http://2009.igem.org/wiki/index.php?title=Special:Contributions/Pierluigi.Stallone&feed=atom&limit=50&target=Pierluigi.Stallone&year=&month=2009.igem.org - User contributions [en]2024-03-28T21:59:31ZFrom 2009.igem.orgMediaWiki 1.16.5http://2009.igem.org/Team:Bologna/Judging_CriteriaTeam:Bologna/Judging Criteria2009-10-22T02:37:35Z<p>Pierluigi.Stallone: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<center><br />
<font size="6"><b>BRONZE MEDAL</b></font></center><br />
<br><br />
[[Image:Bronzo.png|center|]]<br />
<br><br />
<br />
<div style="text-align:justify"><br />
<font size="3"><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Register the team, have a great summer, and have fun attending the Jamboree.<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Successfully complete and submit a [[Project Summary form]].<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Create and share a Description of the team's [https://2009.igem.org/Team:Bologna/Project project] via the iGEM wiki.<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Present a Poster and Talk at the iGEM Jamboree<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Enter information detailing at least one new standard BioBrick Part or Device in the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201001 Registry of Standard Parts]<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Submit DNA for at least one new [https://2009.igem.org/Team:Bologna/Parts BioBrick Part or Device] to the Registry of Parts.<br />
</font><br />
<br />
<br><br><br><br />
<center><br />
<font size="6"><b>SILVER MEDAL</b></font></center><br />
<br><br />
<font size="3"><br />
[[Image:Argento.png|center|]]<br />
<br><br />
[[Image:yes_check.png|50px|left|]]<br />
Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device <br><br><br />
* We did it for the Standard BioBrick BBa_K201001 and results can be found both in our [https://2009.igem.org/Team:Bologna/Characterization wiki] and in the [http://partsregistry.org/Part:BBa_K201001:Experience Registry of Standard parts]<br />
<br><br><br><br />
<center><br />
<font size="6"><b>GOLD MEDAL</b></font></center><br />
<br><br />
<font size="3"><br />
[[Image:oro.png|center|]]<br />
<br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Characterize or improve an existing BioBrick Part or Device and enter this information back on the Registry. <br><br><br />
* We characterized two BioBricks that Bologna iGEM team submitted last year: [http://partsregistry.org/Part:BBa_K079031:Experience BBa_K079031] and [http://partsregistry.org/Part:BBa_K079032:Experience BBa_K079032]<br />
* We submitted the three Lac operators ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K201005 O1], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201004 O2], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201006 Osym]) on Standard plasmids<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br />
<br> Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system <br><br><br />
* We realized and sent the BioBrick [http://partsregistry.org/Part:BBa_K201002 BBa_K201002] to UNIPV-Pavia iGEM team <br />
<br><br><br><br />
<br />
[[Image:yellowtick.png|50px|left|]]<br />
Outline and detail a new approach to an issue of [https://2009.igem.org/Team:Bologna/Human_Practice Human Practice] in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.</div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/Judging_CriteriaTeam:Bologna/Judging Criteria2009-10-22T02:35:36Z<p>Pierluigi.Stallone: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<center><br />
<font size="6"><b>BRONZE MEDAL</b></font></center><br />
<br><br />
[[Image:Bronzo.png|center|]]<br />
<br><br />
<br />
<div style="text-align:justify"><br />
<font size="3"><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Register the team, have a great summer, and have fun attending the Jamboree.<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Successfully complete and submit a [[Project Summary form]].<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Create and share a Description of the team's [https://2009.igem.org/Team:Bologna/Project project] via the iGEM wiki.<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Present a Poster and Talk at the iGEM Jamboree<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Enter information detailing at least one new standard BioBrick Part or Device in the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201001 Registry of Standard Parts]<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Submit DNA for at least one new [https://2009.igem.org/Team:Bologna/Parts BioBrick Part or Device] to the Registry of Parts.<br />
</font><br />
<br />
<br><br><br><br />
<center><br />
<font size="6"><b>SILVER MEDAL</b></font></center><br />
<br><br />
<font size="3"><br />
[[Image:Argento.png|center|]]<br />
<br><br />
[[Image:yes_check.png|50px|left|]]<br />
Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device <br><br><br />
* We did it for the Standard BioBrick BBa_K201001 and results can be found both in our [https://2009.igem.org/Team:Bologna/Characterization] and in the [http://partsregistry.org/Part:BBa_K201001:Experience Registry of Standard parts]<br />
<br><br><br><br />
<center><br />
<font size="6"><b>GOLD MEDAL</b></font></center><br />
<br><br />
<font size="3"><br />
[[Image:oro.png|center|]]<br />
<br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br><br />
Characterize or improve an existing BioBrick Part or Device and enter this information back on the Registry. <br><br><br />
* We characterized two BioBricks that Bologna iGEM team submitted last year: [http://partsregistry.org/Part:BBa_K079031:Experience BBa_K079031] and [http://partsregistry.org/Part:BBa_K079032:Experience BBa_K079032]<br />
* We submitted the three Lac operators ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K201005 O1], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201004 O2], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201006 Osym]) on Standard plasmids<br />
<br><br><br />
[[Image:yes_check.png|50px|left|]]<br />
<br />
<br> Help another iGEM team by, for example, characterizing a part, debugging a construct, or modeling or simulating their system <br><br><br />
* We realized and sent the BioBrick [http://partsregistry.org/Part:BBa_K201002 BBa_K201002] to UNIPV-Pavia iGEM team <br />
<br><br><br><br />
<br />
[[Image:yellowtick.png|50px|left|]]<br />
Outline and detail a new approach to an issue of [https://2009.igem.org/Team:Bologna/Human_Practice Human Practice] in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.</div>Pierluigi.Stallonehttp://2009.igem.org/File:FluorescenceCurveAbsolute1.pngFile:FluorescenceCurveAbsolute1.png2009-10-22T02:24:17Z<p>Pierluigi.Stallone: </p>
<hr />
<div></div>Pierluigi.Stallonehttp://2009.igem.org/File:TabellaPromotori3.pngFile:TabellaPromotori3.png2009-10-22T02:15:43Z<p>Pierluigi.Stallone: </p>
<hr />
<div></div>Pierluigi.Stallonehttp://2009.igem.org/File:Fluorescenza1.pngFile:Fluorescenza1.png2009-10-22T02:05:10Z<p>Pierluigi.Stallone: </p>
<hr />
<div></div>Pierluigi.Stallonehttp://2009.igem.org/File:OD1.pngFile:OD1.png2009-10-22T02:04:31Z<p>Pierluigi.Stallone: </p>
<hr />
<div></div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/PartsTeam:Bologna/Parts2009-10-22T01:21:43Z<p>Pierluigi.Stallone: /* Submitted Parts */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br><br><br />
<br />
=Submitted Parts=<br />
These are the new parts added and whose DNAs were sent to the Registry. <br />
{|<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|width=15| '''N°'''<br />
|width=85| '''NAME'''<br />
|width=85| '''TYPE'''<br />
|width=980| '''DESCRIPTION'''<br />
|width=95| '''PLASMID'''<br />
|width=50| '''LENGTH (bp)'''<br />
|width=1| '''SEQUENCED'''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 1<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201000 BBa_K201000] <br />
| Generator<br />
| LacI repressed GFP generator with BBa_K201007<br />
| BBa_PSB1A2<br />
| 986<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 2<br />
| [http://partsregistry.org/Part:BBa_K201001:Experience BBa_K201001] <br />
| Generator<br />
| LacI repressed GFP generator with BBa_K201008<br />
| BBa_PSB1A2<br />
