http://2009.igem.org/wiki/index.php?title=Special:Contributions/Roh329&feed=atom&limit=50&target=Roh329&year=&month=
2009.igem.org - User contributions [en]
2024-03-29T02:35:45Z
From 2009.igem.org
MediaWiki 1.16.5
http://2009.igem.org/File:Zinc_part.png
File:Zinc part.png
2009-10-21T08:41:12Z
<p>Roh329: uploaded a new version of "Image:Zinc part.png"</p>
<hr />
<div></div>
Roh329
http://2009.igem.org/File:Zinc_part.png
File:Zinc part.png
2009-10-21T08:32:04Z
<p>Roh329: uploaded a new version of "Image:Zinc part.png"</p>
<hr />
<div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Team
Team:KU Seoul/Team
2009-10-21T08:27:25Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
<br />
{|style= "background:#FFCC33;"<br />
|<br />
== '''Who we are''' ==<br />
<gallery><br />
<br />
Image:KN.png|Kina<br />
Image:HS.png|Hanseung<br />
Image:YJ.png|Yeonjin<br />
Image:YS.png|Young<br />
Image:CW.png|Cheolwon<br />
Image:CW1.png|Cheolwoo<br />
Image:SM.png|Simin<br />
Image:YJ1.png|Yoonji<br />
Image:JH.png|Jihye<br />
Image:JH1.png|Jihui<br />
Image:Hj1.png|Hyukjin<br />
Image:KU Seoul Igchoi.jpg|Professor Choi<br />
</gallery><br />
<br />
<br />
<br />
<br />
'''Legend'''<br />
<br />
'''1. Grade & Major'''<br />
<br />
'''2. Motto'''<br />
<br />
'''3. Message to IGEM teams'''<br />
<br />
<br />
'''Advisors:'''<br />
<br />
*''' Ingeol Choi''': Our Professor<br />
<br />
*''' Grad Student ''': <br />
<br />
*''' Hyukjin Ko ''':<br />
1. Doctor Course<br />
2. Don't regret.<br />
3. Best Wishes to all.<br />
<br />
'''Undergrads:'''<br />
<br />
*''' Hanseung Roh ''': <br />
1. Master Course<br />
2. Where there is a will, there is a way. <br />
3. Hello~<br />
<br />
*''' Cheolwon Choi ''': <br />
1. Senior, Genetic Engineering<br />
2. Let's be a striving genius.<br />
3. Participation is what's important, not the results.<br />
<br />
*''' Jihye Shin ''':<br />
1. Senior, Biotechnology<br />
2. Let's be someone worth investment.<br />
3. Nice to meet you all! I am excited from my toes just thinking <br />
about the Jamboree. Lets us make memories of a lifetime.<br />
<br />
*''' Yeonjin Kong ''': <br />
1. Senior, Environmental science & Ecological engineering <br />
2. A person who can govern oneself can govern one's family, <br />
and a person who can govern one's family can govern the nation, <br />
and a person who can govern one's nation can govern the world peacefully.<br />
3. KU_Seoul Fighting!!!<br />
<br />
*''' Young Byun ''': <br />
1. Senior, Biology<br />
2. Practice makes perfect.<br />
3. Here comes KU_Seoul!!!<br />
<br />
*''' Cheolwoo Lee ''': <br />
1. Junior, Environmental science & Ecological engineering<br />
2. Impossible is nothing.<br />
3. I would like to make possibility. <br />
Good luck to everybody who visit a this web page!<br />
<br />
*''' JiHui Jang ''':<br />
1. Junior, Biothechnology<br />
2. Carpe diem!<br />
3. We're coming!!!<br />
<br />
*''' Kina Jeon ''': <br />
1. Junior, Biotechnology<br />
2. Never lose a smile.<br />
3. Thank you for visiting our team wiki! <br />
Can't wait to see all your mind-boggling ideas at iGEM 2009 :) <br />
<br />
*''' Yoonji Kim ''':<br />
1. Junior, Bioengineering<br />
2. A life with prayers.<br />
3. Let's do our best!!!<br />
<br />
*''' Simin Kim ''':<br />
1. Sophomore, Environmental science & Ecological engineering<br />
2. Carpe diem!<br />
3. I want to do evenrything good enough to touch myself.<br />
Experience an unforgettable Time in igem 2009! <br />
Good luck to all participators :)<br />
<br />
== '''What we did''' ==<br />
'''Circuit Design and Modeling''' : Hyukjin Ko<br />
<br />
'''Wiki Design''' : Hansung Roh, Young Byun<br />
<br />
'''Poster Design''' : Cheolwon Choi, Simin Kim<br />
<br />
'''Team T shirt Design''' : Cheolwoo Lee and his friend<br />
<br />
'''Fund Raising''' : Cheolwon Choi, Young Byun, Jihye Shin, Jihui Jang<br />
<br />
'''Experiments, Research''' : All members<br />
<br />
'''Support''' : Professor Ingeol Choi <br />
<br />
'''Special Thanks''' :<br />
<br />
== '''Where we're from''' ==<br />
<br />
Korea University is located at Anamdong, Seoul, South Korea. Seoul is the capital of South Korea <br />
and is divdided largely into South and North, with the the Han river flowing through the middle. <br />
Anamdong is placed northwest to the Han river. Korea University, with 15 Colleges, 1 Graduate <br />
School, 3 Professional Graduate Schools and 10 Specialized Graduate Schools, was established on <br />
May 5, 1905. <br />
<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---><br />
|}</div>
Roh329
http://2009.igem.org/File:KU_Seoul_Igchoi.jpg
File:KU Seoul Igchoi.jpg
2009-10-21T08:26:45Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/mainframe
Team:KU Seoul/mainframe
2009-10-21T08:25:28Z
<p>Roh329: </p>
<hr />
<div><html><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/main.css&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/dd.css&action=raw&ctype=text/css" /><br />
<!--[if IE]><br />
<style type="text/css"><br />
#utilNav ul li {list-style-image: none;}<br />
#suppNav ul li {list-style-image: none;}<br />
#mainNav ul li {list-style-image: none;}<br />
</style><br />
<![endif]--><br />
<script type="text/javascript" src="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/java.js&action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
function ddnav() {<br />
$('#ddNav li').hover(<br />
