr />
<div> function [MinimalGenomes, UnEssentialGeneLists, Models] = FindMinimalGenomes(TheModel, NumberOfMinGenomes, FinalGrowthRate, <br>IterationsPerList, FirstThreshold)<br />
%NumberOfMinGenomes: Number of minimal genomes you want the code to find (since there are many possible minimal genomes)<br />
%FinalGrowthRate: is what the final growth rate will apporximately be. Lower values result in a lower final<br />
%growth rate, but this allows for more genes to be deleted (resulting in a smaller allowable minimal genome).<br />
%FirstThreshold: This is the threshold growth rate for the first iteration of gene deletions.<br />
<br />
disp('May take 5 mins per NumberOfMinGenomes (default is 1 list)')<br />
solutionI = optimizeCbModel(TheModel);<br />
InitialGrowthRate = solutionI.f;<br />
<br />
%Input/Output Error Checking<br />
<br />
if nargout == 0<br />
error('You must have at least 1 output argument! For example: MinGenomes = FindMinimalGenomes(model)')<br />
end<br />
if nargin >=3<br />
if FinalGrowthRate > InitialGrowthRate<br />
disp(['FinalGrowthRate (set by you): ' num2str(FinalGrowthRate)]);<br />
error('The FinalGrowthRate must be less than the InitialGrowthRate')<br />
end<br />
end<br />
if nargin >=4<br />
if IterationsPerList < 1<br />
error('IterationsPerList must be greater than or equal to 1!')<br />
end<br />
end<br />
if nargin == 5<br />
if FirstThreshold >= InitialGrowthRate<br />
error('FirstThreshold must be less than the InitialGrowthRate')<br />
end<br />
end<br />
<br />
%Initialization of variables<br />
<br />
switch nargin<br />
case 1<br />
FinalGrowthRate = 0.2;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
n = 2; IterationsPerList = n+1 ; % n = 2 results in 3 iterations of gene filtering. <br />
NumberOfMinGenomes = 1;<br />
case 2<br />
FinalGrowthRate = 0.2;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
n = 2; IterationsPerList = n+1 ; <br />
case 3<br />
FinalGrowthRate;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
n = 2; IterationsPerList = n+1; <br />
case 4<br />
if rem(IterationsPerList,1) ~= 0<br />
error('IterationsPerList must be an integer')<br />
end<br />
FinalGrowthRate;<br />
FirstThreshold = ((InitialGrowthRate-FinalGrowthRate)*0.87)+FinalGrowthRate;<br />
if IterationsPerList == 1<br />
n = 0.000000001; %Causes only 1 iteration & prevents division by 0 (which only Chuck Norris can do).<br />
else<br />
n = IterationsPerList-1;<br />
end<br />
case 5<br />
if rem(IterationsPerList,1) ~= 0<br />
error('IterationsPerList must be an integer')<br />
end<br />
FinalGrowthRate;<br />
FirstThreshold;<br />
if IterationsPerList == 1<br />
n = 0.000000001; %to cause only 1 iteration & to prevent division by 0<br />
else<br />
n = IterationsPerList-1;<br />
if FirstThreshold < FinalGrowthRate<br />
error('FirstThreshold must be greater than FinalGrowthRate')<br />
end<br />
end<br />
otherwise<br />
error('Too many input arguments! Sorry, try again!')<br />
end<br />
<br />
ThreshDrop = (FirstThreshold-(FinalGrowthRate)-0.0001)/n; <br />
MinimalGenomes = cell(1,NumberOfMinGenomes);<br />
UnEssentialGeneLists = cell(1,NumberOfMinGenomes);<br />
TheModelOriginal = TheModel;<br />
Models = cell(1);<br />
<br />
disp(['Initial Growth Rate is ' num2str(InitialGrowthRate)])<br />
disp(['Final Growth Rate will be ~ ' num2str(FinalGrowthRate)])<br />
disp(['First of ' num2str(IterationsPerList) ' growth rate thresholds is ' num2str(FirstThreshold)])<br />
disp(['The growth rate threshold will drop by this amount for every iteration: ' num2str(ThreshDrop)])<br />
disp(['Number of iterations for every list is ' num2str(IterationsPerList)])<br />
w = 1;<br />
<br />
%Algorithm to find minimal genomes.<br />
<br />
while w<=NumberOfMinGenomes<br />
disp(['FINDING MINIMAL GENOME LIST: ' num2str(w) ' of ' num2str(NumberOfMinGenomes)]);<br />
<br />
geneList = cell(1);<br />
geneListTEST = cell(1);<br />
d = 1;<br />
k = 1;<br />
f = FirstThreshold;<br />
<br />
%this part shuffles the TheModel list for randomization<br />
<br />
RandomGeneList = cell(1,length(TheModelOriginal.genes));<br />
random = randperm(length(TheModel.genes))';<br />
<br />
for x = (1:length(TheModel.genes))<br />
RandomGeneList(x) = TheModelOriginal.genes(random(x));<br />
end<br />
<br />
while f >= FinalGrowthRate<br />
disp(['Performing iteration #' num2str(k) '. Threshold growth rate for this iteration of deletions is ' num2str(f) ' ...']);<br />
for c = (1:length(RandomGeneList)) <br />
match = zeros(length(RandomGeneList));<br />
for a = (1:length(geneList)) %check if gene already on geneList. if so, skip analysis<br />
if strcmp(geneList(a),RandomGeneList(c)) == 1 <br />
match(a) = 1;<br />
else<br />
match(a) = 0;<br />
end<br />
end<br />
<br />
%This part decides whether or not to permanently knockout a gene<br />
<br />
if sum(match) == 0 %if gene does not exist in geneList yet, test its deletion<br />
geneListTEST(d) = RandomGeneList(c);<br />
<br />
deltamodel = deleteModelGenes(TheModelOriginal,geneListTEST); <br />
solution = optimizeCbModel(deltamodel);<br />
<br />
if solution.f > f %"if the deletion causes satisfactory growth, commit gene to geneList<br />
geneList(d) = geneListTEST(d); <br />
%F(d) = solution.f; <br />
d = d+1;<br />
end <br />
end<br />
end<br />
disp(['Genes Deleted So Far for this List is: ' num2str(length(geneList))])<br />
f = f-ThreshDrop;<br />
k = k+1;<br />
end<br />
<br />
UnEssentialGeneLists{w} = geneList';<br />
<br />
%This part "inverts" the unessential list of genes to obtain the essential list (the minimal genome).<br />
<br />
InvertThis = UnEssentialGeneLists{w};<br />
WithThis = TheModel.genes;<br />
InvertedList = cell(1); <br />
<br />
Match=zeros(length(WithThis));<br />
for a = (1:length(InvertThis))<br />
for b = (1:length(WithThis))<br />
if strcmp(InvertThis(a), WithThis(b)) == 1<br />
Match(b) = 1;<br />
end<br />
end<br />
end<br />
<br />
d = 1; <br />
for c=(1:length(WithThis))<br />
if Match(c) == 0<br />
InvertedList(d) = WithThis(c);<br />
d = d+1;<br />
end<br />
end<br />
MinimalGenomes{w} = InvertedList'<br />
<br />
if nargout > 2<br />
Models{w} = deleteModelGenes(TheModelOriginal, geneList);<br />
end<br />
w = w+1;<br />
end<br />
<br />
if nargout > 2<br />
disp('Reassign a model of interest like this: modelMinimal = Models{3}, except replace "Models" with your 3rd output argument.')<br />
end<br />
<br />
%University of Alberta 2009 iGEM Team<br />
%Project BioBytes<br />
%EricB</div>Ocorteshttp://2009.igem.org/Team:Alberta/Project/Promoters_%26_TerminatorsTeam:Alberta/Project/Promoters & Terminators2009-10-22T00:30:11Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/TemplateSc}}<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=75% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Promoter and Terminator Design</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<font size="2"><br />
<br />
<p> Our project tests the limits to which biology can be standardized. Towards this goal, the endogenous promoter of every essential gene will be replaced with one of seven standard promoters producing different expression levels. The terminator of every essential gene will also be replaced with a standard biobrick terminator. The promoters and terminators are biobrick parts and are currently being functionally tested. To determine which promoter to pair with which gene, microarray expression data from the literature was used. </P><br />
<br />
<b>Advantages of standardized promoters include:</b><br />
<ul><br />
<li> streamlined amplification of genes from genomic DNA, as amplicons can all start precisely at the start codon. No data about where the endogenous promoter begins is required. </li><br />
<li> potential for easy manipulation of gene expression levels: the same gene part can easily be assembled with different promoters to test the effect of different expression levels. </li><br />
<li> we need not be concerned about including all the transcription factors need to express the essential genes. </li><br />
<li> as the location and properties of many promoters are unknown, using all standardized promoters results in a much better characterized system that is more amenable to manipulation. </li><br />
</ul><br />
<br />
</p><br />
<br />
</font></div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Promoters</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<font size="2"><br />
<br />
<p>The standardized promoters were based from a series of promoters produced by the 2006 Berkeley iGEM team. These are a series of promoters which have been mutated from the consensus sigma 70 promoter allowing for varying levels of promoter activity to be produced. The promoters can be found <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100"> here </a>. The following promoters were selected:<br />
<ul><br />
<li>J23119 - Sigma 70 Consensus Sequence<br />
<li>J23102 - Sigma 70 75% Strength Promoter<br />
<li>J23118 - Sigma 70 50% Strength Promoter<br />
<li>J23105 - Sigma 70 25% Strength Promoter<br />
<li>J23114 - Sigma 70 10% Strength Promoter<br />
<li>J23113 - Sigma 70 1% Strength Promoter<br />
</ul><br />
<br />
These promoters were tested by the Anderson group by construction of J61002. This plasmid consists of the promoter of interest, the RFP gene, and a double terminator. By measuring the amount of fluorescence produced by each promoter, it is possible to determine the promoter's strength. Unfortunately, the strength of the consensus promoter was not measured. Therefore it was assigned a fluorescence of 2900 based on the rate of decrease in fluorescence per base pair mutation. In order to confirm the strength of each promoter, we are presently in the process of testing our new BioByte promoters (see below for more details on other alterations made to each promoter) using the same experimental procedure as the Anderson Group.</p><br />
<br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Terminator</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<font size="2"><br />
<br />
<p>The part which was used as the universal terminator in our standardized parts list was Bba b1006. This is a bidirectional terminator with 6 nucleotide loop and 8 bp stem which has been shown to terminate transcription 99% of the time (Please see <a href="http://partsregistry.org/Help:Terminators/Measurement/Cassie_Huang"> here </a> for terminator characterization information). The sequence of the terminator is:<br />
<br />
<center><h3>AAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTT</h3><br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Modifications To Promoters and Terminators</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<font size="2"><br />
<br />
<p>Alterations were made to the Anderson collection promoters to allow for use with the BioBytes assembly system. Two restriction sites were removed, and two nucleotides were added to slightly alter the start site of transcription. Both the promoters and terminators had a PstI and XbaI site added allowing for insertion into pAB or pBA. Please see the attached document <a href="https://2009.igem.org/Image:UofA_Promoter_Terminator.zip"> here </a> for sequence information regarding the modified promoters and terminators.<br />
<br />
</font></div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Microarray Determination of Standardized Promoters</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<font size="2"><br />
<br />
<p>With a series of standardized promoters and a list of essential genes it is important to be able to compare these to one another and assign the appropriate promoter to each gene. In order to accomplish this, microarray data was used for the <i>E. coli</i> genome under aerobic conditions. The <a href="https://2009.igem.org/Image:UofA_Covert.pdf"> Covert et al 2004</a> paper was used to determine this information. They looked at a series of gene knockouts under a variety of media conditions and determined the level of transcript for 1010 metabolic genes during the growth phase of the organism. We used the WT data determined a level of each gene's transcript and used this to assign individual promoters to the genes. A list of the literature essential genes with their promoter levels can be found <a href="https://2009.igem.org/Image:UofA_MicroarrayData.xls"> here </a>.</p><br />
<p>These results however are not complete since there are many variables which need to be considered in order to ensure the correct level of transcript is produced. Further research will be required to see the effects of different cellular stages and conditions.</p><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<tr><br />
</table><br />
</div><br />
</HTML></div>Ocorteshttp://2009.igem.org/Team:Alberta/Project/MicrofluidicsTeam:Alberta/Project/Microfluidics2009-10-21T22:19:10Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/TemplateSc}}<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=75% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Lab-on-a-Chip Byte Assembly</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<font size="2"><br />
<P><br />
<br />
<br />
<p><b>Figure 1.</b></p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/7/7a/UofA09_ChipFingers.JPG" width="200" height="400" align="center"><br />
</center><br />
</P><br />
<br />
<P><br />
Microfluidic chips bring several advantages to the table. These so called Lab-on-a-Chip devices require only small amounts of reagents. They are portable, inexpensive, typically faster, more efficient, and able to be automated. We have built and tested prototype chips to execute our novel <a href="https://2009.igem.org/Team:Alberta/Project/Assembly_Process"> Byte Assembly Process</a>. With these chips, we have successfully demonstrated the quick and efficient assembly of 5 Bytes.</P><br />
<P><br />
</p><br />
<br />
</font></div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>How The Chip Works</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<font size="2"><br />
<P><br />
Many design configurations were considered. For the proof of concept, the simplest design was chosen. The chip consists of a central washing chamber that is connected to 8 surrounding chambers through micro-channels. None of the outer chambers are directly connected to each other. The washing chamber is in the middle because it needs to be accessed after every Byte addition, and because this is the easiest way to set up Laplace flow towards all the outer chambers. <br />
<br />
<p><b>Figure 2.</b></p><br />
<P><br />
<img src="https://static.igem.org/mediawiki/2009/d/d2/UofA_MicroA.png" width="700" height="460" ><br />
</P><br />
To assemble the Bytes into a multi-gene construct, all of the chambers are filled with their appropriate solutions (see diagram above). The beads are dragged with an external robotically controlled magnet from the initial chamber into the washing chamber, then into the Anchor chamber. After a short period, the Anchor is attached to the bead and the bead can now be dragged out of the Anchor chamber and into the washing chamber. The beads are now moved into the 1st Byte chamber. After a short time, the 1st Byte is ligated to the Anchor on the bead. The beads are then moved to the next Byte chamber where the next Byte is ligated. The beads keep on moving from chamber to chamber in this manner until all of the Bytes are assembled into one complete construct. After assembly is done, the beads are recovered and digested to release the construct from the bead. The assembled product is now ready for transformation.<br />
<P>Prior to Byte assembly, the software is programmed to organize the order in which the robotic arm moves the beads from chamber to chamber. Using this method, we can choose beforehand the order the Bytes are assembled in the construct.</P><br />
</P><br />
<P><br />
<br />
<br />
</div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Results</h1><br />
<br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<P> We have successfully demonstrated the assembly of 5 Bytes within one of our microfluidic chips. The construct was made up of the anchor and 5 Bytes (2 genes that alternated). Each Byte chamber held 4.2 uL of the specific Byte along with ligase and ligase buffer (totalling 5 uL in each chamber). This is a very small amount compared to the volumes used in standard protocols. The total mass of the magnetic beads is 8 micrograms which takes a volume of 2 uL of the total bead solution. The procedure described in the previous section was carried out as follows: The beads were left in each chamber for 15 minutes; leading to a completion time of less than 2 hours at room temperature, the construct was cleaved off the bead with USER enzyme and ran on an agarose gel. The gel showed 5 very dim but distinct bands (which is expected with low reagent volumes). The contents of the chambers were also run on the same gel as a control, to verify that there was no contamination from other Byte-chambers. The size of the construct; interpreted by the location of the bands on the gel, proved successful assembly of the bytes into a construct! Repeat trials gave consensus results ergo, further-proving the effectiveness of the technique.<br />
<P><br />
<P><br />
<P><br />
<br />
</font></div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>The Robot</h1><br />
<br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<P>The XY stage in the robot was built by a group of undergraduate students from the U of A as a capstone design project. This XY stage is what moved the magnet around which controlled where the beads went on the microfluidic chip. Since then, this XY stage has been incorporated into another machine meant to combine many lab-on-a-chip functions into one device including PCR and CE for sequencing. That is why the machine is so big; the internal laser and camera take up a lot of space. The software can be controlled from a Mac or PC. Since the chip's channels were curved, it was somewhat cumbersome to attain the XY positions that the magnet needed to go. But once the positions were known, the rest was simple.<br />
<P><br />
<p><b>Figure 3.</b></p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/d/d4/UofA09_XYStage.png" width="320" height="240 align="center"><br />
<img src="https://static.igem.org/mediawiki/2009/1/16/UofA09_Angelina.jpeg" width="320" height="240" align="center"><br />
</center><br />
<P><br />
<P><br />
<br />
</font></div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>FAQs</h1><br />
<br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<P><br />
<br />
<b>Q. What stops the DNA in the outer wells from diffusing into the washing chamber and contaminating all of the other chambers?</b><P><br />
A. We set up Laplace flow originating from the central washing chamber.<P><br />
<br />
<br />
<b>Q. What is Laplace flow?</b><P><br />
A. Laplace flow is the term used for the flow of liquid caused by differences in pressure. So by filling the central washing chamber to a height slightly higher than the outer chambers, a slow and steady flow against the concentration gradient of the DNA was accomplished.<P><br />
<br />
<b>Q. How do you stop the chamber contents from evaporating?</b><P><br />
A. We normally cap the chambers with a small volume of oil. Without the oil, the small reaction volumes can evaporate in less than 5 minutes.<P><br />
<br />
<b>Q. What are some of the physical characteristics of the microfluidic chip?</b><br />
<br />
<p><b>Figure 4.</b></p><br />
<P><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/7/77/UofA09_Micro3.png" width="500" height="175" ><br />
</center><br />
</P><br />
<P><br />
A. The chip is made of 2 glass layers. The micro-channels are etched onto the top of the bottom layer, and the chambers are part of the top layer. The channels are 45 micrometers by 100 micrometers. The chip itself is approximately 1 inch by 3 inches. Each outer chamber can hold 5 uL of liquid. The central washing chamber volume varied from chip to chip ranging from ~2 uL to 20 uL. Some chips had a closed central washing chamber, but were no longer used after unintentional Laplace flow was found to be largely uncontrollable. The chips are reusable after a quick wash.<br />
<P><br />
<br />
<b>Q. How do you fill the channels?</b><P><br />
A. Once liquid touches the central washing chamber, capillary flow rapidly fills the channels. The outer chambers are then ready to be filled.<P><br />
<br />
<b>Q. Why were the channels made to curve like they do? Why are they not simply coming straight out of the washing chamber towards the outer chambers?</b><P><br />
A. The first reason was to increase the length that the DNA had to travel if diffusion turned out to be a problem. Since there was limited space, curving the channels is all we could do to increase channel length. The second reason was so that we could visually confirm that Laplace flow was working by filling the outer chambers with orange dye, and the central washing chamber with blue dye. Shorter channel lengths would have made this hard to see.<P><br />
<br />
<b>Q. How do you know that the beads do not drag unwanted DNA around to contaminate other chambers?</b><P><br />
A. In our tests, we've recovered the contents of the chambers to run them on a gel and see if any DNA from a different chamber has entered. No measurable amount of DNA was found to contaminate other chambers (including the wash chamber). This suggests that the Laplace flow from the washing chamber is enough to cleanse the beads of DNA that has not ligated.<br />
<br />
<P><br />
</p><br />
<br />
</font></div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Outreach"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>The Future of Lab-on-a-Chip Byte Assembly</h1><br />