| 986<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 3<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201002 BBa_K201002] <br />
| Generator<br />
| LacI repressor constitutive supplier <br />
| BBa_PSB1A2<br />
| 1351<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 4<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201002 BBa_K201002] <br />
| Generator<br />
| LacI repressor constitutive supplier <br />
| BBa_PSB3K3<br />
| 1351<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 5<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201003 BBa_K201003] <br />
| Generator<br />
| GFP generator<br />
| BBa_PSB1A2<br />
| 918<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 6<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201003 BBa_K201003] <br />
| Generator<br />
| GFP generator<br />
| BBa_PSB3K3<br />
| 918<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 7<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201004 BBa_K201004] <br />
| Regulatory<br />
| Lac natural operator O2 with RFP<br />
| BBa_PSB1A2<br />
| 733<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 8<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201005 BBa_K201005] <br />
| Regulatory<br />
| Lac natural operator O1 with RFP.<br />
| BBa_PSB1A2<br />
| 733<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 9<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201006 BBa_K201006] <br />
| Regulatory<br />
| Lac natural operator Osym with RFP.<br />
| BBa_PSB1A2<br />
| 732<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 10<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201007 BBa_K201007] <br />
| Regulatory<br />
| LacI repressed promoter BBa_J23118<br />
| BBa_PSB1A2<br />
| 776<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 11<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201008 BBa_K201008] <br />
| Regulatory<br />
| LacI repressed promoter BBa_J23100<br />
| BBa_PSB1A2<br />
| 776<br />
| -<br />
|}<br />
<br />
<br><br />
<br />
=Improved Parts=<br />
We added new information about parts already present in the Registry. More details in the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079031 wet-lab section]. <br />
{|<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|width=15| '''N°'''<br />
|width=85| '''NAME'''<br />
|width=85| '''TYPE'''<br />
|width=980| '''DESCRIPTION'''<br />
|width=50| '''LENGTH (bp)'''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 1<br />
| [http://partsregistry.org/Part:BBa_K079031:Experience BBa_K079031] <br />
| Reporter<br />
| GFP reporter protein under the control of the BBa_J23118 promoter <br />
| 957<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 2<br />
| [http://partsregistry.org/Part:BBa_K079032:Experience BBa_K079032] <br />
| Reporter<br />
| GFP reporter protein under the control of the BBa_J23100 constitutive promoter <br />
| 957<br />
|}<br />
<br><br />
<br />
=Added Parts=<br />
These parts should have been use in T-REX device, but we didn't succed in cloning them on standard plasimids.<br />
{|<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|width=15| '''N°'''<br />
|width=85| '''NAME'''<br />
|width=85| '''TYPE'''<br />
|width=960| '''DESCRIPTION'''<br />
|width=80| '''LENGTH (bp)'''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 1<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201010 BBa_K201010] <br />
| DNA<br />
| Cis-Repressing sequence, to be used for T-REX device<br />
| 105<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 2<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201011 BBa_K201011] <br />
| DNA<br />
| Trans-Repressor (4) sequence, to be used for T-REX device<br />
| 103<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 3<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201012 BBa_K201012] <br />
| DNA<br />
| Trans-Repressor (7) sequence, to be used for T-REX device<br />
| 100<br />
|}<br />
<br />
<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Parts ''Up'']</div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/PartsTeam:Bologna/Parts2009-10-21T21:31:28Z<p>Pierluigi.Stallone: /* Improved Parts */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br><br><br />
<br />
=Submitted Parts=<br />
These are the new parts added and whose DNAs were sent to the Registry. <br />
{|<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|width=15| '''N°'''<br />
|width=85| '''NAME'''<br />
|width=85| '''TYPE'''<br />
|width=980| '''DESCRIPTION'''<br />
|width=95| '''PLASMID'''<br />
|width=50| '''LENGTH (bp)'''<br />
|width=1| '''SEQUENCED'''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 1<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201000 BBa_K201000] <br />
| Generator<br />
| LacI repressed GFP generator with BBa_K201007<br />
| BBa_PSB1A2<br />
| 986<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 2<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201001 BBa_K201001] <br />
| Generator<br />
| LacI repressed GFP generator with BBa_K201008<br />
| BBa_PSB1A2<br />
| 986<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 3<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201002 BBa_K201002] <br />
| Generator<br />
| LacI repressor constitutive supplier <br />
| BBa_PSB1A2<br />
| 1351<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 4<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201002 BBa_K201002] <br />
| Generator<br />
| LacI repressor constitutive supplier <br />
| BBa_PSB3K3<br />
| 1351<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 5<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201003 BBa_K201003] <br />
| Generator<br />
| GFP generator<br />
| BBa_PSB1A2<br />
| 918<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 6<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201003 BBa_K201003] <br />
| Generator<br />
| GFP generator<br />
| BBa_PSB3K3<br />
| 918<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 7<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201004 BBa_K201004] <br />
| Regulatory<br />
| Lac natural operator O2 with RFP<br />
| BBa_PSB1A2<br />
| 733<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 8<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201005 BBa_K201005] <br />
| Regulatory<br />
| Lac natural operator O1 with RFP.<br />
| BBa_PSB1A2<br />
| 733<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 9<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201006 BBa_K201006] <br />
| Regulatory<br />
| Lac natural operator Osym with RFP.<br />
| BBa_PSB1A2<br />
| 732<br />
| Yes<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 10<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201007 BBa_K201007] <br />
| Regulatory<br />
| LacI repressed promoter BBa_J23118<br />
| BBa_PSB1A2<br />
| 776<br />
| -<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 11<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201008 BBa_K201008] <br />
| Regulatory<br />
| LacI repressed promoter BBa_J23100<br />
| BBa_PSB1A2<br />
| 776<br />
| -<br />
|}<br />
<br />
<br><br />
<br />
=Improved Parts=<br />
We added new information about parts already present in the Registry. More details in the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K079031 wet-lab section]. <br />
{|<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|width=15| '''N°'''<br />
|width=85| '''NAME'''<br />
|width=85| '''TYPE'''<br />
|width=980| '''DESCRIPTION'''<br />
|width=50| '''LENGTH (bp)'''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 1<br />
| [http://partsregistry.org/Part:BBa_K079031:Experience BBa_K079031] <br />
| Reporter<br />
| GFP reporter protein under the control of the BBa_J23118 promoter <br />
| 957<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 2<br />
| [http://partsregistry.org/Part:BBa_K079032:Experience BBa_K079032] <br />
| Reporter<br />
| GFP reporter protein under the control of the BBa_J23100 constitutive promoter <br />
| 957<br />
|}<br />
<br><br />
<br />
=Added Parts=<br />
These parts should have been use in T-REX device, but we didn't succed in cloning them on standard plasimids.<br />
{|<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|width=15| '''N°'''<br />
|width=85| '''NAME'''<br />
|width=85| '''TYPE'''<br />
|width=960| '''DESCRIPTION'''<br />
|width=80| '''LENGTH (bp)'''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 1<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201010 BBa_K201010] <br />
| DNA<br />
| Cis-Repressing sequence, to be used for T-REX device<br />
| 105<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 2<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201011 BBa_K201011] <br />
| DNA<br />
| Trans-Repressor (4) sequence, to be used for T-REX device<br />
| 103<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| 3<br />
| [http://partsregistry.org/wiki/index.php?title=Part:BBa_K201012 BBa_K201012] <br />
| DNA<br />
| Trans-Repressor (7) sequence, to be used for T-REX device<br />
| 100<br />
|}<br />
<br />
<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Parts ''Up'']</div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/Lab-NotebookTeam:Bologna/Lab-Notebook2009-10-21T21:16:41Z<p>Pierluigi.Stallone: /* Week 13: from 10/12/09 to 10/16/09 */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br />
= Week 1: from 07/20/09 to 07/24/09 =<br />
<br />
* "Work Preparations":<br />
# chemiocompetent cells from E. Coli DH5α, Top10 and DB 3.1<br />
# antibiotic stocks (Ampicillin and Kanamycin)<br />
# LB medium and plates<br />
# M9 medium<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
= Week 2: from 07/27/09 to 07/31/09 =<br />
<br />
In order to build up our circuits, we started looking for stardard plasmids. <br><br />
We needed one high and one medium copy number vector, with different antibiotic resistance (A & K).<br />
We searched the Registry and we chos two possible combinations: pSB1K3 with pSB4A3 or pSB1A2 with pSB3K3.<br />
*Transfomation of:<br />
# pSB1A2 -> ''with BBa_J23100 and BBa_J04031'' from our part library<br />
# pSB4A3 -> ''with BBa_J04500 and BBa_J04031'' from our part library<br />
using Top10 competent cells.<br />
*Inoculation, miniprep preparation and digestion, checked on agarose gel.<br />
*Eluition and Transfomation of:<br />
# pSB1K3 -> ''from 2009 kit, with BBa_J04450''<br />
# pSB3K3 -> ''from 2009 kit, with BBa_J04450''<br />
using Top10 competent cells.<br />
<br><br />
Since neither pSB1K3 nor pSB3K3 yielded colonies, we tried another transformation, choosing different kit wells.<br />
*Eluition and Transfomation of:<br />
# pSB1K3 -> ''from 2009 kit, with BBa_P1010''<br />
# pSB3K3 -> ''from 2009 kit, with BBa_P1010''<br />
# pSB3K3 -> ''from 2007 kit, with BBa_P1010''<br />
using DB3.1 competent cells.<br />
*Inoculation, miniprep preparation and digestion checked on agarose gel of pSB3K3 (2007 kit). <br />
(the only one that yielded colonies)<br />
<br><br />
We decided to use '''pSB1A2''' as high and '''pSB3K3''' as low to medium copy number as they revealed right MW bands when checked with agarose gel. In the meantime, we requested another pSB1K3 with BBa_P1010 from the Registry.<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
= Week 3: from 08/03/09 to 08/07/09 =<br />
<br />
*Cis-repressing (CIS) and Trans-repressor (TRANS_4 and TRANS_7)annealing<br />
*E-P Digestion of:<br />
# CIS<br />
# TRANS_4<br />
# TRANS_7<br />
# PSB1A2<br />
<br><br />
{| border="1"<br />
! DNA sequences !! Plasmid<br />
|-<br />
|H2O mQ == 4.5 μM <br />
|H2O mQ == 19.5 μM<br />
|-<br />
|Sequence == 20 μM<br />
|DNA (miniprep) == 5 μM <br />
|-<br />
|Buffer == 3 μM<br />
|Buffer == 3 μM<br />
|-<br />
|BSA == 0.5 μM<br />
|BSA == 0.5 μM<br />
|-<br />
|EcoRI enzyme == 1 μM<br />
|EcoRI enzyme == 1 μM<br />
|-<br />
|Pst1 enzyme == 1 μM<br />
|Pst1 enzyme == 1 μM<br />
|-<br />
|'''TOT:''' 30 μM<br />
|'''TOT:''' 30 μM<br />
|}<br />
<br><br />
[[Image:Notebook1.JPG|left|thumb|650px|CIS, TRANS_4, MARKER, TRANS_7]]<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
*Purification from agarose gel<br />
*Ligation of CIS, TRANS_4 and TRANS_7 on PSB1A2<br />
*Transformation on DH5α chemically competent cells (-> few colonies)<br />
*Inoculation and miniprep preparation<br />
*Control digestion checked on agarose gel revealed wrong MW bands<br />
<br><br />
*Ligation of:<br />
# 2547_RBS_GFP_T on pSB1A2 <br />
# 1429_RBS_GFP_T on pSB1A2 <br />
# 2547_RBS_GFP_T on pSB3K3<br />
# 1429_RBS_GFP_T on pSB3K3<br />
*Transformation on DH5α competent cells<br />
*Digestion checked on agarose gel<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 4: from 08/10/09 to 08/14/09=<br />
<br />
HOLIDAY!!!<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 5: from 08/17/09 to 08/21/09=<br />
<br />
In order to analyse the CIS/TRANS production ratio, we made some measures, using GFP as reporter.<br />
*Transformation of<br />
# 1429_RBS_GFP_T on pSB3K3<br />
# 2547_RBS_GFP_T on pSB1A2<br />
# 1429_RBS_GFP_T on pSB3K3 + 2547_RBS_GFP_T on pSB1A2<br />
<br />
We made another cloning attempt for CIS, TRANS_4 and TRANS_7<br />
*X-P Digestion of:<br />
# CIS<br />
# TRANS_4<br />
# TRANS_7<br />
# PSB1A2<br />
# PSB4A3<br />
*Purification from agarose gel<br />
*Ligation of CIS, TRANS_4 and TRANS_7 both on pSB1A2 and pSB4A3<br />
*Transformation in DH5α chemically competent cells (-> few colonies)<br />
*Inoculation and miniprep preparation<br />
*Control digestion checked on agarose gel revealed wrong MW bands<br />
<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 6: from 08/24/09 to 08/28/09=<br />
<br />
In order to confirm the promoter ratio we decided to study the different GFP production without degradation tag (E0040) on pSB3K3 under J23100 (2547) and J23118 (1429)<br />
*Ligation of<br />
# 2547_I13504 on pSB3K3 <br />
# 1429_I13504 on pSB3K3<br />
# 2547_I13504 on pSB1A2 <br />
# 1429_I13504 on pSB1A2<br />
*Transformation in DH5α competent cells<br />
*Control digestion checked on agarose gel<br />
Experimental measures failed because GFP levels were too high to detect significant differences. We decided to use GFP with degradation tag (J04031 instead of E0040) <br />
<br><br />
*New annealing of CIS, TRANS_4 and TRANS_7<br />
*Purification from agarose gel of the annealed parts<br />
*X-P Digestion of:<br />
# CIS<br />
# TRANS_4<br />
# TRANS_7<br />
# PSB1AK3<br />
*Purification from agarose gel<br />
*Ligation of CIS, TRANS_4 and TRANS_7 both on PSB1A2 and PSB4A3<br />
*Transformation on DH5α chemically competent cells<br />
*We checked colonies with colony PCR, obtaining wrong MW bands<br />
<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 7: from 08/31/09 to 09/04/09=<br />
<br />
*Ligation of<br />
# 1429_RBS_LacI_T on PSB1A2<br />
# 1429_RBS_LacI_T on PSB3K3<br />
*Transformation on DH5α chemically competent cells<br />
*Control digestion checked on agarose gel<br />
<br><br />
*New X-P digestion of CIS annealed and purified through agarose gel, increasing DNA quantity<br />
*Ligation both on PSB4A3 and PSB3K3<br />
*Transformation on DH5α competent cells<br />
*We checked colonies with colony PCR<br />
<br />
[[Image:notebook2.JPG|left|thumb|650px|PCR Colony: CIS on PSB4A3 in the first well, CIS on PSB3K3 in the others ]]<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
*Only one colony from the ligation on PSB4A3 revealed correct MW band (about 300bp), but the plasmid isolated from this colony revealed wrong MW after digestion checked on agarose gel<br />
<br><br />
*Same results were obtained for TRANS_4 and TRANS_7 parts: colony PCRs seemed right, but we found wrong MW bands after checking on agarose gel.<br />
<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 8: from 09/07/09 to 09/11/09=<br />
<br />
* We received primers and we made PCR of our 3 parts. (We used as primers standard prefix and suffix sequences). We made PCR both from annealed parts and from single strands, and we chose to extract the latter, because of the smears when checked on agarose gel.<br />
[[Image:notebook3.JPG|left|thumb|580px|PCR of CIS-repressing and TRANS-repressor with primers]]<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
* New digestion of CIS, TRANS_4 and TRANS_7 extracted from gel<br />
* Ligation on pSB1A2 yielded no colonies at all<br />
Since the restriction enzymes efficency is considerably reduced when there aren’t enough bases near their restriction sites, we started thinking that digestion could be our critical passage. We ordered longer primers, adding 7 bases to the end of each part. The added bases were the same for all standard vectors. <br />