<br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<br />
<br />
<P>Many of the procedures needed for Byte assembly have been accomplished on a microfluidic chip in labs across the world. Although not used for Byte assembly and not accomplished on the same chip, these on-chip protocols have shown that PCR, purification, digestion, electromagnetic bead manipulation, ligation, cell separation, and electroporation (transformation) can all be achieved on-chip. The future will bring many of these procedures together onto one chip allowing the researcher to choose their artificial plasmid on the computer, and upload the program to the microfluidic chip's microprocessor.<br />
<P><br />
<br />
<p><b>Figure 5.</b></p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/1/13/UofA09_MiniBioFab2.png" width="700" ><br />
</center><br />
<br />
<br />
<P><br />
The diagrams show what a Biofab-on-a-chip might look like. It would be a large scale integration of previously independent lab-on-a-chip procedures. Starting on the left of the first labeled diagram:<br />
<li><br />
Bytes are PCR'd out of their plasmids and their sticky ends are created after the USER enzyme is pumped in. The solution needs to be PCR purified and is pumped through the wavy channels. These wavy channels contain thousands upon thousands of micro-pillars that selectively bind DNA. The DNA does not make it through at first; the waste is made to flow into the waste chamber. Soon after, the purification buffers are pumped through allowing the Bytes to collect in the Byte chambers. Prior to this, magnetic beads were prepared by being dragged into the anchor chamber (either by an external magnet, or on-chip micro-electromagnets). <br />
<li><br />
When the Bytes are ready in their chambers, the supply of beads is split into groups by the external magnet or the internal micro-electromagnets. Each portion is transferred to a different Byte chamber and attaches a Byte to the anchor. After ligation is done, each portion of beads is led to another chamber (through the wash canal) where each bead portion attaches a second Byte. The process continues until a certain amount of Bytes is on each bead. <br />
<br />
<p><b>Figure 6.</b></p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/7/7b/UofA09_BioFab-On-A-Chip.png" width="371" height="473" ><br />
</center><br />
<br />
<li><br />
Two bead groups are moved to independent MegaByte chambers where the USER enzyme cuts the constructs off of the bead. The beads are transferred back to their storage chamber while the construct is left free in the MegaByte chamber. The remaining bead portions that still have constructs attached are transferred to these freshly cut constructs and soon ligate. There are now two bead portions left, each having a construct. One of them is cut with USER, and the remaining bead portion is moved to that chamber where the constructs ligate. At last, this large Byte construct is cut with USER and is ready for electroporation. (Heating in the MegaByte chambers between construct additions and ligations denatures the enzymes to allow for proper conditions for MegaByte assembly.) The newly made MegaByte is pumped into the electroporation chamber where the MegaByte is transformed into a cell and ready for extraction.<br />
<br />
<br />
<P><br />
See the microfluidics section of our <a href="https://2009.igem.org/Team:Alberta/References/Keywords"> References</a> page for papers describing the above protocols.<br />
<br />
</font></div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</div><br />
</HTML></div>Ocorteshttp://2009.igem.org/Team:Alberta/ProtocolsTeam:Alberta/Protocols2009-10-21T17:07:31Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/Template3}}<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=60% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Recoli"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Lab Protocols</h1><br />
<br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Transformation">Transformation</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Overnight">5 mL Overnights</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Glycerol_Stock">Glycerol Stock</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Miniprep">Plasmid Miniprep</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Digest">Restriction Digest</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Gel_Electrophoresis">Agarose Gel Electrophoresis</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Gel_Extraction">Gel Extraction</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Ligation">Ligation</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Colony_PCR">Colony PCR</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Dephosphorylation">Vector Dephosphorylation</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/Sequencing">Sanger Sequencing Reaction</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/AnchTermAnneal">Annealing Anchor/Terminator</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/WashBufferrecipe">Wash/Binding Buffer Recipe</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/ByteAmplification">Byte Amplification and Prep</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/ByteAssembly">Byte Assembly (in a tube)</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/ISceIdigestion">Byte Construct Linearization</a></p><br />
<p><a href="https://2009.igem.org/Team:Alberta/Project/BeadBindingCapacity">Bead Binding Capacity</a></p><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
</table><br />
</div><br />
</HTML></div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-10-21T05:27:41Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/Template3}}<br />
<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=60% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Recoli"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Project BioBytes</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/8/8f/UofAiGEM2009_groupphoto_IMG_5009.JPG" width="320" height="407"><br />
</center><br />
<br />
<br> <br />
<br />
<table><br />
<br />
<tr><br />
<td><br />
<div align="left"><strong>Kalon Armstrong</strong> <br><br />
<em>Molecular Genetics</em> <br><br />
</div><br />
<td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/3/34/UofA09_team_Kalon_Armstrong.jpg" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" >I've recently completed my BSc in Molecular Genetics and will be entering the Engineering program in the fall of 2009. Most of my growing-up took place in the small town of Cochrane, Alberta. My ultimate goals consist of working in the Biotechnology or health care industry. While my interest in music, movies, snowboarding, and hanging out with friends may seem stereotypical on the surface, they feel unique in their own right and keep me busy most of the time. This will be my first year on the U of A iGEM team and I am excited to help take the competition to a new level. I think that iGEM will be a great experience because it demands innovation and collaboration on levels rarely seen in undergraduate programs.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
<tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Eric Bennett</strong><br><br />
<em>Electrical Biomedical Engineering</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ef/UofA09_Eric_Bennett.JPG" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" >I am entering my final year of engineering at the U of A. After graduation, I hope to do research either with a biotechnology company or in grad school. I think that iGEM is a great way to gain valuable experience and is an effective way of accelerating the field of synthetic biology. My interests include brain-machine interfacing, genetic engineering, and robotic control systems. My hobbies include playing guitar, video games, the occasional sport, reading, and fixing my car.</div><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Max Buchko</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="http://igem.biochem.ualberta.ca/wiki/images/3/3d/UofA_iGEM09_Max_Pic1.png" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Honors Biochemistry and wish to pursue a career in medicine. In my time away from the lab I enjoy a wide variety of sports including soccer, boxing, and rifle silhouette shooting. I have also been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs.<br />
I hope for the best with iGEM at MIT in 2009. This competition is a means of proving yourself at an exemplary level amongst many of the top international minds, and it is this challenge that I look forward to the most.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Oscar Cortés</strong><br><br />
<em>Bsc. Specialization molecular genetics</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/7/77/Oscar.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">My future plans include entering into a Masters program in Medical Genetics or Human Genetics, and pursuing this discipline towards a PhD. I enjoy reading books about the human genome and advancements in stem cell research. In my spare time I like to play a variety of sports that I am not necessarily good at: soccer, softball, and dodge ball. I see iGEM as an extraordinary opportunity for me to be exposed to real life research, in which my knowledge of molecular genetics will be challenged, and will help me further my understanding of Synthetic Biology.<br />
"Man with all his noble qualities still bears in his bodily frame the indelible stamp of his lowly origin"- Charles Darwin</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Anh Dao</strong><br><br />
<em>Biological Sciences and Chemistry</em><br> <br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/c/cf/UofA09_team_Ahn_Dao.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am interested in a research career after I finish my degree. I am leaning towards the field of Microbiology to study the many micro-organisms that have not yet been discovered. However, I may enroll in graduate studies after my undergraduate degree to expand my knowledge and gain more experience in the laboratory. Being in a competitive team and atmosphere is a motivating and exciting opportunity that I do not want to miss out on. By creating the smallest artificial E. coli genome we can extend future research. We are attempting to understand and standardize the E. coli genome so that this methodology can be applied to more complex model organisms.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Uchechukwu Davidson</strong><br><br />
<em>Honors biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d5/Uche.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Biochemistry at the University of Alberta. I wish to pursue a career in medicine after my degree. I enjoy sports, movies, and music at my time away from my studies. The iGEM provides an opportunity to experience creativity, innovation, and ingenuity which are sometimes absent at the undergraduate level of science.</div><br />
</td><br />
</tr><br />
<br />
<tr> <br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Youness Elkhalidy</strong><br><br />
<em>Honors immunology and infection</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/f/fe/UofAiGEM2009_Youness_IMG_5049.JPG" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
I am a first year student at the University of Alberta. I hope to enter medical school in the near future. I am currently taking part in mitotic-spindle regulation research from a genetics perspective. I have a passion for science and enjoy sports such as basketball and soccer. iGEM is an great learning experience not only in the cutting-edge field of Synthetic Biology but also in leadership and business management. I will enjoy taking part in research that combines many fields of science as well as socialize with many of my team members who share common interests.<br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Justin Fedor</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/0/0d/IMG_4985.JPG" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I have completed my undergraduate degree in Biochemistry this year and have began my PhD studies this September. I play piano and am attempting to learn the cello. My nerdy tendencies are obvious when I say that I like Star Trek TNG but not DS9. Last summer I worked in the biomedical research lab of Dr. Larry Unsworth of the National Institute for Nanotechnology (NINT), which has further piqued my interest in the field of nanotechnology. In the hopefully not too distant future I plan on becoming a researcher studying the mechanisms of membrane bound enzymes, particularly oxidoreductases. iGEM has proved a fantastic experience, it has served to mature me further as a scientist.</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"> <br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Jason Gardiner</strong> <br><br />
<em>BSc. Specialization in Botany</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/2/2b/UofA09_team_Jason_Gardiner.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">Jason is a veteran of iGEM 2007, where his team "The Butanerds" won first place in the Energy track. His hobbies include Softball, Beach volleyball, soccer, as well as playing the guitar and fiddling with the iGEM 2009 Wiki. Jason has applied to continue his education in graduate studies at the University of Alberta in 2010. His degree in Botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying Synthetic Biology to plants. One day he hopes to solve all of the world's problems using plants and Synthetic Biology.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<div align="left"><br />
<strong>Erin Garside</strong> <br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/60/UofA09_team_Erin_Garside.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. degree this year and plan to do graduate work in biochemistry. After that - who knows? I think iGEM will be a great experience, and that it's about time Synthetic Biology really took off. In my spare time I like to read, play computer games (especially the Sims) and raise cats.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Boris Henriquez</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ec/UofA09_team_Boris_Heneriquez.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have just completed the third year of my BSc. degree. My favorite classes so far have been in the fields of Biochemistry and Genetics. I am most interested in human development and embryogenesis and hope to learn more about these topics in my fourth year. My ultimate goal is to have a career in the medical industry as both a physician and as a researcher. When I'm not busy with school or work my usual activities are pretty standard. I like to hang out with friends and family and I crave the outdoors. This is my first year with iGEM and I'm really excited to learn more about Synthetic Biology. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Stephen Jahns</strong><br><br />
<em>Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a8/Alberta_steve.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am in my second year at the University of Alberta. After taking a year of engineering, I decided to transfer to molecular genetics in order to fulfill my childhood desire of creating an army of giant bat-rabbits. I plan on going on through to graduate school to earn a PhD in order to reach my goals. In my spare time I like to run around, ride my bike, play music, cook delicious food, and pretty much all the other fun things kids are doing these days. In my first year I helped to build a car with the U of A's Formula SAE fabrication team. I had a good time building stuff out of metal, and this year I know that I'm going to have a blast building (or at least attempting to build) a novel organism out of DNA parts.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Eric Leung</strong> <br><br />
<em>Honors Pharmacology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/c7/Alberta_Eric_Leung.JPG" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently in my final year of an Honors Pharmacology degree. What I do after this degree is up in the air but it is definitely something in the health sciences. In my spare time, I like to play basketball, badminton, run, and catch up on TV shows. Soon I hope I can become a professional baker in my free time. Traveling to Europe, Mexico, and Japan is also in the books somewhere along the way.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>David Lloyd</strong><br> <br />
<em> Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/6f/UofA09_team_David_Lloyd.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am a fourth year student, studying at the University of Alberta. While Biochemistry is my major, I have many interests including Genetics, Immunology, Cell Biology, Bioinformatics, and Microbiology. In my spare time I can be found playing sports like soccer, volleyball, or squash, as well as playing piano, listening to music, and playing video games. In the future, I hope to continue into a graduate program in Biochemistry, Cell Biology, Synthetic Biology, or in another field. iGEM is of great interest to myself because of its application to the future of Synthetic Biology. It is an awesome challenge which will hopefully help me to cultivate myself.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Enoch Ng</strong><br><br />
<em>Biological Sciences/Business</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/7/7c/UofA09_team_Enoch_Ng.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am entering my fourth year of studies at the University of Alberta, and am looking forward to the challenge that iGEM provides. In the future I hope to travel across the world and meet people ranging from Meshaal to Obama and remain a glorified generalist. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Emera Nguyen</strong><br><br />
<em>BSc. Biological Sciences/Economics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/5/52/UofA09_team_Emera_Nguyen.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am a BSc student entering my fourth year in a Biological Sciences major and Economics minor. This year will be my second year on an iGEM team, and my first year representing the U of A team. In my downtime, things I enjoy include spending quality time with friends and family and traveling to lesser-known parts of the world. One year's experience later, the iGEM competition still impresses me with the unique opportunities it provides for student growth. This research competition is one of the highlights of my undergraduate experience.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Mitch Paquette</strong><br><br />
<em>BSc. Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/1/12/IMG_5052.jpg" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I have transfered into the honors program in Molecular Genetics from a BSc General program in Physical Sciences. After my degree is completed I plan to apply to graduate studies in Molecular Biology, after which I hope to work in research or academia. What excites me most about iGEM is the opportunity to gain research experience in such a new field.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Amber Paul</strong><br><br />
<em>BSc. Specialization Immunology and Infection</em><br><br />
</div></td></tr><br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/5/5f/IMG_4987.jpg" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I plan to find the cure for cancer. Seriously. Will be attending graduate school to earn a PhD following my undergraduate degree. I would like to live somewhere warm that allows me to do research, preferably Maui. iGEM is a developmental forefront to Synthetic Biology, something that I love to be part of. Its challenging and fun. To be able to determine the minimal genes for a simple prokaryote, we provide a scaffold to future research on larger, more complex cells such as cancerous tissues, simple eukaryotes, etc.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Julia Pon</strong><br><br />
<em>Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ec/UofA_Julia_Pon_photo.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">My future plans include pursuing PhD in Medical Genetics. I've worked in biological research labs for the past two summers, with last summer spent at the German Cancer Research Institute in Heidelberg, Germany. I'll be working in both the iGEM lab and a Medical Genetics research lab during summer 2009. My heritage is a mixture of English, Chinese, and Danish. iGEM helps move biology to a streamlined, standardized, abstracted process that opens the door to interdisciplinary collaborations and new applications. I'm excited about the many applications of Synthetic Biology and am enjoying the student-directed and team-oriented nature of iGEM.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"> <br />
<strong>Alina Ponomarev</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d6/UofAiGEM2009_Alina_IMG_5023.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently a second year student in Biological Sciences and I am considering transferring into the Immunology and Infection program for my third year. I joined iGEM at the end of my first year and can honestly say that it has been an unbeatable learning experience. It is very exciting to think that the progress we have made can positively impact synthetic biology and society in general. In the future, my career goal is to become a Pediatrician. However, after doing labwork at the iGEM lab this summer, I have begun to consider a career in medical research. </div> <br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Kelly Robinson</strong><br><br />
<em>Hon. Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/92/UofA09_team_Kelly_Robinson.png" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. in Biochemistry this year and have enrolled in the University of Alberta's Chemical Engineering program in hopes of fusing the fundamental science of biological machines with the entrepreneurial world of engineering. I got involved in iGEM a couple of years ago when I went to a presentation put on by one of the past teams. I ended up applying in the middle of the night on the last day of registration. That said, it has been a great experience ever since. I'm glad that this year I get the opportunity to do some full time work and really get into the project. Overall, iGEM has a lot to offer anyone who gets involved (including incorrigible advisors: you know who you are!).</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>James Rodway</strong><br><br />
<em>Electrical Engineering</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a5/UofA09_team_James_Rodway.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently finishing up a co-op Electrical Engineering degree, and am aiming to do some graduate work in more of the computer area, specifically modeling. At the University, I've been involved with the ARVP and iGEM.<br />
I haven't really had much time for hobbies in a while, but when I did I played more video games, the guitar, and I actually read books for entertainment value. During my time on last year's iGEM team I found that it was a pretty cool multidisciplinary project, which drew in a few different disciplines that I have never really interacted with previously. It was very impressive to see what we, and all the iGEM teams, had accomplished by the end of last year's competition.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Andy Spencer</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/ca/UofA09_team_Andy_Spencer.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">In 5 years I see myself on one of two different paths, medicine or oncology research. I grew up in the Okanagan, British Columbia, and love spending my summers at the beach . In my spare time I enjoy playing squash and bouldering. iGEM to me represents a fundamental value of science as a discipline; that people can from diverse backgrounds with a common interest and curiosity can work as a cohesive team to overcome barriers and problems. </div><br />
<br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jonathan Tam</strong><br><br />
<em>Honors Cell Biotechnology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/e2/UofA09_team_Jonathan_Tam.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have completed my Bachelor's degree in Honors Cell Biotechnology and intend to pursue a medical degree in Germany in the near future. I am very interested in the fields of Molecular Biology and Immunology. For the last two years, I have been keeping myself busy studying the development of macrophages in the lab of Dr. Daniel Barreda. Outside of the lab, I am an avid photographer and downhill mountain biker. The iGEM competition accelerates the development of Synthetic Biology as a field. To be a part of our University of Alberta team is an excellent opportunity for collaboration and advancement.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jennifer Yau</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/99/UofAiGEM2009_Jen_IMG_5048.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently in the second year of my undergraduate program with the ultimate goal of attending graduate school to pursue a research career in Geriatric Medicine. Additional science related activities of mine include my interest in astronomy and promoting science to elementary students through volunteer work. Otherwise, I dedicate the majority of my free time to the arts of chainmaille, knitting, and jazz/classical piano. This is my first year on iGEM and I am ecstatic to be partaking in a project that requires such diverse disciplinary backgrounds. Not only will this be a great learning experience in so many perspectives, but also an opportunity to contribute significant ideas to the ongoing research in Synthetic Biology</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>Zach Wiltshire</strong> <br><br />
<em>BSc. Specialization in Cell Biology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/1/19/UofA09_team_Zach_Wiltshire.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am entering into my fourth year in the Cell Biology program at the U of A and have already experienced iGEM once before as a member of the 2008 National Institute for Nanotechnology team. Through my degree I have found myself to have interests ranging from immunology to both eukaryotic & prokaryotic cellular anatomy & physiology. I also happen to be very fond of molecules that fluoresce. My experience with iGEM last year opened my eyes to the possibilities which engineering biological systems can offer. Over the course of the 2009 competition I hope to have just as many opportunities to learn as I did last year.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<tr><td><br />
<a name="Team_Ad"></a><br />
<strong>The Supervisors</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Mike Ellison</strong><br />
<img src="https://static.igem.org/mediawiki/2009/d/d5/UofA09_teamad_Mike_Ellison.jpg" ALIGN="LEFT" hspace="20"><br />
</td></tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Doug Ridgway</strong><br />
<img src="https://static.igem.org/mediawiki/2009/c/cc/UofA09_teamad_Douglas_Ridgway.jpg" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>James Maclagan</strong><br />
<img src="https://static.igem.org/mediawiki/2009/a/ab/UofAigem2009_JamesMIMG_4975.JPG" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<tr><td><br />
<a name="Fac_Con"></a><br />
<strong>Faculty Consultants</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Chris Backhouse</strong><br />
<br><br />
Department of Electrical Engineering<br />
<br><br />
christopher.backhouse@ualberta.ca<br />
<img src="http://www.ece.ualberta.ca/~chrisb/Graphics/Backhouse.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Nanobiotechnologies give us the ability to manipulate and sense at the level of individual molecules, with a tremendous potential impact on both human health and the economy. To a large extent, this potential is likely to be realised through the development of Lab on Chip (LOC) technologies. Although the LOC technologies are powerful, the complexity of the infrastructure required to support LOC operation has hindered the widespread adoption of LOC methods in life science applications. A central theme in the work of the Backhouse lab (<a href="http://www.ece.ualberta.ca/~aml/">the Applied Miniaturisation Lab, AML</a>) is the development of extremely inexpensive (e.g. $1000) systems for implementing nanobiotechnologies/molecular biology, especially for medical diagnostic applications.</div><br />
</td><br />
</tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Robert Campbell</strong><br />
<br><br />
Department of Chemistry<br />
<br><br />
robert.e.campbell@ualberta.ca<br />
<img src="http://www.chem.ualberta.ca/faculty_staff/faculty/facultypics/campbell.jpg" width=200 height=274.19355 ALIGN="LEFT" hspace="20"></a><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Robert E. Campbell is an associate professor and Canada Research Chair in Bioanalytical Chemistry in the Department of Chemistry of the University of Alberta. Research in his laboratory, (<a href="http://www.chem.ualberta.ca/~campbell/">the Campbell Research Group</a>), is focused on protein engineering and the development of new fluorescent protein variants for construction of FRET-based biosensors.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>Linda Reha-Krantz</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
Linda.Reha-Krantz@ualberta.ca<br />
<img src="http://www.biology.ualberta.ca/faculty/bio-187/uploads/images/reha_krantz.jpg" width=200 height=300 ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Tracy Raivio</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Jon Dennis</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
</table><br />
</html></div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-10-21T05:21:23Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/Template3}}<br />
<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=60% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Recoli"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Project BioBytes</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/8/8f/UofAiGEM2009_groupphoto_IMG_5009.JPG" width="320" height="407"><br />
</center><br />
<br />
<br> <br />
<br />
<table><br />
<br />
<tr><br />
<td><br />
<div align="left"><strong>Kalon Armstrong</strong> <br><br />
<em>Molecular Genetics</em> <br><br />
</div><br />
<td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/3/34/UofA09_team_Kalon_Armstrong.jpg" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" >I've recently completed my BSc in Molecular Genetics and will be entering the Engineering program in the fall of 2009. Most of my growing-up took place in the small town of Cochrane, Alberta. My ultimate goals consist of working in the Biotechnology or health care industry. While my interest in music, movies, snowboarding, and hanging out with friends may seem stereotypical on the surface, they feel unique in their own right and keep me busy most of the time. This will be my first year on the U of A iGEM team and I am excited to help take the competition to a new level. I think that iGEM will be a great experience because it demands innovation and collaboration on levels rarely seen in undergraduate programs.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
<tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Eric Bennett</strong><br><br />
<em>Electrical Biomedical Engineering</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ef/UofA09_Eric_Bennett.JPG" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" >I am entering my final year of engineering at the U of A. After graduation, I hope to do research either with a biotechnology company or in grad school. I think that iGEM is a great way to gain valuable experience and is an effective way of accelerating the field of synthetic biology. My interests include brain-machine interfacing, genetic engineering, and robotic control systems. My hobbies include playing guitar, video games, the occasional sport, reading, and fixing my car.</div><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Max Buchko</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="http://igem.biochem.ualberta.ca/wiki/images/3/3d/UofA_iGEM09_Max_Pic1.png" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Honors Biochemistry and wish to pursue a career in medicine. In my time away from the lab I enjoy a wide variety of sports including soccer, boxing, and rifle silhouette shooting. I have also been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs.<br />
I hope for the best with iGEM at MIT in 2009. This competition is a means of proving yourself at an exemplary level amongst many of the top international minds, and it is this challenge that I look forward to the most.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Oscar Cortés</strong><br><br />
<em>Bsc. Specialization molecular genetics</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/7/77/Oscar.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">My future plans include entering into a Masters program in Medical Genetics or Human Genetics, and pursuing this discipline towards a PhD. I enjoy reading books about the human genome and advancements in stem cell research. In my spare time I like to play a variety of sports that I am not necessarily good at: soccer, softball, and dodge ball. I see iGEM as an extraordinary opportunity for me to be exposed to real life research, in which my knowledge of molecular genetics will be challenged, and will help me further my understanding of Synthetic Biology.<br />
"Man with all his noble qualities still bears in his bodily frame the indelible stamp of his lowly origin"- Charles Darwin</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Anh Dao</strong><br><br />
<em>Biological Sciences and Chemistry</em><br> <br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/c/cf/UofA09_team_Ahn_Dao.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am interested in a research career after I finish my degree. I am leaning towards the field of Microbiology to study the many micro-organisms that have not yet been discovered. However, I may enroll in graduate studies after my undergraduate degree to expand my knowledge and gain more experience in the laboratory. Being in a competitive team and atmosphere is a motivating and exciting opportunity that I do not want to miss out on. By creating the smallest artificial E. coli genome we can extend future research. We are attempting to understand and standardize the E. coli genome so that this methodology can be applied to more complex model organisms.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Uchechukwu Davidson</strong><br><br />
<em>Honors biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d5/Uche.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Biochemistry at the University of Alberta. I wish to pursue a career in medicine after my degree. I enjoy sports, movies, and music at my time away from my studies. The iGEM provides an opportunity to experience creativity, innovation, and ingenuity which are sometimes absent at the undergraduate level of science.</div><br />
</td><br />
</tr><br />
<br />
<tr> <br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Youness Elkhalidy</strong><br><br />
<em>Honors immunology and infection</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/f/fe/UofAiGEM2009_Youness_IMG_5049.JPG" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
I am a first year student at the University of Alberta. I hope to enter medical school in the near future. I am currently taking part in mitotic-spindle regulation research from a genetics perspective. I have a passion for science and enjoy sports such as basketball and soccer. iGEM is an great learning experience not only in the cutting-edge field of Synthetic Biology but also in leadership and business management. I will enjoy taking part in research that combines many fields of science as well as socialize with many of my team members who share common interests.<br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Justin Fedor</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://2009.igem.org/Image:IMG_4985.JPG" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I have completed my undergraduate degree in Biochemistry this year and have began my PhD studies this September. I play piano and am attempting to learn the cello. My nerdy tendencies are obvious when I say that I like Star Trek TNG but not DS9. Last summer I worked in the biomedical research lab of Dr. Larry Unsworth of the National Institute for Nanotechnology (NINT), which has further piqued my interest in the field of nanotechnology. In the hopefully not too distant future I plan on becoming a researcher studying the mechanisms of membrane bound enzymes, particularly oxidoreductases. iGEM has proved a fantastic experience, it has served to mature me further as a scientist.</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"> <br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Jason Gardiner</strong> <br><br />
<em>BSc. Specialization in Botany</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/2/2b/UofA09_team_Jason_Gardiner.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">Jason is a veteran of iGEM 2007, where his team "The Butanerds" won first place in the Energy track. His hobbies include Softball, Beach volleyball, soccer, as well as playing the guitar and fiddling with the iGEM 2009 Wiki. Jason has applied to continue his education in graduate studies at the University of Alberta in 2010. His degree in Botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying Synthetic Biology to plants. One day he hopes to solve all of the world's problems using plants and Synthetic Biology.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<div align="left"><br />
<strong>Erin Garside</strong> <br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/60/UofA09_team_Erin_Garside.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. degree this year and plan to do graduate work in biochemistry. After that - who knows? I think iGEM will be a great experience, and that it's about time Synthetic Biology really took off. In my spare time I like to read, play computer games (especially the Sims) and raise cats.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Boris Henriquez</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ec/UofA09_team_Boris_Heneriquez.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have just completed the third year of my BSc. degree. My favorite classes so far have been in the fields of Biochemistry and Genetics. I am most interested in human development and embryogenesis and hope to learn more about these topics in my fourth year. My ultimate goal is to have a career in the medical industry as both a physician and as a researcher. When I'm not busy with school or work my usual activities are pretty standard. I like to hang out with friends and family and I crave the outdoors. This is my first year with iGEM and I'm really excited to learn more about Synthetic Biology. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Stephen Jahns</strong><br><br />
<em>Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a8/Alberta_steve.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am in my second year at the University of Alberta. After taking a year of engineering, I decided to transfer to molecular genetics in order to fulfill my childhood desire of creating an army of giant bat-rabbits. I plan on going on through to graduate school to earn a PhD in order to reach my goals. In my spare time I like to run around, ride my bike, play music, cook delicious food, and pretty much all the other fun things kids are doing these days. In my first year I helped to build a car with the U of A's Formula SAE fabrication team. I had a good time building stuff out of metal, and this year I know that I'm going to have a blast building (or at least attempting to build) a novel organism out of DNA parts.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Eric Leung</strong> <br><br />
<em>Honors Pharmacology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/c7/Alberta_Eric_Leung.JPG" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently in my final year of an Honors Pharmacology degree. What I do after this degree is up in the air but it is definitely something in the health sciences. In my spare time, I like to play basketball, badminton, run, and catch up on TV shows. Soon I hope I can become a professional baker in my free time. Traveling to Europe, Mexico, and Japan is also in the books somewhere along the way.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>David Lloyd</strong><br> <br />
<em> Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/6f/UofA09_team_David_Lloyd.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am a fourth year student, studying at the University of Alberta. While Biochemistry is my major, I have many interests including Genetics, Immunology, Cell Biology, Bioinformatics, and Microbiology. In my spare time I can be found playing sports like soccer, volleyball, or squash, as well as playing piano, listening to music, and playing video games. In the future, I hope to continue into a graduate program in Biochemistry, Cell Biology, Synthetic Biology, or in another field. iGEM is of great interest to myself because of its application to the future of Synthetic Biology. It is an awesome challenge which will hopefully help me to cultivate myself.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Enoch Ng</strong><br><br />
<em>Biological Sciences/Business</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/7/7c/UofA09_team_Enoch_Ng.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am entering my fourth year of studies at the University of Alberta, and am looking forward to the challenge that iGEM provides. In the future I hope to travel across the world and meet people ranging from Meshaal to Obama and remain a glorified generalist. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Emera Nguyen</strong><br><br />
<em>BSc. Biological Sciences/Economics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/5/52/UofA09_team_Emera_Nguyen.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am a BSc student entering my fourth year in a Biological Sciences major and Economics minor. This year will be my second year on an iGEM team, and my first year representing the U of A team. In my downtime, things I enjoy include spending quality time with friends and family and traveling to lesser-known parts of the world. One year's experience later, the iGEM competition still impresses me with the unique opportunities it provides for student growth. This research competition is one of the highlights of my undergraduate experience.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Mitch Paquette</strong><br><br />