<br />
In order to analyse the high/low copy number plasmid ratio we decided to study the production of GFP without degradation tag on both pSB1A2 and pSB3K3, using 1429 promoter to avoid GFP saturation.<br />
Transformation of:<br />
# 1429_I13504 on pSB3K3<br />
# 1429_I13504 on pSB1A2<br />
<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 9: from 09/14/09 to 09/18/09=<br />
<br />
We started to assemble LacI repressor's natural operators on standard plasmids.<br />
*Digestion of<br />
#K079017<br />
#K079018<br />
#K079019<br />
*Ligation with RFP (BBa_E1010)<br />
*Transformations in DH5α chemically competent cells<br />
*Digestion checked on agarose gel<br />
<br><br />
*We received longer primers for our sequences and made a new PCR in order to make them longer.<br />
*New cloning attempt failed again.<br />
<br><br />
*Transformation of pSB1K3 received from Registry in order to try ligation with BBa_P1010 ("Death" gene)<br />
<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 10: from 09/21/09 to 09/25/09=<br />
<br />
* New cloning attempts for CIS, TRANS_4 and TRANS_7. We reduced passage through gel using PCR extraction kit to purify PCR products and PSB1K3 with BBa_P1010<br />
<br />
*Digestion of<br />
#O2_RFP<br />
#O1_RFP<br />
#Oid_RFP<br />
and ligation on pSB1A2, in order to create standard BioBricks.<br />
*Transformation in DH5α competent cells<br />
*Digestion checked on agarose gel<br />
<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 11: from 09/28/09 to 10/02/09=<br />
*Digestion of O2_RFP and ligation on:<br />
#PSB1A2_1429<br />
#PSB1A2_2547<br />
*Transformation on DH5α chemically competent cells<br />
*Control digestion checked on agarose gel<br />
<br />
*Digestion of:<br />
#1429_O2_RFP on pSB1A2<br />
#2547_O2_RFP on pSB1A2<br />
and ligation with GFP (J04031)<br />
*Transformation on DH5α competent cells<br />
*Digestion checked on agarose gel<br />
<br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 12: from 10/05/09 to 10/09/09=<br />
Thinking that our cloning problem was still due to wrong digestion, we made another attempt:<br />
* X-S digestion of TRANS_4 (we choose only one of our parts, since it was only a try)<br />
* Ligation on pSB1K3 with BBa_P1010<br />
*Transformation on DH5α chemically competent cells<br />
*Colony PCR made with two different primers revealed correct MW bands.<br />
<br />
[[Image:picture3TS.jpg|left|thumb|580px|Colony PCR with standard Prefix and Suffix as primers: inserts were all at about 100bp as expected]]<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[[Image:picture4TS.jpg|left|thumb|580px|Colony PCR with standard VR and VF2 primers: inserts were all at about 300bp as expected (100bp is the length of our parts and 200bp are nucleotides due to primers’ binding on plasmid)]]<br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
=Week 13: from 10/12/09 to 10/16/09=<br />
<br><br />
* Experimental measurement<br />
* Shipment of our parts to the Registry<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Lab-Notebook ''Up'']<br />
<br />
More information about our CIS, TRANS_4 and TRANS_7 cloning attempt can be found in [https://2009.igem.org/Team:Bologna/T-REx_Story "Story of a T-REX"].<br />
<br><br />
<br><br />
More information on experimental measures can be found in the [https://2009.igem.org/Team:Bologna/Characterization Characterization] section.</div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T21:02:30Z<p>Pierluigi.Stallone: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<br />
<html><br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>The Genetic Circuits</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit</center>]]<br />
<br><br><br />
<br />
The circuit above represents the ON configuration of our T-REX device: TRANS-repressor is constitutively expressed and CIS-repressing is assembled upstream the LacI gene (BBa_C0012), while the reporter protein GFP (BBa_J04031) is assembled under the control of another promoter, regulated by LacI natural operator O2.<br />
<br><br />
CIS-repressing and TRANS-repressor mRNAs bind together, preventing LacI translation and allowing GFP production.<br />
<br><br />
Using some IPTG, the repression action of T-REX become easily, because the concentration of free LacI in the cells is reduced.<br />
<br><br><br />
To prove T-REX repression, GFP production level must be compared with the level produced by the OFF configuration of our T-REX device, that is the same circuit in absence of TRANS-repressor:<br />
<br><br><br />
[[Image:OffCircuit_tag.png|center|900px]]<br />
<br><br><br />
In this second case, LacI is regularly translated and, binding with its O2 natural operator, it blocks GFP production.<br />
<br><br />
We choose to use a low copy number plasmid and a weak promoter (J23118) for the CIS-repressing/LacI production, and a high copy number plasmid and a strong promoter (J23100) for the TRANS-repressing, to make reporter production's variations easily to be detected.<br />
<br><br />
<br><br />
<br><br />
<br><br />
Before realizing the whole T-REX device, we decided to perform some preliminary tests, in order to characterize every single BioBrick involved in it.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to characterize the difference between the high copy number pSB1A2 and the low to medium copy number pSB3K3 plasmids, we analyzed production of BBa_I13504 (wild type GFP) under BBa_J23118 promoter (1429): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to characterize the ratio between BBa_J23100 (strength 2547) and BBa_J23118 (strength 1429) promoters, we analyzed GFP (BBa_J04031) production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We evaluate this on pSB1A2, using BBa_J04031 under the control of both BBa_J23118 and BBa_J23100, in presence and in absence of BBa_K079019:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|[[Image:1429GFP_O2_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, analyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:openLACi_GFP_tag.png|center|750 px]]<br />
|}<br />
In the first circuit, we used different IPTG concentration in order to evaluate LacI repression strength. In the latter, we verified that LacI doesn't interfere with GFP production if its natural operator O2 is not present.<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Pierluigi.Stallonehttp://2009.igem.org/Team:BolognaTeam:Bologna2009-10-21T21:01:45Z<p>Pierluigi.Stallone: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br><br><br />
[[Image:Ely9Copia.jpg|center|850px]]<br />
<br><br />
<div style="text-align:justify"><br />
<br />
= Project Summary =<br />
<br />
<br><br />
<font face="Calibri" size="5"><br />
'''Our idea'''<br />
</font><br />
<br><br><br />
<br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>Ex</b>pression). <br />
</font></html><br />
<br />
<br><br />
<font face="Calibri" size="5"><br />
'''How T-REX works'''<br />
</font><br />
<br><br><br />
<br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
<html><br />
The device consists of two new BioBricks:<br />
<br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target coding sequence.<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. <br />
</ul></html><br />
<br><br />
CIS-repressing and TRANS-repressor sequences were designed by [[Team:Bologna/Software#1|BASER]] software.<br />
<br><br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
<br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
</font><br />
<br />
<br><br><br />
<font face="Calibri" size="5"><br />
'''How we can test the device'''<br />
</font><br />
<br><br><br><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig 2):</font><br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit</center>]]<br />
<font face="Calibri" font size="4" color="#000000"><br />
<br><br><br><br />
More details about our work are reported in the [[Team:Bologna/Project|Project]] section.<br />
<br><br />
<br><br />
<br><br />
</font><br />
<br />
= Acknowledgements =<br />
<br><br />
<font size="3"><br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:LogoUnibo.jpg|left|100 px]]<br />
<br />
<br><br><br><br><br><br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|left|500px]]<br />
<br />
<br><br><br><br><br><br />
<br />
* '''Cultural Association San Sebastiano''' <br />
<br />
[[Image:SSebastiano.jpg|left|200px]]<br />
<br />
<br><br><br><br><br><br><br><br><br />
----<br />
<br />
<br />
<html><br />
<center><br />
<a href="http://www2.clustrmaps.com/counter/maps.php?url=https://2009.igem.org/Team:Bologna" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=https://2009.igem.org/Team:Bologna" style="border:0px;" alt="Locations of visitors to this page" title="Locations of visitors to this page" id="clustrMapsImg" onerror="this.onerror=null; this.src='http://clustrmaps.com/images/clustrmaps-back-soon.jpg'; document.getElementById('clustrMapsLink').href='http://clustrmaps.com';" /><br />
</a><br />
<br />
</center><br />
</html><br />
<br />
<br />
[https://2009.igem.org/Team:Bologna ''Up'']<br />
</font></div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T21:00:11Z<p>Pierluigi.Stallone: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>EX</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, left panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, right panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<br />
<html><br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>The Genetic Circuits</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit</center>]]<br />
<br><br><br />
<br />
The circuit above represents the ON configuration of our T-REX device: TRANS-repressor is constitutively expressed and CIS-repressing is assembled upstream the LacI gene (BBa_C0012), while the reporter protein GFP (BBa_J04031) is assembled under the control of another promoter, regulated by LacI natural operator O2.<br />
<br><br />
CIS-repressing and TRANS-repressor mRNAs bind together, preventing LacI translation and allowing GFP production.<br />
<br><br />
Using some IPTG, the repression action of T-REX become easily, because the concentration of free LacI in the cells is reduced.<br />
<br><br><br />
To prove T-REX repression, GFP production level must be compared with the level produced by the OFF configuration of our T-REX device, that is the same circuit in absence of TRANS-repressor:<br />
<br><br><br />
[[Image:OffCircuit_tag.png|center|900px]]<br />
<br><br><br />
In this second case, LacI is regularly translated and, binding with its O2 natural operator, it blocks GFP production.<br />
<br><br />
We choose to use a low copy number plasmid and a weak promoter (J23118) for the CIS-repressing/LacI production, and a high copy number plasmid and a strong promoter (J23100) for the TRANS-repressing, to make reporter production's variations easily to be detected.<br />
<br><br />
<br><br />
<br><br />
<br><br />
Before realizing the whole T-REX device, we decided to perform some preliminary tests, in order to characterize every single BioBrick involved in it.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to characterize the difference between the high copy number pSB1A2 and the low to medium copy number pSB3K3 plasmids, we analyzed production of BBa_I13504 (wild type GFP) under BBa_J23118 promoter (1429): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to characterize the ratio between BBa_J23100 (strength 2547) and BBa_J23118 (strength 1429) promoters, we analyzed GFP (BBa_J04031) production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We evaluate this on pSB1A2, using BBa_J04031 under the control of both BBa_J23118 and BBa_J23100, in presence and in absence of BBa_K079019:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|[[Image:1429GFP_O2_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, analyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:openLACi_GFP_tag.png|center|750 px]]<br />
|}<br />
In the first circuit, we used different IPTG concentration in order to evaluate LacI repression strength. In the latter, we verified that LacI doesn't interfere with GFP production if its natural operator O2 is not present.<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/ProjectTeam:Bologna/Project2009-10-21T20:57:12Z<p>Pierluigi.Stallone: </p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br />
<html><br />
<center><br />
<font face="Calibri" font size="8" color="#000000"><b>T-REX Project<br><br></b></font> <br />
<font face="Calibri" font size="5" color="#000000">(<b>T</b>rans-<b>R</b>epressor of <b>Ex</b>pression)</font></center><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a standard device to control the synthesis of any protein of interest. This "general-purpose" device, implemented in <i>E. coli</i>, acts at the translational level to allow silencing of protein expression faster than using regulated promoters. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>EX</b>pression). <br>T-REX consists of two new BioBricks: <br />
<br><br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target protein coding sequence. It contains a ribosomal binding site <font color="#228b22"><b>(RBS)</b></font>;<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. For a better repressive effectiveness, the TRANS sequence contains also a <font color="#228b22"><b>RBS cover</b></font>, released in two versions of different length (either 4 or 7 nucleotides). <br>The longer version covers also 3 nucleotides of the Shine-Dalgarno sequence.<br />
</ul><br />
<br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, right panel</i>). When the promoter controlling the TRANS coding sequence is active, it drives the transcription of an oligoribonucleotide complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>silencing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, left panel</i>)<br />
</html><br />
<br><br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
<br><br><br />
<br />
<html><br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
To identify CIS-repressing and TRANS-repressor complementary parts, we developed <a href="https://2009.igem.org/Team:Bologna/Software">BASER</a> software. We used it to seek for two complementary 50bp non-coding sequences, whose transcribed RNAs:<br><br />
a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); <br><br />
b) have minimal unwanted interactions with genomic mRNA; <br><br />
c) present a minimal probability of partial/shifted hybridization with complementary strands. <br><br><br />
Here below are the CIS-repressing and TRANS-repressor sequences:<br />
<br />
<br><br><br />
</html><br />
<br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>CIS-repressing</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''non-coding TRANS target'''''<br />
|width=170| <font size="2">'''''RBS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#000080">AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC<br />
| <font size="2" color="#FF6600">AAAGAGGAGAAA<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (4)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br />
{| align="center"<br />
|- style="background: #1560BD; color:white; text-align: center;"<br />
|colspan=4| <font size="+1"><b>TRANS-repressor (7)</b></font><br />
|- style="background: #99BADD; text-align: center;"<br />
|width=100| <font size="2">'''''Prefix'''''<br />
|width=180| <font size="2">'''''RBS cover'''''<br />
|width=170| <font size="2">'''''non-coding TRANS'''''<br />
|width=110| <font size="2">'''''Suffix'''''<br />
|- style="background:#99BADD; color:black; text-align: center"<br />
| <font size="2" color="#228b22">GAATTCGCGGCCGCTTCTAGAG<br />
| <font size="2" color="#FF6600">CCTCTTT<br />
| <font size="2" color="#000080">GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT<br />
| <font size="2" color="#228b22">TACTAGTAGCGGCCGCTGCAG<br />
|}<br />
<br><br><br />
More details about BASER and its functioning can be found in the <html><a href="https://2009.igem.org/Team:Bologna/Software">software section</a>.</html><br />
<br><br><br><br><br />
<br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>The Genetic Circuits</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig 2):<br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit</center>]]<br />
<br><br><br />
<br />