<em>BSc. Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/1/12/IMG_5052.jpg" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I have transfered into the honors program in Molecular Genetics from a BSc General program in Physical Sciences. After my degree is completed I plan to apply to graduate studies in Molecular Biology, after which I hope to work in research or academia. What excites me most about iGEM is the opportunity to gain research experience in such a new field.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Amber Paul</strong><br><br />
<em>BSc. Specialization Immunology and Infection</em><br><br />
</div></td></tr><br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/5/5f/IMG_4987.jpg" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I plan to find the cure for cancer. Seriously. Will be attending graduate school to earn a PhD following my undergraduate degree. I would like to live somewhere warm that allows me to do research, preferably Maui. iGEM is a developmental forefront to Synthetic Biology, something that I love to be part of. Its challenging and fun. To be able to determine the minimal genes for a simple prokaryote, we provide a scaffold to future research on larger, more complex cells such as cancerous tissues, simple eukaryotes, etc.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Julia Pon</strong><br><br />
<em>Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ec/UofA_Julia_Pon_photo.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">My future plans include pursuing PhD in Medical Genetics. I've worked in biological research labs for the past two summers, with last summer spent at the German Cancer Research Institute in Heidelberg, Germany. I'll be working in both the iGEM lab and a Medical Genetics research lab during summer 2009. My heritage is a mixture of English, Chinese, and Danish. iGEM helps move biology to a streamlined, standardized, abstracted process that opens the door to interdisciplinary collaborations and new applications. I'm excited about the many applications of Synthetic Biology and am enjoying the student-directed and team-oriented nature of iGEM.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"> <br />
<strong>Alina Ponomarev</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d6/UofAiGEM2009_Alina_IMG_5023.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently a second year student in Biological Sciences and I am considering transferring into the Immunology and Infection program for my third year. I joined iGEM at the end of my first year and can honestly say that it has been an unbeatable learning experience. It is very exciting to think that the progress we have made can positively impact synthetic biology and society in general. In the future, my career goal is to become a Pediatrician. However, after doing labwork at the iGEM lab this summer, I have begun to consider a career in medical research. </div> <br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Kelly Robinson</strong><br><br />
<em>Hon. Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/92/UofA09_team_Kelly_Robinson.png" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. in Biochemistry this year and have enrolled in the University of Alberta's Chemical Engineering program in hopes of fusing the fundamental science of biological machines with the entrepreneurial world of engineering. I got involved in iGEM a couple of years ago when I went to a presentation put on by one of the past teams. I ended up applying in the middle of the night on the last day of registration. That said, it has been a great experience ever since. I'm glad that this year I get the opportunity to do some full time work and really get into the project. Overall, iGEM has a lot to offer anyone who gets involved (including incorrigible advisors: you know who you are!).</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>James Rodway</strong><br><br />
<em>Electrical Engineering</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a5/UofA09_team_James_Rodway.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently finishing up a co-op Electrical Engineering degree, and am aiming to do some graduate work in more of the computer area, specifically modeling. At the University, I've been involved with the ARVP and iGEM.<br />
I haven't really had much time for hobbies in a while, but when I did I played more video games, the guitar, and I actually read books for entertainment value. During my time on last year's iGEM team I found that it was a pretty cool multidisciplinary project, which drew in a few different disciplines that I have never really interacted with previously. It was very impressive to see what we, and all the iGEM teams, had accomplished by the end of last year's competition.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Andy Spencer</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/ca/UofA09_team_Andy_Spencer.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">In 5 years I see myself on one of two different paths, medicine or oncology research. I grew up in the Okanagan, British Columbia, and love spending my summers at the beach . In my spare time I enjoy playing squash and bouldering. iGEM to me represents a fundamental value of science as a discipline; that people can from diverse backgrounds with a common interest and curiosity can work as a cohesive team to overcome barriers and problems. </div><br />
<br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jonathan Tam</strong><br><br />
<em>Honors Cell Biotechnology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/e2/UofA09_team_Jonathan_Tam.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have completed my Bachelor's degree in Honors Cell Biotechnology and intend to pursue a medical degree in Germany in the near future. I am very interested in the fields of Molecular Biology and Immunology. For the last two years, I have been keeping myself busy studying the development of macrophages in the lab of Dr. Daniel Barreda. Outside of the lab, I am an avid photographer and downhill mountain biker. The iGEM competition accelerates the development of Synthetic Biology as a field. To be a part of our University of Alberta team is an excellent opportunity for collaboration and advancement.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jennifer Yau</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/99/UofAiGEM2009_Jen_IMG_5048.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently in the second year of my undergraduate program with the ultimate goal of attending graduate school to pursue a research career in Geriatric Medicine. Additional science related activities of mine include my interest in astronomy and promoting science to elementary students through volunteer work. Otherwise, I dedicate the majority of my free time to the arts of chainmaille, knitting, and jazz/classical piano. This is my first year on iGEM and I am ecstatic to be partaking in a project that requires such diverse disciplinary backgrounds. Not only will this be a great learning experience in so many perspectives, but also an opportunity to contribute significant ideas to the ongoing research in Synthetic Biology</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>Zach Wiltshire</strong> <br><br />
<em>BSc. Specialization in Cell Biology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/1/19/UofA09_team_Zach_Wiltshire.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am entering into my fourth year in the Cell Biology program at the U of A and have already experienced iGEM once before as a member of the 2008 National Institute for Nanotechnology team. Through my degree I have found myself to have interests ranging from immunology to both eukaryotic & prokaryotic cellular anatomy & physiology. I also happen to be very fond of molecules that fluoresce. My experience with iGEM last year opened my eyes to the possibilities which engineering biological systems can offer. Over the course of the 2009 competition I hope to have just as many opportunities to learn as I did last year.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<tr><td><br />
<a name="Team_Ad"></a><br />
<strong>The Supervisors</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Mike Ellison</strong><br />
<img src="https://static.igem.org/mediawiki/2009/d/d5/UofA09_teamad_Mike_Ellison.jpg" ALIGN="LEFT" hspace="20"><br />
</td></tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Doug Ridgway</strong><br />
<img src="https://static.igem.org/mediawiki/2009/c/cc/UofA09_teamad_Douglas_Ridgway.jpg" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>James Maclagan</strong><br />
<img src="https://static.igem.org/mediawiki/2009/a/ab/UofAigem2009_JamesMIMG_4975.JPG" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<tr><td><br />
<a name="Fac_Con"></a><br />
<strong>Faculty Consultants</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Chris Backhouse</strong><br />
<br><br />
Department of Electrical Engineering<br />
<br><br />
christopher.backhouse@ualberta.ca<br />
<img src="http://www.ece.ualberta.ca/~chrisb/Graphics/Backhouse.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Nanobiotechnologies give us the ability to manipulate and sense at the level of individual molecules, with a tremendous potential impact on both human health and the economy. To a large extent, this potential is likely to be realised through the development of Lab on Chip (LOC) technologies. Although the LOC technologies are powerful, the complexity of the infrastructure required to support LOC operation has hindered the widespread adoption of LOC methods in life science applications. A central theme in the work of the Backhouse lab (<a href="http://www.ece.ualberta.ca/~aml/">the Applied Miniaturisation Lab, AML</a>) is the development of extremely inexpensive (e.g. $1000) systems for implementing nanobiotechnologies/molecular biology, especially for medical diagnostic applications.</div><br />
</td><br />
</tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Robert Campbell</strong><br />
<br><br />
Department of Chemistry<br />
<br><br />
robert.e.campbell@ualberta.ca<br />
<img src="http://www.chem.ualberta.ca/faculty_staff/faculty/facultypics/campbell.jpg" width=200 height=274.19355 ALIGN="LEFT" hspace="20"></a><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Robert E. Campbell is an associate professor and Canada Research Chair in Bioanalytical Chemistry in the Department of Chemistry of the University of Alberta. Research in his laboratory, (<a href="http://www.chem.ualberta.ca/~campbell/">the Campbell Research Group</a>), is focused on protein engineering and the development of new fluorescent protein variants for construction of FRET-based biosensors.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>Linda Reha-Krantz</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
Linda.Reha-Krantz@ualberta.ca<br />
<img src="http://www.biology.ualberta.ca/faculty/bio-187/uploads/images/reha_krantz.jpg" width=200 height=300 ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Tracy Raivio</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Jon Dennis</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
</table><br />
</html></div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-10-21T05:18:07Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/Template3}}<br />
<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=60% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Recoli"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Project BioBytes</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/8/8f/UofAiGEM2009_groupphoto_IMG_5009.JPG" width="320" height="407"><br />
</center><br />
<br />
<br> <br />
<br />
<table><br />
<br />
<tr><br />
<td><br />
<div align="left"><strong>Kalon Armstrong</strong> <br><br />
<em>Molecular Genetics</em> <br><br />
</div><br />
<td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/3/34/UofA09_team_Kalon_Armstrong.jpg" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" >I've recently completed my BSc in Molecular Genetics and will be entering the Engineering program in the fall of 2009. Most of my growing-up took place in the small town of Cochrane, Alberta. My ultimate goals consist of working in the Biotechnology or health care industry. While my interest in music, movies, snowboarding, and hanging out with friends may seem stereotypical on the surface, they feel unique in their own right and keep me busy most of the time. This will be my first year on the U of A iGEM team and I am excited to help take the competition to a new level. I think that iGEM will be a great experience because it demands innovation and collaboration on levels rarely seen in undergraduate programs.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
<tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Eric Bennett</strong><br><br />
<em>Electrical Biomedical Engineering</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ef/UofA09_Eric_Bennett.JPG" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" >I am entering my final year of engineering at the U of A. After graduation, I hope to do research either with a biotechnology company or in grad school. I think that iGEM is a great way to gain valuable experience and is an effective way of accelerating the field of synthetic biology. My interests include brain-machine interfacing, genetic engineering, and robotic control systems. My hobbies include playing guitar, video games, the occasional sport, reading, and fixing my car.</div><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Max Buchko</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="http://igem.biochem.ualberta.ca/wiki/images/3/3d/UofA_iGEM09_Max_Pic1.png" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Honors Biochemistry and wish to pursue a career in medicine. In my time away from the lab I enjoy a wide variety of sports including soccer, boxing, and rifle silhouette shooting. I have also been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs.<br />
I hope for the best with iGEM at MIT in 2009. This competition is a means of proving yourself at an exemplary level amongst many of the top international minds, and it is this challenge that I look forward to the most.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Oscar Cortes</strong><br><br />
<em>Bsc. Specialization molecular genetics</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/7/77/Oscar.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">My future plans include entering into a Masters program in Medical Genetics or Human Genetics, and pursuing this discipline towards a PhD. I enjoy reading books about the human genome and advancements in stem cell research. In my spare time I like to play a variety of sports that I am not necessarily good at: soccer, softball, and dodge ball. I see iGEM as an extraordinary opportunity for me to be exposed to real life research, in which my knowledge of molecular genetics will be challenged, and will help me further my understanding of Synthetic Biology.<br />
"Man with all his noble qualities still bears in his bodily frame the indelible stamp of his lowly origin"- Charles Darwin</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Anh Dao</strong><br><br />
<em>Biological Sciences and Chemistry</em><br> <br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/c/cf/UofA09_team_Ahn_Dao.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am interested in a research career after I finish my degree. I am leaning towards the field of Microbiology to study the many micro-organisms that have not yet been discovered. However, I may enroll in graduate studies after my undergraduate degree to expand my knowledge and gain more experience in the laboratory. Being in a competitive team and atmosphere is a motivating and exciting opportunity that I do not want to miss out on. By creating the smallest artificial E. coli genome we can extend future research. We are attempting to understand and standardize the E. coli genome so that this methodology can be applied to more complex model organisms.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Uchechukwu Davidson</strong><br><br />
<em>Honors biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d5/Uche.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Biochemistry at the University of Alberta. I wish to pursue a career in medicine after my degree. I enjoy sports, movies, and music at my time away from my studies. The iGEM provides an opportunity to experience creativity, innovation, and ingenuity which are sometimes absent at the undergraduate level of science.</div><br />
</td><br />
</tr><br />
<br />
<tr> <br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Youness Elkhalidy</strong><br><br />
<em>Honors immunology and infection</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/f/fe/UofAiGEM2009_Youness_IMG_5049.JPG" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
I am a first year student at the University of Alberta. I hope to enter medical school in the near future. I am currently taking part in mitotic-spindle regulation research from a genetics perspective. I have a passion for science and enjoy sports such as basketball and soccer. iGEM is an great learning experience not only in the cutting-edge field of Synthetic Biology but also in leadership and business management. I will enjoy taking part in research that combines many fields of science as well as socialize with many of my team members who share common interests.<br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Justin Fedor</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://2009.igem.org/Image:IMG_4985.JPG" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I have completed my undergraduate degree in Biochemistry this year and have began my PhD studies this September. I play piano and am attempting to learn the cello. My nerdy tendencies are obvious when I say that I like Star Trek TNG but not DS9. Last summer I worked in the biomedical research lab of Dr. Larry Unsworth of the National Institute for Nanotechnology (NINT), which has further piqued my interest in the field of nanotechnology. In the hopefully not too distant future I plan on becoming a researcher studying the mechanisms of membrane bound enzymes, particularly oxidoreductases. iGEM has proved a fantastic experience, it has served to mature me further as a scientist.</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"> <br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Jason Gardiner</strong> <br><br />
<em>BSc. Specialization in Botany</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/2/2b/UofA09_team_Jason_Gardiner.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">Jason is a veteran of iGEM 2007, where his team "The Butanerds" won first place in the Energy track. His hobbies include Softball, Beach volleyball, soccer, as well as playing the guitar and fiddling with the iGEM 2009 Wiki. Jason has applied to continue his education in graduate studies at the University of Alberta in 2010. His degree in Botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying Synthetic Biology to plants. One day he hopes to solve all of the world's problems using plants and Synthetic Biology.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<div align="left"><br />
<strong>Erin Garside</strong> <br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/60/UofA09_team_Erin_Garside.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. degree this year and plan to do graduate work in biochemistry. After that - who knows? I think iGEM will be a great experience, and that it's about time Synthetic Biology really took off. In my spare time I like to read, play computer games (especially the Sims) and raise cats.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Boris Henriquez</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ec/UofA09_team_Boris_Heneriquez.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have just completed the third year of my BSc. degree. My favorite classes so far have been in the fields of Biochemistry and Genetics. I am most interested in human development and embryogenesis and hope to learn more about these topics in my fourth year. My ultimate goal is to have a career in the medical industry as both a physician and as a researcher. When I'm not busy with school or work my usual activities are pretty standard. I like to hang out with friends and family and I crave the outdoors. This is my first year with iGEM and I'm really excited to learn more about Synthetic Biology. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Stephen Jahns</strong><br><br />
<em>Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a8/Alberta_steve.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am in my second year at the University of Alberta. After taking a year of engineering, I decided to transfer to molecular genetics in order to fulfill my childhood desire of creating an army of giant bat-rabbits. I plan on going on through to graduate school to earn a PhD in order to reach my goals. In my spare time I like to run around, ride my bike, play music, cook delicious food, and pretty much all the other fun things kids are doing these days. In my first year I helped to build a car with the U of A's Formula SAE fabrication team. I had a good time building stuff out of metal, and this year I know that I'm going to have a blast building (or at least attempting to build) a novel organism out of DNA parts.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Eric Leung</strong> <br><br />
<em>Honors Pharmacology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/c7/Alberta_Eric_Leung.JPG" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently in my final year of an Honors Pharmacology degree. What I do after this degree is up in the air but it is definitely something in the health sciences. In my spare time, I like to play basketball, badminton, run, and catch up on TV shows. Soon I hope I can become a professional baker in my free time. Traveling to Europe, Mexico, and Japan is also in the books somewhere along the way.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>David Lloyd</strong><br> <br />