The circuit above represents the ON configuration of our T-REX device: TRANS-repressor is constitutively expressed and CIS-repressing is assembled upstream the LacI gene (BBa_C0012), while the reporter protein GFP (BBa_J04031) is assembled under the control of another promoter, regulated by LacI natural operator O2.<br />
<br><br />
CIS-repressing and TRANS-repressor mRNAs bind together, preventing LacI translation and allowing GFP production.<br />
<br><br />
Using some IPTG, the repression action of T-REX become easily, because the concentration of free LacI in the cells is reduced.<br />
<br><br><br />
To prove T-REX repression, GFP production level must be compared with the level produced by the OFF configuration of our T-REX device, that is the same circuit in absence of TRANS-repressor:<br />
<br><br><br />
[[Image:OffCircuit_tag.png|center|900px]]<br />
<br><br><br />
In this second case, LacI is regularly translated and, binding with its O2 natural operator, it blocks GFP production.<br />
<br><br />
We choose to use a low copy number plasmid and a weak promoter (J23118) for the CIS-repressing/LacI production, and a high copy number plasmid and a strong promoter (J23100) for the TRANS-repressing, to make reporter production's variations easily to be detected.<br />
<br><br />
<br><br />
<br><br />
<br><br />
Before realizing the whole T-REX device, we decided to perform some preliminary tests, in order to characterize every single BioBrick involved in it.<br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>pSB1A2</i> vs <i>pSB3K3</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to characterize the difference between the high copy number pSB1A2 and the low to medium copy number pSB3K3 plasmids, we analyzed production of BBa_I13504 (wild type GFP) under BBa_J23118 promoter (1429): <br />
<br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Plasmid_copy_number_characterization wet-lab section]</b> </center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>BBa_J23100</i> vs <i>BBa_J23118</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* In order to characterize the ratio between BBa_J23100 (strength 2547) and BBa_J23118 (strength 1429) promoters, we analyzed GFP (BBa_J04031) production on pSB1A2:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#Promoter_characterization wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b><i>Presence</i> vs <i>Absence</i> of LacI natural operator O2</b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We needed to confirm that LacI natural operator O2 don't influence GFP production when LacI repressor is not present. We evaluate this on pSB1A2, using BBa_J04031 under the control of both BBa_J23118 and BBa_J23100, in presence and in absence of BBa_K079019:<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP_open_tag.png|center|450 px]]<br />
|[[Image:2547GFPO2_open_tag.png|center|450 px]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc_tag.png|center|450 px]]<br />
|[[Image:1429GFP_O2_tag.png|center|450 px]]<br />
|}<br />
<center><br />
<b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization#GFP_production_in_absence_/_presence_of_operator_Ox wet-lab section]</b></center><br />
<br><br />
<br><br />
<html><br />
<font face="Calibri" font size="5" color="#000000"><b>Interaction of <i>LacI repressor</i> with its <i>natural operator O2</i></b><br />
<br><br><br />
<font face="Calibri" font size="4" color="#000000"><br />
</html><br />
* We studied interactions between LacI repressor and its natural operator O2, analyzing this two genetic circuits:<br />
{|align="center"<br />
|[[Image:LACi_GFP2_tag.png|center|750 px]]<br />
|}<br />
<br><br><br />
{|align="center"<br />
|[[Image:openLACi_GFP_tag.png|center|750 px]]<br />
|}<br />
In the first circuit, we used different IPTG concentration in order to evaluate LacI repression strength. In the latter, we verified that LacI doesn't interfere with GFP production if its natural operator O2 is not present.<br />
<br><br><br />
<center><b>Results can be found in the [https://2009.igem.org/Team:Bologna/Characterization wet-lab section]</b></center><br />
<br><br />
</font></div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/SoftwareTeam:Bologna/Software2009-10-21T20:49:56Z<p>Pierluigi.Stallone: /* 1 */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<br />
<html><center> <br />
<font face="Dom Casual" font size="3" color="#000000"><i><b>"Part of the inhumanity of the computer is that, once it is competently programmed and working smoothly, it is completely honest."</b><br />
</i></font> <br />
<br><br> <br />
<font face="Times New Roman" font size="4"><i> I. Asimov </i></font> <br />
</center></html><br />
<br><br />
----<br />
<font size="4"><b>The Softwares</b></font><br><br />
* [[Image:BASER_ICON.png|30px|]] <font size="4">[[Media:BASER_0.4.zip|Download]] BASER</font><br><br />
<font size="2">Note: <b>Matlab required;</b> after decompacting file read ReadMe.txt</font><br><br />
<font size="3">More details about BASER [https://2009.igem.org/Team:Bologna/Software#1 here]</font><br><br><br><br />
* [[Image:microscopio.gif|40px|]] <font size="4">[[Media:VIFluoR.zip|Download]] VIFluoR</font><br />
<font size="2">Note: <b>Matlab required;</b> after decompacting file read ReadMe.txt</font><br><br />
<font size="3">More details about VIFluoR [https://2009.igem.org/Team:Bologna/Software#2 here]</font><br />
<br><br />
----<br />
=1=<br />
<br><br />
<font size="5"><center><br />
<b>B<font color=#00FF00>A</font>S<font color=#00FF00>E</font>R<br>Best Sequence Research by <font color=#00FF00>A</font>ndrea and <font color=#00FF00>E</font>lisa</b><br />
</center><br />
<br><br />
<font size="4"><b>Aims</b></font><br />
<br><br />
<font size="3"><br />
<div style="text-align:justify"><br />
BASER is a computer program developed to design synthetic DNA sequences whose transcribed RNAs: a) feature maximal free energy in the secondary structure (i.e. reducing the probability of its intra-molecular annealing); b) have minimal unwanted interactions with genomic mRNA; c) present a minimal probability of partial/shifted hybridization with complementary strands. These specifications are required for the proper engineering of the TRANS and CIS complementary sequences, whose functions are described in the T-REX device.<br />
<br><br><br />
<br />
<font size="4"><b>Method</b></font><br />
<br><br />
The BASER algorithm builds a 50 nucleotide-long sequence (start sequence), assembled by linking 10 blocks of 5 nucleotides each, randomly extracted from a basket file (BF), stored in a basket directory. The BF file can be either uniform (containing all the possible combinations of 2, 3 or 4 distinct nucleotides in the 5 available places) or non-uniform (containing each block a number of times that is inversely proportional to the appearance of that same block in the genomic DNA of <i>E. coli</i>).<br />
<br><br><br />
After having generated a 50b-long sequence, BASER performs the Conformity test to check that the sequence does not contain: a) more than 5 adjacent repeats of the same nucleotide (to avoid transcription errors); b) restriction sites; c) RBS sequences. If one among these conditions occurs, a new sequence is generated until the Conformity test is passed. Thereafter the RBS sequence, chosen by the user, is linked downstream of its 3’ end to obtain what is called the “current” sequence. BASER thus calculates a score for the “current” sequence, derived from a combination of: <br />
<br><br />
a) the self score: proportional to the minimum free energy of the corresponding RNA secondary structure <font color=#FF0000>[1,2]</font>; b) the genomic score: the number of times that the sequence appears in the coding DNA with at least '''m''' adjacent nucleotides out of a total of '''n''' corresponding nucleotides; c) the shifted score: proportional to the best suboptimal pairing of the “current” sequence and its Watson and Crick complementary strand.<br />
<br><br />
After score computation, five adjacent nucleotides in the “current” sequence are substituted with a randomly-picked block from the BF, originating a new sequence. The score of this new sequence is calculated and, if lower than the previous one, the new sequence will be considered as the “current” one in the next iteration (otherwise the previous one is maintained as the “current”). The algorithm tries to modify the “current” sequence until the number of total iterations N (N chosen by the user) has been reached. However, if the same sequence persists for more than K iterations (K<N, K chosen by the user) without any improvement of its best score, this sequence is considered as candidate. This same sequence, in its opposite 5’ to 3’ orientation will be the start sequence for a subsequent research by BASER. Candidate sequences are usually reached in less than 500 iterations (Fig. 1). All of them are reported at the end of the elaboration.<br />
<br />
[[Image:Fig1.png|center|800px|thumb|<font size="2">Figure 1. Sequence Score vs Number of Iterations. In this example, when a sequence is found to have the same score for more than 150 iterations, it is considered a candidate sequence. Then, to restart the searching procedure, it is read in the opposite 5’ to 3’ orientation.</font>]]<br />
<br />
<br><br />
<font size="4"><b>CIS and TRANS sequences</b></font><br />
<br><br />
<br />
The CIS-repressing (RNA secondary structure in Fig. 2) sequence chosen by BASER to be assembled upstream of the target protein-coding sequence in T-REX resulted:<br />
<br><br><br />
<center><b>AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC</b><font color=#00ff00><i><u>AAAG</u>AGG</i></font><i>AGAAA</i><br><br />
(RBS in <i>italic</i>)</center><br><br />
<br />
[[Image:Immagine2.png|center|800px|thumb|<font size="2">Figure 2.</font>]]<br />
<br><br />
Its complementary TRANS-repressor sequence, with a RBS cover in two versions of different length, was:<br><br><br />
either<br><br><br />
<center><br />
<font color=#00ff00>CCTCTTT</font><b>GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT</b><br><br />
with a 7b-long RBS cover in <font color=#00ff00>green</font> (RNA secondary structure in Fig. 3a)<br />
</center><br />
or<br />
<center><br />
<font color=#00ff00><u>CTTT</u></font><b>GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT</b><br><br />
with a 4b-long RBS cover in <font color=#00ff00><u>green underlined</u></font> (RNA secondary structure in Fig. 3b)<br />
<br><br />
{|align="center"<br />
|[[Image:figura3a.png|center|450 px|thumb|Figure 3a]]<br />
|[[Image:figura3b.png|center|450 px|thumb|Figure 3b]]<br />
|}<br />
<br><br><br></center><br />
<font color=#FF0000>1.</font> Wuchty, S., Fontana, W., Hofacker, I., and Schuster, P. (1999). Complete suboptimal<br />
folding of RNA and the stability of secondary structures. Biopolymers 49, 145–165<br><br />
<font color=#FF0000>2.</font> Matthews, D., Sabina, J., Zuker, M., and Turner, D. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911–940.<br />
<br><br><br />
[https://2009.igem.org/Team:Bologna/Software ''Up'']<br />
----<br />
<br><br />
<br />
=2=<br />
<br><br><br />
<font size="5"><br />
<center><br />
<b>VIFluoR <br><br> (Very Inexpensive Fluorescence Reader) </b><br />
</center><br />
<br><br />
<font size="3"><br />
In Synthetic Biology, the quantification of protein synthesis using fluorescent reporters is an established practice. Fluorescence intensity can be assessed by two different methods: i) the measure of total fluorescence produced by populations of cells; ii) the acquisition of images by an optical microscope to obtain information on single-cell fluorescence. We have developed a Matlab code (VIFluoR) to estimate, by imaging analysis, the fluorescence emitted by a single bacterium. To validate the program, we compared the fluorescence determined using micro-images with the fluorescence measured in the same bacterial culture using a fluorimeter.<br />
<br />
<br><br />
<font size="4"><b>Images Selection</b></font><br />
<br><br />
<br />
Single cell fluorescence in a bacterial population exhibits large variability, also depending on the cell cycle phase. To obtain a significant representation of bacterium fluorescence, it is necessary to acquire several images, each one reporting a sufficient number of bacterial cells (Figure 1). Our program can process more images at once. In addition, the images to be processed are selected when the program is running (Figure 2).<br />
<br />
[[Image:partenza.jpg|center|thumb|900px|<font size="2">Figure 1 - Image of <i>E. coli</i> (Magnification 400x)</font>]]<br />
<br><br />
[[Image:pick.jpg|center|500px|]]<br />
<br />
<br><br><br />
<font size="4"><b>Bacterial cell recognition</b></font><br />
<br><br />
VIFluoR firstly operates the image segmentation and then recognises the bacterial cells (Figure 3) evaluating two properties of segmented objects: the morphology, assuming an elliptical shape for the bacterium, and the focus. The user can select the bacterium morphology by setting the eccentricity (from 0 to 1), and the values for minimum and maximum area (in pixel). The program aids the user to set these parameters by showing the eccentricity and the area histograms of the candidate bacteria (Figure 4).<br />
<br><br><br />
[[Image:seg.jpg|center|thumb|900px|<font size="2">Figure 3. Image segmentation. All the candidate bacteria are marked with red boxes.</font>]]<br />
<br><br />
{|align="center"<br />
|[[Image:eccbact.png|center|thumb|450 px|<font size="2">Figure 4a. Bacterial eccentricity distribuction.</font>]]<br />
|[[Image:area.jpg|center|450 px|thumb|<font size="2">Figure 4b. Bacterial area distribuction.</font>]]<br />
|}<br />
<br><br />
Focus clustering is an automated routine that divides the candidate bacteria in clusters and selects only the individuals featuring high fluorescence and high cell numbers. The program marks with a yellow box the bacteria chosen after the morphology and focus tests and with a red box the others (Figure 5).<br />
<br><br><br />
<br />
[[Image:cluster.jpg|center|1000 px|thumb|<font size="2">Figure 5. Bacterium recognition: bacteria passing the morphology and focus tests are marked with a yellow box.</font>]]<br />
<br />
<br><br><br />
<font size="4"><b>Program output</b></font><br />
<br><br />
The program seeks the pixel fluorescence associated to each bacterium and then shows the fluorescence histogram per pixels (Figure 6.a) <br />
<br><br />
{|align="center"<br />
|[[Image:pixels.jpg|center|thumb|420 px|<font size="2">Figure 6a. Fluorescence histograms per pixel.</font>]]<br />
|[[Image:meand.jpg|center|470 px|thumb|<font size="2">Figure 6b. Fluorescence histograms per bacterium.</font>]]<br />
|}<br />
<br />
For each recognized bacterium the program computes: the bacterium area in pixel and the bacterium fluorescence (mean over the bacterium pixel number). Data are stored on the 4 vectors (Px<i><b>zzz</b></i> , F<i><b>zzz</b></i>, A<i><b>zzz</b></i> and Results<i><b>zzz</b></i> where <i><b>zzz</b></i> is the name given to the dataset when the program starts). The vector Results<i><b>zzz</b></i> contains the most important data of the analysis to help the consultation. If you have excel it's possible to save, as image.xls, a worksheet with all the data. Vectors Px<i><b>zzz</b></i> , F<i><b>zzz</b></i>, A<i><b>zzz</b></i> are used to plot the mean fluorescence histogram, boxplot of bacteria fluorescence (Figure 7) and the area vs the fluorescence graph (Figure 8).<br />
<br><br />
{|align="center"<br />
|[[Image:boxpl.jpg|center|thumb|440 px|center|<font size="2">Figure 7. Boxplot of bacteria fluorescence.</font>]]<br />
|[[Image:areavsfluo.jpg|center|470 px|center|thumb|<font size="2">Figure 8. Area vs Fluorescence.</font>]]<br />
|}<br />
<br><br />
[https://2009.igem.org/Team:Bologna/Software ''Up'']</div>Pierluigi.Stallonehttp://2009.igem.org/Team:BolognaTeam:Bologna2009-10-21T20:43:59Z<p>Pierluigi.Stallone: /* Project Summary */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br><br><br><br />
[[Image:Ely9Copia.jpg|center|850px]]<br />
<br><br />
<div style="text-align:justify"><br />
<br />
= Project Summary =<br />
<br />
<br><br />
<font face="Calibri" size="5"><br />
'''Our idea'''<br />
</font><br />
<br><br><br />
<br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
The aim of our project is the design of a new device to control the synthesis of any protein of interest. This "general-purpose" standard device, implemented in <i>E. coli</i>, acts at the translational level to allow a switch in protein expression faster than transcriptional promoter regulation. We named this device <b>T-REX</b> (<b>T</b>rans <b>R</b>epressor of <b>EX</b>pression). <br />