<em> Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/6f/UofA09_team_David_Lloyd.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am a fourth year student, studying at the University of Alberta. While Biochemistry is my major, I have many interests including Genetics, Immunology, Cell Biology, Bioinformatics, and Microbiology. In my spare time I can be found playing sports like soccer, volleyball, or squash, as well as playing piano, listening to music, and playing video games. In the future, I hope to continue into a graduate program in Biochemistry, Cell Biology, Synthetic Biology, or in another field. iGEM is of great interest to myself because of its application to the future of Synthetic Biology. It is an awesome challenge which will hopefully help me to cultivate myself.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Enoch Ng</strong><br><br />
<em>Biological Sciences/Business</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/7/7c/UofA09_team_Enoch_Ng.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am entering my fourth year of studies at the University of Alberta, and am looking forward to the challenge that iGEM provides. In the future I hope to travel across the world and meet people ranging from Meshaal to Obama and remain a glorified generalist. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Emera Nguyen</strong><br><br />
<em>BSc. Biological Sciences/Economics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/5/52/UofA09_team_Emera_Nguyen.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am a BSc student entering my fourth year in a Biological Sciences major and Economics minor. This year will be my second year on an iGEM team, and my first year representing the U of A team. In my downtime, things I enjoy include spending quality time with friends and family and traveling to lesser-known parts of the world. One year's experience later, the iGEM competition still impresses me with the unique opportunities it provides for student growth. This research competition is one of the highlights of my undergraduate experience.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Mitch Paquette</strong><br><br />
<em>BSc. Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/1/12/IMG_5052.jpg" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I have transfered into the honors program in Molecular Genetics from a BSc General program in Physical Sciences. After my degree is completed I plan to apply to graduate studies in Molecular Biology, after which I hope to work in research or academia. What excites me most about iGEM is the opportunity to gain research experience in such a new field.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Amber Paul</strong><br><br />
<em>BSc. Specialization Immunology and Infection</em><br><br />
</div></td></tr><br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/5/5f/IMG_4987.jpg" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I plan to find the cure for cancer. Seriously. Will be attending graduate school to earn a PhD following my undergraduate degree. I would like to live somewhere warm that allows me to do research, preferably Maui. iGEM is a developmental forefront to Synthetic Biology, something that I love to be part of. Its challenging and fun. To be able to determine the minimal genes for a simple prokaryote, we provide a scaffold to future research on larger, more complex cells such as cancerous tissues, simple eukaryotes, etc.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Julia Pon</strong><br><br />
<em>Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ec/UofA_Julia_Pon_photo.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">My future plans include pursuing PhD in Medical Genetics. I've worked in biological research labs for the past two summers, with last summer spent at the German Cancer Research Institute in Heidelberg, Germany. I'll be working in both the iGEM lab and a Medical Genetics research lab during summer 2009. My heritage is a mixture of English, Chinese, and Danish. iGEM helps move biology to a streamlined, standardized, abstracted process that opens the door to interdisciplinary collaborations and new applications. I'm excited about the many applications of Synthetic Biology and am enjoying the student-directed and team-oriented nature of iGEM.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"> <br />
<strong>Alina Ponomarev</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d6/UofAiGEM2009_Alina_IMG_5023.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently a second year student in Biological Sciences and I am considering transferring into the Immunology and Infection program for my third year. I joined iGEM at the end of my first year and can honestly say that it has been an unbeatable learning experience. It is very exciting to think that the progress we have made can positively impact synthetic biology and society in general. In the future, my career goal is to become a Pediatrician. However, after doing labwork at the iGEM lab this summer, I have begun to consider a career in medical research. </div> <br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Kelly Robinson</strong><br><br />
<em>Hon. Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/92/UofA09_team_Kelly_Robinson.png" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. in Biochemistry this year and have enrolled in the University of Alberta's Chemical Engineering program in hopes of fusing the fundamental science of biological machines with the entrepreneurial world of engineering. I got involved in iGEM a couple of years ago when I went to a presentation put on by one of the past teams. I ended up applying in the middle of the night on the last day of registration. That said, it has been a great experience ever since. I'm glad that this year I get the opportunity to do some full time work and really get into the project. Overall, iGEM has a lot to offer anyone who gets involved (including incorrigible advisors: you know who you are!).</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>James Rodway</strong><br><br />
<em>Electrical Engineering</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a5/UofA09_team_James_Rodway.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently finishing up a co-op Electrical Engineering degree, and am aiming to do some graduate work in more of the computer area, specifically modeling. At the University, I've been involved with the ARVP and iGEM.<br />
I haven't really had much time for hobbies in a while, but when I did I played more video games, the guitar, and I actually read books for entertainment value. During my time on last year's iGEM team I found that it was a pretty cool multidisciplinary project, which drew in a few different disciplines that I have never really interacted with previously. It was very impressive to see what we, and all the iGEM teams, had accomplished by the end of last year's competition.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Andy Spencer</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/ca/UofA09_team_Andy_Spencer.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">In 5 years I see myself on one of two different paths, medicine or oncology research. I grew up in the Okanagan, British Columbia, and love spending my summers at the beach . In my spare time I enjoy playing squash and bouldering. iGEM to me represents a fundamental value of science as a discipline; that people can from diverse backgrounds with a common interest and curiosity can work as a cohesive team to overcome barriers and problems. </div><br />
<br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jonathan Tam</strong><br><br />
<em>Honors Cell Biotechnology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/e2/UofA09_team_Jonathan_Tam.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have completed my Bachelor's degree in Honors Cell Biotechnology and intend to pursue a medical degree in Germany in the near future. I am very interested in the fields of Molecular Biology and Immunology. For the last two years, I have been keeping myself busy studying the development of macrophages in the lab of Dr. Daniel Barreda. Outside of the lab, I am an avid photographer and downhill mountain biker. The iGEM competition accelerates the development of Synthetic Biology as a field. To be a part of our University of Alberta team is an excellent opportunity for collaboration and advancement.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jennifer Yau</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/99/UofAiGEM2009_Jen_IMG_5048.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently in the second year of my undergraduate program with the ultimate goal of attending graduate school to pursue a research career in Geriatric Medicine. Additional science related activities of mine include my interest in astronomy and promoting science to elementary students through volunteer work. Otherwise, I dedicate the majority of my free time to the arts of chainmaille, knitting, and jazz/classical piano. This is my first year on iGEM and I am ecstatic to be partaking in a project that requires such diverse disciplinary backgrounds. Not only will this be a great learning experience in so many perspectives, but also an opportunity to contribute significant ideas to the ongoing research in Synthetic Biology</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>Zach Wiltshire</strong> <br><br />
<em>BSc. Specialization in Cell Biology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/1/19/UofA09_team_Zach_Wiltshire.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am entering into my fourth year in the Cell Biology program at the U of A and have already experienced iGEM once before as a member of the 2008 National Institute for Nanotechnology team. Through my degree I have found myself to have interests ranging from immunology to both eukaryotic & prokaryotic cellular anatomy & physiology. I also happen to be very fond of molecules that fluoresce. My experience with iGEM last year opened my eyes to the possibilities which engineering biological systems can offer. Over the course of the 2009 competition I hope to have just as many opportunities to learn as I did last year.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<tr><td><br />
<a name="Team_Ad"></a><br />
<strong>The Supervisors</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Mike Ellison</strong><br />
<img src="https://static.igem.org/mediawiki/2009/d/d5/UofA09_teamad_Mike_Ellison.jpg" ALIGN="LEFT" hspace="20"><br />
</td></tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Doug Ridgway</strong><br />
<img src="https://static.igem.org/mediawiki/2009/c/cc/UofA09_teamad_Douglas_Ridgway.jpg" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>James Maclagan</strong><br />
<img src="https://static.igem.org/mediawiki/2009/a/ab/UofAigem2009_JamesMIMG_4975.JPG" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<tr><td><br />
<a name="Fac_Con"></a><br />
<strong>Faculty Consultants</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Chris Backhouse</strong><br />
<br><br />
Department of Electrical Engineering<br />
<br><br />
christopher.backhouse@ualberta.ca<br />
<img src="http://www.ece.ualberta.ca/~chrisb/Graphics/Backhouse.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Nanobiotechnologies give us the ability to manipulate and sense at the level of individual molecules, with a tremendous potential impact on both human health and the economy. To a large extent, this potential is likely to be realised through the development of Lab on Chip (LOC) technologies. Although the LOC technologies are powerful, the complexity of the infrastructure required to support LOC operation has hindered the widespread adoption of LOC methods in life science applications. A central theme in the work of the Backhouse lab (<a href="http://www.ece.ualberta.ca/~aml/">the Applied Miniaturisation Lab, AML</a>) is the development of extremely inexpensive (e.g. $1000) systems for implementing nanobiotechnologies/molecular biology, especially for medical diagnostic applications.</div><br />
</td><br />
</tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Robert Campbell</strong><br />
<br><br />
Department of Chemistry<br />
<br><br />
robert.e.campbell@ualberta.ca<br />
<img src="http://www.chem.ualberta.ca/faculty_staff/faculty/facultypics/campbell.jpg" width=200 height=274.19355 ALIGN="LEFT" hspace="20"></a><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Robert E. Campbell is an associate professor and Canada Research Chair in Bioanalytical Chemistry in the Department of Chemistry of the University of Alberta. Research in his laboratory, (<a href="http://www.chem.ualberta.ca/~campbell/">the Campbell Research Group</a>), is focused on protein engineering and the development of new fluorescent protein variants for construction of FRET-based biosensors.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>Linda Reha-Krantz</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
Linda.Reha-Krantz@ualberta.ca<br />
<img src="http://www.biology.ualberta.ca/faculty/bio-187/uploads/images/reha_krantz.jpg" width=200 height=300 ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Tracy Raivio</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Jon Dennis</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
</table><br />
</html></div>Ocorteshttp://2009.igem.org/File:Uche.jpgFile:Uche.jpg2009-10-21T05:16:47Z<p>Ocortes: uploaded a new version of "Image:Uche.jpg"</p>
<hr />
<div></div>Ocorteshttp://2009.igem.org/File:Uche.jpgFile:Uche.jpg2009-10-21T05:10:10Z<p>Ocortes: uploaded a new version of "Image:Uche.jpg"</p>
<hr />
<div></div>Ocorteshttp://2009.igem.org/File:Uche.jpgFile:Uche.jpg2009-10-21T05:06:36Z<p>Ocortes: uploaded a new version of "Image:Uche.jpg"</p>
<hr />
<div></div>Ocorteshttp://2009.igem.org/Team:AlbertaTeam:Alberta2009-10-21T04:54:27Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/Template3}}<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=60% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 200; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Recoli"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>BioBytes</h1><br />
<br />
<div align="justify"><br />
<br />
<font size="2"><br />
<p>At present, the cost to synthesize oligonucleotides has been continually declining and therefore their availability is exponentially growing. However, the current technique to ligate pieces of DNA together is outdated. Present methods take a considerable amount of time to piece DNA together, making large constructs incredibly difficult to build. The University of Alberta 2009 iGEM team would like to introduce the BioBytes Chromosome Assembly System. This method refers to a mechanism for rapid and reliable construction of plasmids (i.e. artificial gene sets) in vitro. It allows for the assembly of components in a structured manner within hours rather than days. Our hope is to see this method become a valuable tool for any molecular biologist. Furthermore we have adapted our approach for Biofabrication by developing a robot which can use our method for automated assembly. Finally, microfluidics have been utilized to miniaturize construction allowing for additional validation for automated production of constructs.</p><br />
<p align=right><p align=right><a href="https://2009.igem.org/Team:Alberta/Project/assemblyoverview"> Click here for more...</a> </P><br />
<p>The method can be applied to numerous different applications, however, its greatest application is for the assembling of entire genomes. For this reason we have provided a detailed explanation regarding the requirements of constructing a minimal genome including an in-silico method for identifying essential genes in any organism, and a theoretical design of replacing the host chromosome with the new synthetic genome.</p><br />
<p align=right><p align=right><a href="https://2009.igem.org/Team:Alberta/Project/Bioinformatics"> Click here for more...</a> </P><br />
<br />
</font></div><br />
<br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td style="height: 800; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Overview"><br />
<div style="height: 800; background:#FFFFFF; line-height:100% padding: 3px 0px;"><br />
<h2>The Minimal Genome Project</h2><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<font size="2"><P>The minimal <i>Escherichia coli</i> genome has been the holy grail of biology for a number of years. <i>E. coli</i> is the most widely used cellular research tool by the molecular biology community. Since scientific research is based upon reductionism and simplification for understanding, a simplified version of an experimental model organism such as <i>E. coli</i> is ideally preferred as a chassis for experimentation. Reducing the <i>E. coli</i> genome to roughly 10% of its original size, demonstrates a great simplification of this model organism.</P><br />
<P><br />
To reconstruct such an organism, we plan on building an artificial <i>E. coli</i> chromosome using the BioBytes chromosome assembly system and inserting it into living <i>E. coli</i> cells. We then intend to remove the host chromosome by making it incapable of division, thus allowing only the artificially inserted chromosome to propagate through multiple generations as the cells grow and divide. This is markedly different from the current, time-consuming method of knocking out inessential genes, one at a time, in an effort to produce the minimal genome. It is this difference that we hope to exploit in our attempt to win the race to produce the minimal <i>E. coli</i> genome.</p><br />
</font><br />
</div><br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
<br />
</td><br />
</tr><br />
<tr><br />
<td style="height: 800; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Overview"><br />
<div style="height: 800; background:#FFFFFF; line-height:100% padding: 3px 0px;"><br />
<h2>Team Achievements</h2><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<font size="2"><P> Through our efforts we have made the following accomplishments:</p><br />
<ul><br />
<li>Developed the BioBytes Assembly Method and produced a proof of concept of the design<br />
<li>A kit of components has been added to the registry allowing for use of our system by anyone<br />
<li>Produced a series of modeling programs which can be used to determine the essential genes in any organism<br />
<li>188 essential genes have been amplified and their primers added to the registry<br />
<li>A robot has been developed demonstrating the potential of automation for BioBytes<br />
<li>Validated the method with the use of microfluidics which can be employed for Biofabrication<br />
<li>We have hosted a debate involving synthetic biology<br />
<li>We have constructed and completed a series of presentation to discuss iGEM and promote knowledge of synthetic biology <br />
</ul><br />
<br />
</table><br />
</div><br />
</HTML></div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-10-21T02:10:19Z<p>Ocortes: </p>
<hr />
<div>{{:Team:Alberta/Template3}}<br />
<br />
<html><br />
<head><br />
<style type="text/css"><br />
.b1f, .b2f, .b3f, .b4f{font-size:1px; overflow:hidden; display:block;}<br />
.b1f {height:1px; background:#e1e1e1; margin:0 5px;}<br />
.b2f {height:1px; background:#e1e1e1; margin:0 3px;}<br />
.b3f {height:1px; background:#e1e1e1; margin:0 2px;}<br />
.b4f {height:2px; background:#e1e1e1; margin:0 1px;}<br />
.content {background: #e1e1e1;}<br />
.content div {margin-left: 5px;}<br />
</style><br />
</head><br />
<br />
<div class="all"><br />
<div style="background:#FFFFFF"><br />
<br />
<!-- adjust table width, main background and padding between cells and edge of background --><br />
<br />
<br />
<table width=60% style="background:#FFFFFF; padding:2px;"><br />
<br />
<tr><br />
<td style="height: 400; padding-left: 10px; padding-right: 10px; padding-top: 11px;"><br />
<b class="b1f"></b><b class="b2f"></b><b class="b3f"></b><b class="b4f"></b><br />
<div class="Recoli"><br />
<div style="height: 400; background:#FFFFFF; colorou line-height:100% padding: 3px 0px;"><br />
<h1>Project BioBytes</h1><br />
<br />
<!-- <div align="justify" style="padding-left:20px; padding-right:20px"> --><br />
<div align="justify"><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2009/8/8f/UofAiGEM2009_groupphoto_IMG_5009.JPG" width="320" height="407"><br />
</center><br />
<br />
<br> <br />
<br />
<table><br />
<br />
<tr><br />
<td><br />
<div align="left"><strong>Kalon Armstrong</strong> <br><br />
<em>Molecular Genetics</em> <br><br />
</div><br />
<td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/3/34/UofA09_team_Kalon_Armstrong.jpg" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" >I've recently completed my BSc in Molecular Genetics and will be entering the Engineering program in the fall of 2009. Most of my growing-up took place in the small town of Cochrane, Alberta. My ultimate goals consist of working in the Biotechnology or health care industry. While my interest in music, movies, snowboarding, and hanging out with friends may seem stereotypical on the surface, they feel unique in their own right and keep me busy most of the time. This will be my first year on the U of A iGEM team and I am excited to help take the competition to a new level. I think that iGEM will be a great experience because it demands innovation and collaboration on levels rarely seen in undergraduate programs.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
<tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Eric Bennett</strong><br><br />
<em>Electrical Biomedical Engineering</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ef/UofA09_Eric_Bennett.JPG" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" >I am entering my final year of engineering at the U of A. After graduation, I hope to do research either with a biotechnology company or in grad school. I think that iGEM is a great way to gain valuable experience and is an effective way of accelerating the field of synthetic biology. My interests include brain-machine interfacing, genetic engineering, and robotic control systems. My hobbies include playing guitar, video games, the occasional sport, reading, and fixing my car.</div><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Max Buchko</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="http://igem.biochem.ualberta.ca/wiki/images/3/3d/UofA_iGEM09_Max_Pic1.png" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Honors Biochemistry and wish to pursue a career in medicine. In my time away from the lab I enjoy a wide variety of sports including soccer, boxing, and rifle silhouette shooting. I have also been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs.<br />
I hope for the best with iGEM at MIT in 2009. This competition is a means of proving yourself at an exemplary level amongst many of the top international minds, and it is this challenge that I look forward to the most.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Oscar Cortes</strong><br><br />
<em>Bsc. Specialization molecular genetics</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/7/77/Oscar.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">My future plans include entering into a Masters program in Medical Genetics or Human Genetics, and pursuing this discipline towards a PhD. I enjoy reading books about the human genome and advancements in stem cell research. In my spare time I like to play a variety of sports that I am not necessarily good at: soccer, softball, and dodge ball. I see iGEM as an extraordinary opportunity for me to be exposed to real life research, in which my knowledge of molecular genetics will be challenged, and will help me further my understanding of Synthetic Biology.<br />
"Man with all his noble qualities still bears in his bodily frame the indelible stamp of his lowly origin"- Charles Darwin</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr> <br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Anh Dao</strong><br><br />
<em>Biological Sciences and Chemistry</em><br> <br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/c/cf/UofA09_team_Ahn_Dao.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I am interested in a research career after I finish my degree. I am leaning towards the field of Microbiology to study the many micro-organisms that have not yet been discovered. However, I may enroll in graduate studies after my undergraduate degree to expand my knowledge and gain more experience in the laboratory. Being in a competitive team and atmosphere is a motivating and exciting opportunity that I do not want to miss out on. By creating the smallest artificial E. coli genome we can extend future research. We are attempting to understand and standardize the E. coli genome so that this methodology can be applied to more complex model organisms.</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Uchechukwu Davidson</strong><br><br />
<em>Honors biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/3/3c/UofA09_team_Uche_Davidson.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
<div align="justify" style="padding-right:20px">I am in my third year of Biochemistry at the University of Alberta. I wish to pursue a career in medicine after my degree. I enjoy sports, movies, and music at my time away from my studies. The iGEM provides an opportunity to experience creativity, innovation, and ingenuity which are sometimes absent at the undergraduate level of science.</div><br />
</td><br />
</tr><br />
<br />
<tr> <br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Youness Elkhalidy</strong><br><br />
<em>Honors immunology and infection</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/f/fe/UofAiGEM2009_Youness_IMG_5049.JPG" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><br />
<td><br />
I am a first year student at the University of Alberta. I hope to enter medical school in the near future. I am currently taking part in mitotic-spindle regulation research from a genetics perspective. I have a passion for science and enjoy sports such as basketball and soccer. iGEM is an great learning experience not only in the cutting-edge field of Synthetic Biology but also in leadership and business management. I will enjoy taking part in research that combines many fields of science as well as socialize with many of my team members who share common interests.<br />
</td><br />
</tr><br />
<br />
<tr><br />
<td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Justin Fedor</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2009/7/71/UofA09_team_Justin_Fedor.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" style="padding-right:20px">I have completed my undergraduate degree in Biochemistry this year and will be starting my Ph.D. program in September. I play piano and am attempting to learn the cello. My nerdy tendencies are obvious when I say that I like Star Trek TNG but not DS9. Last summer I worked in the biomedical research lab of Dr. Larry Unsworth of the National Institute for Nanotechnology (NINT), which has further piqued my interest in the field of nanotechnology. In the hopefully not too distant future I plan on becoming a researcher studying the mechanisms of membrane bound enzymes, particularly oxidoreductases.</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"> <br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><br />
<td><br />
<div align="left"><br />
<strong>Jason Gardiner</strong> <br><br />
<em>BSc. Specialization in Botany</em><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/2/2b/UofA09_team_Jason_Gardiner.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">Jason is a veteran of iGEM 2007, where his team "The Butanerds" won first place in the Energy track. His hobbies include Softball, Beach volleyball, soccer, as well as playing the guitar and fiddling with the iGEM 2009 Wiki. Jason has applied to continue his education in graduate studies at the University of Alberta in 2010. His degree in Botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying Synthetic Biology to plants. One day he hopes to solve all of the world's problems using plants and Synthetic Biology.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<div align="left"><br />
<strong>Erin Garside</strong> <br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/60/UofA09_team_Erin_Garside.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. degree this year and plan to do graduate work in biochemistry. After that - who knows? I think iGEM will be a great experience, and that it's about time Synthetic Biology really took off. In my spare time I like to read, play computer games (especially the Sims) and raise cats.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Boris Henriquez</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/ec/UofA09_team_Boris_Heneriquez.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have just completed the third year of my BSc. degree. My favorite classes so far have been in the fields of Biochemistry and Genetics. I am most interested in human development and embryogenesis and hope to learn more about these topics in my fourth year. My ultimate goal is to have a career in the medical industry as both a physician and as a researcher. When I'm not busy with school or work my usual activities are pretty standard. I like to hang out with friends and family and I crave the outdoors. This is my first year with iGEM and I'm really excited to learn more about Synthetic Biology. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Stephen Jahns</strong><br><br />
<em>Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a8/Alberta_steve.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am in my second year at the University of Alberta. After taking a year of engineering, I decided to transfer to molecular genetics in order to fulfill my childhood desire of creating an army of giant bat-rabbits. I plan on going on through to graduate school to earn a PhD in order to reach my goals. In my spare time I like to run around, ride my bike, play music, cook delicious food, and pretty much all the other fun things kids are doing these days. In my first year I helped to build a car with the U of A's Formula SAE fabrication team. I had a good time building stuff out of metal, and this year I know that I'm going to have a blast building (or at least attempting to build) a novel organism out of DNA parts.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Eric Leung</strong> <br><br />
<em>Honors Pharmacology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/c7/Alberta_Eric_Leung.JPG" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently in my final year of an Honors Pharmacology degree. What I do after this degree is up in the air but it is definitely something in the health sciences. In my spare time, I like to play basketball, badminton, run, and catch up on TV shows. Soon I hope I can become a professional baker in my free time. Traveling to Europe, Mexico, and Japan is also in the books somewhere along the way.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>David Lloyd</strong><br> <br />
<em> Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/6/6f/UofA09_team_David_Lloyd.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am a fourth year student, studying at the University of Alberta. While Biochemistry is my major, I have many interests including Genetics, Immunology, Cell Biology, Bioinformatics, and Microbiology. In my spare time I can be found playing sports like soccer, volleyball, or squash, as well as playing piano, listening to music, and playing video games. In the future, I hope to continue into a graduate program in Biochemistry, Cell Biology, Synthetic Biology, or in another field. iGEM is of great interest to myself because of its application to the future of Synthetic Biology. It is an awesome challenge which will hopefully help me to cultivate myself.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Enoch Ng</strong><br><br />
<em>Biological Sciences/Business</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/7/7c/UofA09_team_Enoch_Ng.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am entering my fourth year of studies at the University of Alberta, and am looking forward to the challenge that iGEM provides. In the future I hope to travel across the world and meet people ranging from Meshaal to Obama and remain a glorified generalist. </div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Emera Nguyen</strong><br><br />
<em>BSc. Biological Sciences/Economics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/5/52/UofA09_team_Emera_Nguyen.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am a BSc student entering my fourth year in a Biological Sciences major and Economics minor. This year will be my second year on an iGEM team, and my first year representing the U of A team. In my downtime, things I enjoy include spending quality time with friends and family and traveling to lesser-known parts of the world. One year's experience later, the iGEM competition still impresses me with the unique opportunities it provides for student growth. This research competition is one of the highlights of my undergraduate experience.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<br />
<tr><td><div align="left"><br />
<strong>Mitch Paquette</strong><br><br />
<em>BSc. Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/b/bf/Mitch5012_uofa.igem09.JPG" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I have transfered into the honors program in Molecular Genetics from a BSc General program in Physical Sciences. After my degree is completed I plan to apply to graduate studies in Molecular Biology, after which I hope to work in research or academia. What excites me most about iGEM is the opportunity to gain research experience in such a new field.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Amber Paul</strong><br><br />
<em>BSc. Specialization Immunology and Infection</em><br><br />
</div></td></tr><br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d8/IMG_4987.JPG" width="200" height="300" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I plan to find the cure for cancer. Seriously. Will be attending graduate school to earn a PhD following my undergraduate degree. I would like to live somewhere warm that allows me to do research, preferably Maui. iGEM is a developmental forefront to Synthetic Biology, something that I love to be part of. Its challenging and fun. To be able to determine the minimal genes for a simple prokaryote, we provide a scaffold to future research on larger, more complex cells such as cancerous tissues, simple eukaryotes, etc.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Julia Pon</strong><br><br />
<em>Honors Molecular Genetics</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/3/30/UofA09_team_Julia_Pon.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">My future plans include pursuing PhD in Medical Genetics. I've worked in biological research labs for the past two summers, with last summer spent at the German Cancer Research Institute in Heidelberg, Germany. I'll be working in both the iGEM lab and a Medical Genetics research lab during summer 2009. My heritage is a mixture of English, Chinese, and Danish. iGEM helps move biology to a streamlined, standardized, abstracted process that opens the door to interdisciplinary collaborations and new applications. I'm excited about the many applications of Synthetic Biology and am enjoying the student-directed and team-oriented nature of iGEM.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<br />
<tr><td><div align="left"> <br />
<strong>Alina Ponomarev</strong><br><br />
<em>Biological Sciences</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/d/d6/UofAiGEM2009_Alina_IMG_5023.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently a second year student in Biological Sciences and I am considering transferring into the Immunology and Infection program for my third year. I joined iGEM at the end of my first year and can honestly say that it has been an unbeatable learning experience. It is very exciting to think that the progress we have made can positively impact synthetic biology and society in general. In the future, my career goal is to become a Pediatrician. However, after doing labwork at the iGEM lab this summer, I have begun to consider a career in medical research. </div> <br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Kelly Robinson</strong><br><br />
<em>Hon. Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/92/UofA09_team_Kelly_Robinson.png" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I completed my BSc. in Biochemistry this year and have enrolled in the University of Alberta's Chemical Engineering program in hopes of fusing the fundamental science of biological machines with the entrepreneurial world of engineering. I got involved in iGEM a couple of years ago when I went to a presentation put on by one of the past teams. I ended up applying in the middle of the night on the last day of registration. That said, it has been a great experience ever since. I'm glad that this year I get the opportunity to do some full time work and really get into the project. Overall, iGEM has a lot to offer anyone who gets involved (including incorrigible advisors: you know who you are!).</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>James Rodway</strong><br><br />
<em>Electrical Engineering</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/a/a5/UofA09_team_James_Rodway.jpg" ALIGN="LEFT" hspace="20"><br />
<br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am currently finishing up a co-op Electrical Engineering degree, and am aiming to do some graduate work in more of the computer area, specifically modeling. At the University, I've been involved with the ARVP and iGEM.<br />
I haven't really had much time for hobbies in a while, but when I did I played more video games, the guitar, and I actually read books for entertainment value. During my time on last year's iGEM team I found that it was a pretty cool multidisciplinary project, which drew in a few different disciplines that I have never really interacted with previously. It was very impressive to see what we, and all the iGEM teams, had accomplished by the end of last year's competition.</div><br />
<br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Andy Spencer</strong><br><br />
<em>Honours Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/c/ca/UofA09_team_Andy_Spencer.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">In 5 years I see myself on one of two different paths, medicine or oncology research. I grew up in the Okanagan, British Columbia, and love spending my summers at the beach . In my spare time I enjoy playing squash and bouldering. iGEM to me represents a fundamental value of science as a discipline; that people can from diverse backgrounds with a common interest and curiosity can work as a cohesive team to overcome barriers and problems. </div><br />
<br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jonathan Tam</strong><br><br />
<em>Honors Cell Biotechnology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/e/e2/UofA09_team_Jonathan_Tam.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I have completed my Bachelor's degree in Honors Cell Biotechnology and intend to pursue a medical degree in Germany in the near future. I am very interested in the fields of Molecular Biology and Immunology. For the last two years, I have been keeping myself busy studying the development of macrophages in the lab of Dr. Daniel Barreda. Outside of the lab, I am an avid photographer and downhill mountain biker. The iGEM competition accelerates the development of Synthetic Biology as a field. To be a part of our University of Alberta team is an excellent opportunity for collaboration and advancement.</div><br />
</td></tr> <br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><div align="left"><br />
<strong>Jennifer Yau</strong><br><br />
<em>Honors Biochemistry</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/9/99/UofAiGEM2009_Jen_IMG_5048.JPG" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<div align="justify" style="padding-right:20px">I am currently in the second year of my undergraduate program with the ultimate goal of attending graduate school to pursue a research career in Geriatric Medicine. Additional science related activities of mine include my interest in astronomy and promoting science to elementary students through volunteer work. Otherwise, I dedicate the majority of my free time to the arts of chainmaille, knitting, and jazz/classical piano. This is my first year on iGEM and I am ecstatic to be partaking in a project that requires such diverse disciplinary backgrounds. Not only will this be a great learning experience in so many perspectives, but also an opportunity to contribute significant ideas to the ongoing research in Synthetic Biology</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr> <br />
<br />
<tr><td><div align="left"><br />
<strong>Zach Wiltshire</strong> <br><br />
<em>BSc. Specialization in Cell Biology</em><br><br />
</div></td></tr><br />
<br />
<tr><td><br />
<img src="https://static.igem.org/mediawiki/2009/1/19/UofA09_team_Zach_Wiltshire.jpg" ALIGN="LEFT" hspace="20"><br />
</td><td><br />
<br />
<div align="justify" style="padding-right:20px">I am entering into my fourth year in the Cell Biology program at the U of A and have already experienced iGEM once before as a member of the 2008 National Institute for Nanotechnology team. Through my degree I have found myself to have interests ranging from immunology to both eukaryotic & prokaryotic cellular anatomy & physiology. I also happen to be very fond of molecules that fluoresce. My experience with iGEM last year opened my eyes to the possibilities which engineering biological systems can offer. Over the course of the 2009 competition I hope to have just as many opportunities to learn as I did last year.</div><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<tr><td><br />
<a name="Team_Ad"></a><br />
<strong>The Supervisors</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Mike Ellison</strong><br />
<img src="https://static.igem.org/mediawiki/2009/d/d5/UofA09_teamad_Mike_Ellison.jpg" ALIGN="LEFT" hspace="20"><br />
</td></tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Doug Ridgway</strong><br />
<img src="https://static.igem.org/mediawiki/2009/c/cc/UofA09_teamad_Douglas_Ridgway.jpg" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>James Maclagan</strong><br />
<img src="https://static.igem.org/mediawiki/2009/a/ab/UofAigem2009_JamesMIMG_4975.JPG" ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<tr><td><br />
<a name="Fac_Con"></a><br />
<strong>Faculty Consultants</strong><br />
</tr><td><br />
<br />
<tr><td><br />
<strong>Chris Backhouse</strong><br />
<br><br />
Department of Electrical Engineering<br />
<br><br />
christopher.backhouse@ualberta.ca<br />
<img src="http://www.ece.ualberta.ca/~chrisb/Graphics/Backhouse.jpg" ALIGN="LEFT" hspace="20"><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Nanobiotechnologies give us the ability to manipulate and sense at the level of individual molecules, with a tremendous potential impact on both human health and the economy. To a large extent, this potential is likely to be realised through the development of Lab on Chip (LOC) technologies. Although the LOC technologies are powerful, the complexity of the infrastructure required to support LOC operation has hindered the widespread adoption of LOC methods in life science applications. A central theme in the work of the Backhouse lab (<a href="http://www.ece.ualberta.ca/~aml/">the Applied Miniaturisation Lab, AML</a>) is the development of extremely inexpensive (e.g. $1000) systems for implementing nanobiotechnologies/molecular biology, especially for medical diagnostic applications.</div><br />
</td><br />
</tr><br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<br />
<strong>Robert Campbell</strong><br />
<br><br />
Department of Chemistry<br />
<br><br />
robert.e.campbell@ualberta.ca<br />
<img src="http://www.chem.ualberta.ca/faculty_staff/faculty/facultypics/campbell.jpg" width=200 height=274.19355 ALIGN="LEFT" hspace="20"></a><br />
</td><br />
<br />
<td><br />
<div align="justify" ><br />
Robert E. Campbell is an associate professor and Canada Research Chair in Bioanalytical Chemistry in the Department of Chemistry of the University of Alberta. Research in his laboratory, (<a href="http://www.chem.ualberta.ca/~campbell/">the Campbell Research Group</a>), is focused on protein engineering and the development of new fluorescent protein variants for construction of FRET-based biosensors.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</td></tr><br />
<br />
<tr><td><br />
<strong>Linda Reha-Krantz</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
Linda.Reha-Krantz@ualberta.ca<br />
<img src="http://www.biology.ualberta.ca/faculty/bio-187/uploads/images/reha_krantz.jpg" width=200 height=300 ALIGN="LEFT" hspace="20"></a><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Tracy Raivio</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<tr><td><br />
<strong>Jon Dennis</strong><br />
<br><br />
Department of Biological Sciences<br />
<br><br />
</td></tr><br />
<br />
<tr><td colspan = "2"><br />
<br><br />
<hr style=width:66% align=left><br />
</tr></td><br />
<br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
<br />
</div></div><br />
<b class="b4f"></b><b class="b3f"></b><b class="b2f"></b><b class="b1f"></b><br />
</td><br />
</tr><br />
<br />
</table><br />
</html></div>Ocorteshttp://2009.igem.org/File:Oscar.jpgFile:Oscar.jpg2009-10-21T02:08:57Z<p>Ocortes: uploaded a new version of "Image:Oscar.jpg"</p>
<hr />
<div>Oscar E. Cortes</div>Ocorteshttp://2009.igem.org/File:Oscar.jpgFile:Oscar.jpg2009-10-21T01:41:52Z<p>Ocortes: uploaded a new version of "Image:Oscar.jpg"</p>
<hr />
<div>Oscar E. Cortes</div>Ocorteshttp://2009.igem.org/File:Oscarcortes.jpgFile:Oscarcortes.jpg2009-10-20T22:52:11Z<p>Ocortes: </p>
<hr />
<div></div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-06-13T15:37:01Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy "Ball and Chain"'''<br />
<font color=silver>Andy has a girlfriend. Enough said.<br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Brewster is dead to us.<br />
<br><br />
<br><br />
[[Image:Chongya.jpg|left]] '''<font color=white>Chongya "Chun-Li" Niu'''<br />
<font color=silver>Chongya Niu is currently a typical premed. She works eight hour days, then studies eight more for the MCAT and caps off her evenings by reading bed time stories to the blind, and singing orphans lullabies. She also hates sleep and will do just about anything for an A... And I mean anything.<br />
<br><br />
<br><br />
[[Image:Dan.jpg|left]] '''<font color=white>Daniel "Bat Wings" Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Motor Boater" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
[[Image:Zach]] '''<font color=white>Zachary Wiltshire'''<br />
<br><br />
<font color=silver>Zach is...<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Eric "Qiwei" Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>"Rick" James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>James "Sparky" R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
[[Image:jnynikonpic.jpg|left|160px]] '''<font color=white>Jennifer "Granny" "BusLink" "The Legend" "Shuttle Cock" "Sweat Shop" Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really REALLLY good magic cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. She likes attention from old men, preferably over 80. <br />
<br><br />
<br><br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "Lemminwinks" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Justin "Justice" Fedor'''<br />
<font color=silver>Justin likes beads; all beads, magnetic or normal beads.<br />
<br><br />
<br><br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon "Clam Burglar" Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity... and rainbow colored bowling shirts.<br />
<br><br />
<br><br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>"Moaner" Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;) - that's black men for those who didn't get it), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Black Magic" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Max "Maxy Pads" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. If that doesn't work out, he wishes to pursue a woman who will have a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, rifle silhouette shooting, ballet dancing, and of course interpretative dancing. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs, that is, if he is not re-acting the dance scenes from the movie Flash Dance. <br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh "Compton" Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "True Pimp" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. However, it's no secret that he actually does this so he can have hot nurses take care of him. This is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris "El Pollo Loco" Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys drinking, eating, and taking constant cat naps underneath random trees. This will be his first year with the iGem Team and he is looking forward to sweeping and mopping the lab. <br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "The Russian" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt, if for some odd reason that turns you on. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be hommies. They would have evolution rap battles like the Pokemon rap. On that note, Alina loves Pikachu.<br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-05-28T22:52:24Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Chongya.jpg|left]] '''<font color=white>Chongya "Chun-Li" Niu'''<br />
<font color=silver>Chongya Niu is currently a typical premed. She works eight hour days, then studies eight more for the MCAT and caps off her evenings by reading bed time stories to the blind, and singing orphans lullabies. She also hates sleep and will do just about anything for an A... And I mean anything.<br />
<br><br />
<br><br />
[[Image:Dan.jpg|left]] '''<font color=white>Daniel "Bat Wings" Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Motor Boater" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Zach]] '''<font color=white>Zachary "Dutch Rudder" Wiltshire'''<br />
<br><br />
<font color=silver>Zach is...<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric "Qiwei" Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Rick" James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James "Sparky" R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:jnynikonpic.jpg|left|160px]] '''<font color=white>Jennifer "Shuttle Cock" Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really good cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "Lemminwinks" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin "Justice" '''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon "Clam Burglar" Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Mona" Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;) - that's black men for those who didn't get it), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Token" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Max "True Greatness" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. If that doesn't work out, he wishes to pursue a woman who will have a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, rifle silhouette shooting, ballet dancing, and of course interpretative dancing. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs, that is, if he is not re-acting the dance scenes from the movie Flash Dance. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh "Compton" Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "True Pimp" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. However, it's no secret that he actually does this so he can have hot nurses take care of him. This is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris "El Pollo Loco" Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys drinking, eating, and taking constant cat naps underneath random trees. This will be his first year with the iGem Team and he is looking forward to sweeping and mopping the lab. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "The Russian" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt, if for some odd reason that turns you on. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be hommies. They would have evolution rap battles like the Pokemon rap. On that note, Alina loves Pikachu.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-05-08T16:54:55Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly "Sailor Moon" Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Chongya.jpg|left]] '''<font color=white>Chongya "Chun-Li" Niu'''<br />
<font color=silver>Chongya Niu is currently a typical premed. She works eight hour days, then studies eight more for the MCAT and caps off her evenings by reading bed time stories to the blind, and singing orphans lullabies. She also hates sleep and will do just about anything for an A... And I mean anything.<br />
<br><br />
<br><br />
[[Image:Dan.jpg|left]] '''<font color=white>Daniel "Bat Wings" Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric "Qiwei" Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Rick" James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James "Sparky" R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:jnynikonpic.jpg|left|160px]] '''<font color=white>Jennifer "Manchu Wok" Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really good cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "Lemminwinks" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin "Justice" '''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon "Clam Burglar" Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Mona" Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;) - that's black men for those who didn't get it), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Token" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Max "Fruit-Loop" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, rifle silhouette shooting, ballet dancing, and of course interpretative dancing. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs, that is, if he is not re-acting the dance scenes from the movie Flash Dance. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh "Compton" Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "De La Hoya" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. this is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris "El Pollo Loco" Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys drinking, eating, and taking constant cat naps underneath random trees. This will be his first year with the iGem Team and he is looking forward to sweeping and mopping the lab. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "The Russian" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt, if for some odd reason that turns you on. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be hommies. They would have evolution rap battles like the Pokemon rap. On that note, Alina loves Pikachu.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-05-08T00:01:04Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly "Sailor Moon" Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Chongya.jpg|left]] '''<font color=white>Chongya "Chun-Li" Niu'''<br />
<font color=silver>Chongya Niu is currently a typical premed. She works eight hour days, then studies eight more for the MCAT and caps off her evenings by reading bed time stories to the blind, and singing orphans lullabies. She also hates sleep and will do just about anything for an A... And I mean anything.<br />
<br><br />
<br><br />
[[Image:Dan.jpg|left]] '''<font color=white>Daniel "Bat Wings" Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric "Qiwei" Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Rick" James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James "Sparky" R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:jnynikonpic.jpg|left|160px]] '''<font color=white>Jennifer "Manchu Wok" Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really good cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "lemming wing" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin "Justice" '''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon "Clam Burglar" Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Mona" Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;) - that's black men for those who didn't get it), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Token" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Max "Fruit-Loop" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, rifle silhouette shooting, ballet dancing, and of course interpretative dancing. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs, that is, if he is not re-acting the dance scenes from the movie Flash Dance. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh "Compton" Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "De La Hoya" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. this is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris "El Pollo Loco" Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys drinking, eating, and taking constant cat naps underneath random trees. This will be his first year with the iGem Team and he is looking forward to sweeping and mopping the lab. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "The Russian" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt, if for some odd reason that turns you on. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be hommies. They would have evolution rap battles like the Pokemon rap. On that note, Alina loves Pikachu.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-05-07T23:59:26Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly "Sailor Moon" Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Chongya.jpg|left]] '''<font color=white>Chongya "Chun-Li" Niu'''<br />
<font color=silver>Chongya Niu is currently a typical premed. She works eight hour days, then studies eight more for the MCAT and caps off her evenings by reading bed time stories to the blind, and singing orphans lullabies. She also hates sleep and will do just about anything for an A... And I mean anything.<br />
<br><br />
<br><br />
[[Image:Dan.jpg|left]] '''<font color=white>Daniel Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric "Qiwei" Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Rick" James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James "Sparky" R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:jnynikonpic.jpg|left|160px]] '''<font color=white>Jennifer "Manchu Wok" Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really good cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "lemming wing" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin "Justice" '''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon "Clam Burglar" Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Mona" Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;) - that's black men for those who didn't get it), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Token" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Max "Fruit-Loop" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, rifle silhouette shooting, ballet dancing, and of course interpretative dancing. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs, that is, if he is not re-acting the dance scenes from the movie Flash Dance. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh "Compton" Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "De La Hoya" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. this is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris "El Pollo Loco" Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys drinking, eating, and taking constant cat naps underneath random trees. This will be his first year with the iGem Team and he is looking forward to sweeping and mopping the lab. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "The Russian" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt, if for some odd reason that turns you on. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be hommies. They would have evolution rap battles like the Pokemon rap. On that note, Alina loves Pikachu.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-05-07T23:56:54Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly "Pikachu" Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Chongya.jpg|left]] '''<font color=white>Chongya "Chun-Li" Niu'''<br />
<font color=silver>Chongya Niu is currently a typical premed. She works eight hour days, then studies eight more for the MCAT and caps off her evenings by reading bed time stories to the blind, and singing orphans lullabies. She also hates sleep and will do just about anything for an A... And I mean anything.<br />
<br><br />
<br><br />
[[Image:Dan.jpg|left]] '''<font color=white>Daniel Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric "Qiwei" Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Rick" James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James "Sparky" R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:jnynikonpic.jpg|left|160px]] '''<font color=white>Jennifer "Manchu Wok" Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really good cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "lemming wing" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin "Justice" '''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon "Clam Burglar" Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>"Mona" Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;) - that's black men for those who didn't get it), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Token" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Max "Fruit-Loop" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, rifle silhouette shooting, ballet dancing, and of course interpretative dancing. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs, that is, if he is not re-acting the dance scenes from the movie Flash Dance. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh "Compton" Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "De La Hoya" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. this is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris "El Pollo Loco" Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys drinking, eating, and taking constant cat naps underneath random trees. This will be his first year with the iGem Team and he is looking forward to sweeping and mopping the lab. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "The Russian" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt, if for some odd reason that turns you on. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be hommies. They would have evolution rap battles like the Pokemon rap. On that note, Alina loves Pikachu.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-05-04T17:25:52Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:chris.jpg|left]] '''<font color=white>Chongya Niu'''<br />
<font color=silver>Chris Kelly is a recent graduate of the University of Alberta's molecular genetics program and a first time participant in iGEM. His interests include (but are not limited to) science, science and more science (genetics, biochemistry, microbiology, astronomy, quantum mechanics in particular); but he also enjoys math and philosophy. In his spare time, Chris enjoys the most nerdiest of pursuits - Dungeons and Dragons, Lord of the Rings, video games, arguing on the internet about trivial things (Yes, the Millennium Falcon could kick the Enterprise's butt), reading (mostly non-fiction science books, but occasionaly hard sci-fi) and making countless references to internet memes. His musical tastes are, shall we say, refined? He listens mainly to heavy metal but also likes post-rock, IDM/EDM/EBM and a little bit of shoegaze and neofolk. To top it off, he's a huge fan of Leonard Cohen. Go figure.<br />
<br><br />
<br><br />