</font></html><br />
<br />
<br><br />
<font face="Calibri" size="5"><br />
'''How T-REX works'''<br />
</font><br />
<br><br><br />
<br />
<br />
<font face="Calibri" font size="4" color="#000000"><br />
<html><br />
The device consists of two new BioBricks:<br />
<br><br />
<ul><br />
<li><font color="#000080"><b>CIS-repressing</b></font>, to be assembled upstream of the target coding sequence.<br />
</ul><br />
<ul><br />
<li><font color="#000080"><b>TRANS-repressor</b></font>, complementary to the CIS-repressing and placed under the control of a different promoter. <br />
</ul></html><br />
<br><br />
CIS-repressing and TRANS-repressor sequences were designed by [[Team:Bologna/Software#1|BASER]] software.<br />
<br><br><br />
Transcription of the target gene yields a mRNA strand - containing the CIS-repressing sequence at its 5' end - available for translation into protein by ribosomes (<i>see Fig. 1, right panel</i>). Induction of the promoter controlling the TRANS coding sequence, releases a transcript complementary to the CIS mRNA sequence. The TRANS/CIS <b>RNA duplex</b> prevents ribosomes from binding to RBS on target mRNA, thus <b>repressing protein synthesis</b>. The amount of the TRANS-repressor regulates the rate of translation of the target mRNA (<i>see Fig. 1, left panel</i>)<br />
<br><br><br />
[[Image:project3b.png|center|950px|thumb|<center>Figure 1 - T-REX device</center>]]<br />
</font><br />
<br />
<br><br><br />
<font face="Calibri" size="5"><br />
'''How we can test the device'''<br />
</font><br />
<br><br><br><br />
<html><br />
<font face="Calibri" font size="4" color="#000000"><br />
In order to test and characterize our T-REX device, we developed the following genetic circuit (Fig 2):</font><br />
</html><br />
<br><br><br />
[[Image:circuit2OK.jpg|center|900px|thumb|<center>Figure 2 - Genetic Circuit</center>]]<br />
<font face="Calibri" font size="4" color="#000000"><br />
<br><br><br><br />
More details about our work are reported in the [[Team:Bologna/Project|Project]] section.<br />
<br><br />
<br><br />
<br><br />
</font><br />
<br />
= Acknowledgements =<br />
<br><br />
<font size="3"><br />
* ''' [http://www.unibo.it/Portale/default.htm University of Bologna] '''<br />
<br />
<br><br />
<br />
[[Image:LogoUnibo.jpg|left|100 px]]<br />
<br />
<br><br><br><br><br><br><br><br />
<br />
* ''' [http://serinar.criad.unibo.it Ser.In.Ar. Cesena] ''' <br />
<br />
<br><br />
<br />
[[Image:Ser_In_Ar.jpg|left|500px]]<br />
<br />
<br><br><br><br><br><br />
<br />
* '''Cultural Association San Sebastiano''' <br />
<br />
[[Image:SSebastiano.jpg|left|200px]]<br />
<br />
<br><br><br><br><br><br><br><br><br />
----<br />
<br />
<br />
<html><br />
<center><br />
<a href="http://www2.clustrmaps.com/counter/maps.php?url=https://2009.igem.org/Team:Bologna" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=https://2009.igem.org/Team:Bologna" style="border:0px;" alt="Locations of visitors to this page" title="Locations of visitors to this page" id="clustrMapsImg" onerror="this.onerror=null; this.src='http://clustrmaps.com/images/clustrmaps-back-soon.jpg'; document.getElementById('clustrMapsLink').href='http://clustrmaps.com';" /><br />
</a><br />
<br />
</center><br />
</html><br />
<br />
<br />
[https://2009.igem.org/Team:Bologna ''Up'']<br />
</font></div>Pierluigi.Stallonehttp://2009.igem.org/Team:Bologna/CharacterizationTeam:Bologna/Characterization2009-10-19T09:48:32Z<p>Pierluigi.Stallone: /* Plasmid copy number characterization */</p>
<hr />
<div>{{Template:BolognaTemplate}}<br />
<br />
<font size="3"><br />
<br><br />
We decided to create and developed a biological circuit in which the TRANS-repressor, in absence of IPTG, can inhibit the synthesis of LacI repressor protein, warranting the production of GFP:<br />
<br><br><br />
[[Image:circuit2.jpg|center|900px|]]<br />
<br><br />
To do that we initially need to characterize some sub-circuits in order to obtain some information and values concerning the processes we were analyzing. <br />
<br><br><br />
You can find here all our [[Team:Bologna/WetlabProtocols|Wetlab Protocols]]<br />
</font><br />
<br><br />
= Plasmid copy number characterization =<br />
<font size="3"><br />
To test the ratio between the production of an high copy number plasmid (PSB1A2) and a low copy number one (PSB3K3), we assembled two circuits. The open loop GFP circuits are realized with a 1429 promotor and the standard biobrick I13504. From the Registry of Standard Biological Parts we knew that pSB1A2 is an high copy number plasmid while pSB3K3 is a low copy one, so the ideal ratio between their copy number is at least 10, but the best value that we reached with the spectrofluorimeter is about 3,3.<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_lc.png|center|450 px]]<br />
|}<br />
<br />
PSB1A2 with high copy number plasmid and a low copy number were transformed in DH5alfa bacterial cells according to the standard protocol. <br />
<br><br />
One colony from each plate was picked up and let grow overnight in M9 medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 8000 rpm for a minute; another milliliter was used for measuring the optical density and estimate the growth of the sample. The supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition. <br />
<br><br />
Finally, images were elaborated with the fluorescence visualization software and these are the results:<br />
<br><br><br />
{|align="center"<br />
|[[Image:1429i13504psb1a2y100cgn170esp1,4_v1.png|center|thumbnail|385 px|High copy number plasmid (PSB1A2)]]<br />
|[[Image:1429i13504psb3k3y100cgn170esp1,4_v1.png|center|thumbnail|385 px|Low copy number plasmid (PSB3K3)]]<br />
|}<br />
<br><br><br />
</font><br />
<br />
= Promoter characterization =<br />
<br />
<font size="3"><br />
In order to estimate the difference in strength of the two promoters J23100 (2547) and J23118 (1429), we realized two circuits. Both were composed by an open loop GFP mounted on an high copy number plasmid (PSB1A2), the only different element was the promoter. <br />
<br />
<br><br />
{|align="center"<br />
|[[Image:2547GFP open.png|center|450 px]]<br />
|[[Image:1429GFP_openloop_hc.png|center|450 px]]<br />
|}<br />
To do this we transformed those constructs in bacterial cells; we picked up a colony from each plate and we inoculated it in M9 medium. After growing all night at 37°C we took a milliliter of each sample and we measured their optical density; than we prepared slides for the fluorescence bacteria images acquisition, following the same steps of the previous test. <br />
The images, acquired during some repetitions of the test, was elaborated with the fluorescence visualization software (VIFluoR) giving out those results:<br />
{|align="center"<br />
|[[Image:2500gfpy100cgn170esp0,25pomev6.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23100 (2547)]]<br />
|[[Image:1429gfpy100cgn170esp0,5.png|center|thumbnail|385 px|Open loop GFP circuit with promoter J23118 (1429)]]<br />
|}<br />
<br><br />
From the registry of standard parts we learnt that the strengths of J23100 and J23118 are respectively 2547 and 1429, so the ratio between them is about 1.78. Experimentally we have achieved the value of 1.2; for this reason we can say that this prove has gone well.<br />
<br><br><br />
</font><br />
<br />
= GFP production in absence/presence of operator Ox =<br />
<br />
<font size="3"><br />
With this trial we aimed to demonstrate that, in absence of LAC I protein, the operator Ox doesn't affect the bacterial production of GFP. <br />
<br><br />
To do that we realized four circuits: the first was composed by the GFP protein under the control of the J23100 promoter mounted on the pSB1A2 plasmid; the second circuit differed from the first because it contained also the operator Ox. Similarly the third and the fourth circuits differed only for the presence or the absence of the operator, but they mounted the J23118 promoter instead of the J23100.<br />
<br><br><br />
{|align="center"<br />
|[[Image:2547GFP open.png|center|450 px]]<br />
|[[Image:2547GFPOx_open.png|center|450 px]]<br />
|}<br />
Following the steps of the previous tests we obtained those results:<br />
<br></div>Pierluigi.Stallone