[[Image:|left]] '''<font color=white>Daniel Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Jennifer Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really good cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "lemming wing" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;)), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Token" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Maximus "The Gladiator" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, and rifle silhouette shooting. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "De La Hoya" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. this is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris "El Pollo Loco" Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys napping, drinking, eating and dancing. This will be his first year with the iGem Team. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "Gasolina" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be homies. They would have evolution rap battles. On that note, Alina loves hip hop.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-05-04T17:24:28Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
<br />
[[image:teamminime.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:chris.jpg|left]] '''<font color=white>Chongya Niu'''<br />
<font color=silver>Chris Kelly is a recent graduate of the University of Alberta's molecular genetics program and a first time participant in iGEM. His interests include (but are not limited to) science, science and more science (genetics, biochemistry, microbiology, astronomy, quantum mechanics in particular); but he also enjoys math and philosophy. In his spare time, Chris enjoys the most nerdiest of pursuits - Dungeons and Dragons, Lord of the Rings, video games, arguing on the internet about trivial things (Yes, the Millennium Falcon could kick the Enterprise's butt), reading (mostly non-fiction science books, but occasionaly hard sci-fi) and making countless references to internet memes. His musical tastes are, shall we say, refined? He listens mainly to heavy metal but also likes post-rock, IDM/EDM/EBM and a little bit of shoegaze and neofolk. To top it off, he's a huge fan of Leonard Cohen. Go figure.<br />
<br><br />
<br><br />
[[Image:|left]] '''<font color=white>Daniel Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Frenchie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too. Denis just might be hit by a flying-from-out-of-nowhere, hardcover French dictionary this summer. This sad event may have been illicited by his incessant antics messing with EDIT functions. It's probably a good thing he has already fulfilled his life's wish of skydiving...<br />
<br><br />
<br><br />
Denis might be innocent with respect to the allegations put in front of him, but still deserves to be hit with the dictionary. As should Oscar for reasons unbeknownst to him. Team dynamics are awesome!<br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
Enoch has simultaneously been voluntold to every single subteam that does not require complex knowledge of anything cellular.<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>Emera "Darkness" Nguyen'''<br />
<font color=silver>Emera is a third year BSc Biological Sciences/Economics student. This will be her second year competing in iGEM. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Jennifer Yau'''<br><br />
<font color=silver>Jen is currently a second year honors biochemistry student and a newbie to igem. When she isn't busy perfecting her skills in the lab, she bakes cookies...really really good cookies. In addition, she enjoys chainmaille-ing, knitting, and playing the piano. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan "lemming wing" Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Kiwi Fruit is a 2nd year Biochemistry student. He just loves being fruity..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate (if you know what i mean ;)), hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Road Rash" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Token" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max 1.jpg|left|160px]] '''<font color=white>Maximus "The Gladiator" Buchko'''<br />
<font color=silver>This is Max's first iGEM experience and is hoping for the best with the 2009 University of Alberta team down at MIT. He is in his third year of Honors Biochemistry and wishes to pursue a career in medicine. In his time away from the lab he enjoys a wide variety of sports including soccer, boxing, and rifle silhouette shooting. He also has been known to strum a chord or two at an intolerable volume to the annoyance of the people living upstairs. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "De La Hoya" Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. this is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:N523140880 629192 9080.jpg|left|160px]] '''<font color=white>Boris Henriquez'''<br><br />
<font color=silver>Boris is in the third year of his Bachelor degree in biological sciences. He enjoys napping, drinking, eating and dancing. This will be his first year with the iGem Team. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Example.jpg|left|160px]]'''<font color=white>Alina "Gasolina" Ponomarev'''<br><br />
<font color=silver>Alina is the newbie because she's only in the first year of her Bachelor degree in Biological Sciences. But don't be fooled... She is a 2nd degree black belt in taekwondo and can kick your butt. She is also from St.Petersburg, Russia. Her favorite topic in biology is evolution and if Charles Darwin was still alive, he and Alina would be homies. They would have evolution rap battles. On that note, Alina loves hip hop.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmaclagan.jpg|left|160px]] '''James Maclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-03-31T07:12:43Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
[[image:justice League.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:chris.jpg|left]] '''<font color=white>Chongya Niu'''<br />
<font color=silver>Chris Kelly is a recent graduate of the University of Alberta's molecular genetics program and a first time participant in iGEM. His interests include (but are not limited to) science, science and more science (genetics, biochemistry, microbiology, astronomy, quantum mechanics in particular); but he also enjoys math and philosophy. In his spare time, Chris enjoys the most nerdiest of pursuits - Dungeons and Dragons, Lord of the Rings, video games, arguing on the internet about trivial things (Yes, the Millennium Falcon could kick the Enterprise's butt), reading (mostly non-fiction science books, but occasionaly hard sci-fi) and making countless references to internet memes. His musical tastes are, shall we say, refined? He listens mainly to heavy metal but also likes post-rock, IDM/EDM/EBM and a little bit of shoegaze and neofolk. To top it off, he's a huge fan of Leonard Cohen. Go figure.<br />
<br><br />
<br><br />
[[Image:|left]] '''<font color=white>Daniel Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Jolie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:justinp.jpg|left|160px]] '''<font color=white>Emera "Schulze" Nguyen'''<br />
<font color=silver>Emera enjoys yelling at small children, punting miniature dogs, and acting as Wayne's left hand woman. She also enjoys pastries, cream puffs, and a nice bottle of Sherry each night before curling up in front of the fire with the latest translation of Mien Kempf.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Jen'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate, hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Who ate all the chocolate chips?" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Why Am I Here?" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max.jpg|left|160px]] '''<font color=white>Maximus "The Gladiator" Buchko'''<br />
<font color=silver>Max is the manchild of team Alberta. He is currently seeking a "playmate" with similar interests, particularly whoopy cushions, teasing girls with coodies (who he secretly has crushes on), and making fart noises with his armpit. He also likes Spanish girls and sometimes...boys. That's why one day he's going to marry Dora the Explorer's father... <br />
<br><br />
<br><br />
...He just doesn't know it yet.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]] '''<font color=white>Oscar "...." Cortes'''<br />
<font color=silver>Oscar is in his third year Bsc. specialization molecular genetics, he enjoys getting himself into trouble and as a consequence ending up in a Hospital. this is his first year with the iGEM team and he is having a blast. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmclagan.jpg|left|160px]] '''James Mclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/Team:Alberta/TeamTeam:Alberta/Team2009-03-31T07:06:43Z<p>Ocortes: </p>
<hr />
<div><html><br />
<head><br />
<style><br />
table {<br />
background-color: #191919;<br />
font-color: #FFFFFF;<br />
color:white;<br />
}<br />
a.menu {<br />
background-color: #191919;<br />
color: white;<br />
width: 10em;<br />
}<br />
<br />
.firstHeading {<br />
color:white;<br />
}<br />
<br />
#bodyContent {<br />
background-color: #191919;<br />
}<br />
<br />
#content {<br />
background-color: 000000;<br />
}<br />
<br />
#footer-box {<br />
background-color: #000000;<br />
}<br />
p {<br />
color:#333333;<br />
}<br />
body {<br />
background-color:#ffffff;<br />
}<br />
.firstHeading {<br />
display:none;<br />
}<br />
</style><br />
</head><br />
</html><br />
[[image:justice League.jpg|950px|center]]<br />
{| align="center"<br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta}} https://static.igem.org/mediawiki/2008/a/af/HOMEUAB.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Team}} https://static.igem.org/mediawiki/2008/7/7c/TEAMUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Project}} https://static.igem.org/mediawiki/2008/7/7e/PROJECTUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Parts}} https://static.igem.org/mediawiki/2008/c/c0/PARTSUA.png]</span><br />
<span class="plainlinks">[{{SERVER}}{{localurl:Team:Alberta/Notebook}} https://static.igem.org/mediawiki/2008/f/f9/NOTEBOOKUA.png]</span><br />
<br />
<br />
<P>[[Image:Kelly.jpg|left|160px]] '''<font color=white>Kelly Robinson</font>'''<br />
<font color=silver>Kelly Robinson is currently involved in the 2009 University of Alberta iGEM team. She is in her final year of an Honors Biochemistry program, and wishes the actively pursue molecular virology in graduate studies. In her spare time, she enjoys playing video games, Magic the Gathering, watching anime and reading (anything from the Future of Spacetime to Metamorphoses). Her favorite bands include, but are not limited to, Opeth, Tristania, Blind Guardian and Lake of Tears.</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jason.jpg|left|160px]] '''<font color=white>Jason "The Vet" Gardiner'''<br />
<font color=silver>Jason is a veteran of IGEM 2007 where his team the Butanerds won first place in the Energy track. Jason is currently in his fourth year of his Bachelor degree specializing in Botany. His hobbies include Softball, Beach volley ball, soccer, as well as playing the guitar and fiddling with the IGEM 2009 Wiki. Jason has applied to continue his education in grad studies at the University of Alberta in 2010. His degree in botany focuses mostly on the molecular side of plants and he hopes to use this knowledge applying synthetic biology to plants.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Amber.jpg|160px|left]] '''<font color=white>Amber "Tattoo" Paul'''<br />
<font color=silver> Hi, my name is Amber. I`m a Pisces, and my hobbies include beer, big men, and fast bikes or fast men and big bikes. Whatever comes first. <br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:13.jpg|160px|left]] '''<font color=white>Andy'''<br />
<font color=silver>Benny is entering his fifth year of study in UofA's Electrical Engineering (Biomedical Specialization) program, having transferred from the Engineering Physics program. This is his first year participating in the iGEM competition. He joined the team in hopes of gaining field experience, and meeting potential colleagues from around the world. In his spare time, he enjoys writing/playing music on his electric guitar, studying new languages (Mandarin, Japanese, and eventually Spanish), video games, reading, and just chilling in general.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:cheekoo.jpg|left]] '''<font color=white>Brewster "Brewster" Laxston'''<br />
<font color=silver>Saima Zamir is in her third year of Biological Sciences Program at U of A and a proud member of 2008 iGEM Team. She plans to be a hot shot neurosurgeon one day. In her spare time, she works diligently on building her Zamir Memorial Hospital, one fantasy brick at a time - in addition to glass etching and pencil sketching. With her dancing shoes and Mighty wings, she is going places!!<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:chris.jpg|left]] '''<font color=white>Chongya Niu'''<br />
<font color=silver>Chris Kelly is a recent graduate of the University of Alberta's molecular genetics program and a first time participant in iGEM. His interests include (but are not limited to) science, science and more science (genetics, biochemistry, microbiology, astronomy, quantum mechanics in particular); but he also enjoys math and philosophy. In his spare time, Chris enjoys the most nerdiest of pursuits - Dungeons and Dragons, Lord of the Rings, video games, arguing on the internet about trivial things (Yes, the Millennium Falcon could kick the Enterprise's butt), reading (mostly non-fiction science books, but occasionaly hard sci-fi) and making countless references to internet memes. His musical tastes are, shall we say, refined? He listens mainly to heavy metal but also likes post-rock, IDM/EDM/EBM and a little bit of shoegaze and neofolk. To top it off, he's a huge fan of Leonard Cohen. Go figure.<br />
<br><br />
<br><br />
[[Image:|left]] '''<font color=white>Daniel Cotfas'''<br />
<font color=silver> Daniel is a fourth year Biological Sciences student, graduating on June 3rd, 2009. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:david.jpg|160px|left]] '''<font color=white>David "Str8 Up Hawtie" Lloyd'''<br />
<font color=silver> David Lloyd is a 3rd year student, studying at the University of Alberta. While biochemistry is his major, David has many interests including genetics, immunology, cell biology, bioinformatics, and microbiology. In his spare time he can bound found playing sports, including soccer, volleyball or squash, as well as playing piano, listening to music, and playing video games. Yo, I'm a str8 up G, the lab life is the life for me. Running gels by day, plating colonies by night, being a synbiologist is hella tight. Yo I'm the mighty D to the avid but we never stay low that's why I'm Lloyd. I take out those gene the way I out them playa hatas. Straight up, no one pippettes like the mighty D. Don't be calling me to plate that garbage, you be wasting my minutes. I burst them cells like I pop my lab colla. Don't mess with with this straight G, I'll you won't have an eye left for iGem. PEACE<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:profile pic 1.jpg|left|160px]] '''<font color=white>Denis "Jolie" Joly'''<br />
<font color=silver>Denis hails from St. Paul, Alberta. A town where men are men and women are too.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
'''<font color=white>[[Image:]]>Enoch "Half Pint" NG'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:justinp.jpg|left|160px]] '''<font color=white>Emera "Schulze" Nguyen'''<br />
<font color=silver>Emera enjoys yelling at small children, punting miniature dogs, and acting as Wayne's left hand woman. She also enjoys pastries, cream puffs, and a nice bottle of Sherry each night before curling up in front of the fire with the latest translation of Mien Kempf.<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Eric Leung'''<br><br />
<font color=silver>Eric is currently in his third year of a pharmacology degree. He enjoys playing basketball and badminton, drawing, and trying to catch up to TV series such as <i>House</i> and <i>Heroes</i>. Oh, and the Oilers rock.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>James'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white James R'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Jen'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Jon.jpg|left|160px]] '''<font color=white>Jonathan Tam'''<br />
<font color=silver> ..<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Justin'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:Igem_edit.jpg|left|160px]] '''<font color=white> Kalon Amstrong'''<br />
<font color=silver>Kalon Armstrong is a 4th year UofA student finishing off a BSc specializing in Molecular Genetics. Most of his growing-up and schooling took place in the small town of Cochrane, AB. This will be his first year on UofA's IGEM team and he is excited help take the competition to a new level. His ultimate goals consist of working in the Biotech or healthcare industry. When lab work,textbooks & energy drinks are aside, Kalon volunteers at the Student Distress Center on campus. While his interest in music, movies, snowboarding & hanging with friends etc. may seem stereotypical on the surface, they feel unique in their own right and keep him more than busy most of the time.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Kiwi Fruit'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:kevin.jpg|160px|left]] '''<font color=white>Kevin "Quarter Pint" Tok'''<br />
<font color=silver>I enjoys to spend time with my cuzin' Bobbie-Sue. She has a purtty mouf. and she ed-u-a-cated to the third level in school, ele-ment-ary, that is. I also love my dog. <br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Lisa'''<br />
<font color=silver>Saul Godkewitsch, hailing from beautiful Canmore, Alberta, is in his fourth year of<br />
Electrical Engineering studies, biomedical option. While pipettes and Eppendorf tubes<br />
aren't his specialty, the iGEM project proved to be one of the most exciting pursuits of<br />
his summer. When he wasn't making gels or preparing overnights, Saul was spending time<br />
working on his diffusion tensor tractography project of neurodevelopment in the corpus<br />
callosum (read: "brain stuff"), or playing squash. Aside from schoolwork, Saul<br />
volunteers at the Campus Food Bank, plays guitar and enjoys sports of all variety.<br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:]] '''<font color=white>Julia "Try Hard" Pon'''<br />
<font color=silver>Julia enjoys doing essays for fun and auditing molecular genetics classes...Okay, I feel like I should update this somehow, but that pretty much sums it up. Sad but true. I also have an addiction for dark chocolate, hate golf with a passion and like the word wapiti. I also wish I was clever enough to be the first one to realize Winnipeg sounds like a cheap contest for pirates. I'm in third year honors molecular genetics.<br />
<br><br />
<br><br />
<br><br />
[[Image:steve.jpg|160px|left]] '''<font color=white>Stephen "Who ate all the chocolate chips?" Jahns'''<br />
<font color=silver>Steve's in 2nd year genetics. He likes sandwiches. <br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Uche.jpg|160px|left]] '''<font color=white>Uche "Why Am I Here?" Davidson'''<br />
<font color=silver>Uche enjoys the soulful music of 98 degrees, N Sync, and Backstreet Boys. His interest include collecting Jonas brother posters and just can't understand how people don't know every word to HSM1,2, and 3! And OMG, if they know the dance moves... (you don't even want to know)<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Max.jpg|left|160px]] '''<font color=white>Maximus "The Gladiator" Buchko'''<br />
<font color=silver>Max is the manchild of team Alberta. He is currently seeking a "playmate" with similar interests, particularly whoopy cushions, teasing girls with coodies (who he secretly has crushes on), and making fart noises with his armpit. He also likes Spanish girls and sometimes...boys. That's why one day he's going to marry Dora the Explorer's father... <br />
<br><br />
<br><br />
...He just doesn't know it yet.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:]] '''<font color=white>Anh Dao'''<br><br />
<font color=silver>Anh is currently in her third year, majoring in Biological Sciences and Chemistry. This is her first year participating in the University of Alberta iGem Team. Her hobbies include playing the piano, drawing and cooking up strange concoctions she calls food.<br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:Oscar.jpg|left|160px]]<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
==<font color=gold>Advisors</font>==<br />
<br />
[[Image:mikedeyholos.jpg|left|160px]] '''Dr. Michael Deyholos'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:doug.jpg|left|160px]] '''Dr. Douglas "Pinky" Ridgway'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:mikeellison.jpg|160px|left]] '''Dr. Michael "The Brain" Ellison'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:jamesmclagan.jpg|left|160px]] '''James Mclagan'''<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
[[Image:waynemateri.jpg|160px|left]] '''Dr. Wayne Materi'''<br />
<font color=silver><br />
<br><br />
<br><br />
<br><br />
Background & Interests: BSc Computing Science Simon Frasier University, PhD Molecular Biology and Genetics University of Alberta, interests include neural development of nematode C. elegans and Synthetic Biology(design and construction of novel genetically modified bacteria to perform useful manufacturing and medical functions)</font><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
==<font color=gold>What we did</font>==<br />
(Provide proper attribution for all work)<br />
<br><br />
<br><br />
<br />
==<font color=gold>Where we're from</font>==</div>Ocorteshttp://2009.igem.org/File:Oscar.jpgFile:Oscar.jpg2009-03-31T06:53:10Z<p>Ocortes: Oscar E. Cortes</p>
<hr />
<div>Oscar E. Cortes</div>Ocortes