function () {<br />
$(this).find('div:first').css('display','block');},<br />
function () {<br />
$(this).find('div:first').css('display','none');}<br />
);<br />
}<br />
function ddnavsub() {<br />
$('#ddNav span > a').toggle(<br />
function () {<br />
$(this).removeClass("expand").addClass("collapse");<br />
$(this).parent().find('div:first').slideDown('fast');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#e5e5e0')},<br />
function (){$(this).css('background-color','#e5e5e0')});},<br />
function () {<br />
$(this).removeClass("collapse").addClass("expand");<br />
$(this).parent().find('div:first').css('display','none');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#F5F5F0')},<br />
function (){$(this).css('background-color','#FFFFFF')});}<br />
).addClass('expand');<br />
}<br />
<br />
function ddmozilla() {<br />
ddtoggle();<br />
}<br />
<br />
$(function () {<br />
ddnav();<br />
ddnavsub();<br />
<br />
if($.browser.mozilla) {ddmozilla();}<br />
});<br />
</script><br />
<center><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2009/9/99/Category.png" width="965" height="235"><br />
<br />
<!-- logo --><br />
<div id="logo"><br />
</div><br />
<!-- END logo --><br />
<br />
<!-- main navigation --><br />
<div id="mainNav"><br />
<ul id="ddNav"><br />
<br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul">Home</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Team">Team</a><br />
</li><br />
<li><br />
<a>Project</a><br />
<div><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Overview">Overview</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Materials">Materials</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Experiment Dairy">Experiment Diary</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Result">Result</a><br />
</div><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Parts">Parts</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Notebook">Notebook</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Safety">Safety</a><br />
</li><br />
</ul><br />
<br />
</div><br />
<br />
<!-- END main navigation --><br />
<br />
</div><br />
</center><br />
</html><br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
{{:Team:KU_Seoul/Rightbar}}<br />
<html><br />
<style type="text/css"><br />
body {background-color:#f8f8f8;}<br />
</style><br />
</html></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Parts
Team:KU Seoul/Parts
2009-10-21T08:24:48Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
<br />
{|style= "background:#FFCC33;" align="justify"<br />
|<br />
<br />
=== Part ===<br />
Mercury sensor - Mercury inducing promoter : Part:{{Part|BBa_I728456}} + amd gene<br />
<br />
{{Part|BBa_K271000}}<br />
<br />
{{Part|BBa_K271001}}<br />
<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul
Team:KU Seoul
2009-10-21T08:23:39Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
----<br />
[[image:KU.png| After Dinner]]<br />
<br />
{|style= "background:#FFCC33;" align="center" <br />
|<b>Hello~ World!!! This is our first time applying for the iGEM and we are EXCITED!!! <br />
We are a [[Team:KU Seoul/Team|team]] of 10 undergraduate students from Korea University, South Korea. <br />
The current project we are working on is ''metal detecting bacteria'', through which we are trying to sense <br />
harmful metal ions inside water and see if it is suitable for drinking. We mainly discuss our ideas through <br />
[http://groups.google.com/group/synbiogroup?hl=ko|g Google] in Korean and then post the results on wiki.<br />
|</b><br />
|}<br />
<html><br />
<a href="http://www.easycounter.com/"><br />
<img src="http://www.easycounter.com/counter.php?bys131"<br />
border="0" alt="Website Hit Counters"></a><br />
</html><br />
<br />
<br />
<!--- The Mission, Experiments ---></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/mainframe
Team:KU Seoul/mainframe
2009-10-21T08:23:04Z
<p>Roh329: </p>
<hr />
<div><html><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/main.css&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/dd.css&action=raw&ctype=text/css" /><br />
<!--[if IE]><br />
<style type="text/css"><br />
#utilNav ul li {list-style-image: none;}<br />
#suppNav ul li {list-style-image: none;}<br />
#mainNav ul li {list-style-image: none;}<br />
</style><br />
<![endif]--><br />
<script type="text/javascript" src="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/java.js&action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
function ddnav() {<br />
$('#ddNav li').hover(<br />
function () {<br />
$(this).find('div:first').css('display','block');},<br />
function () {<br />
$(this).find('div:first').css('display','none');}<br />
);<br />
}<br />
function ddnavsub() {<br />
$('#ddNav span > a').toggle(<br />
function () {<br />
$(this).removeClass("expand").addClass("collapse");<br />
$(this).parent().find('div:first').slideDown('fast');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#e5e5e0')},<br />
function (){$(this).css('background-color','#e5e5e0')});},<br />
function () {<br />
$(this).removeClass("collapse").addClass("expand");<br />
$(this).parent().find('div:first').css('display','none');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#F5F5F0')},<br />
function (){$(this).css('background-color','#FFFFFF')});}<br />
).addClass('expand');<br />
}<br />
<br />
function ddmozilla() {<br />
ddtoggle();<br />
}<br />
<br />
$(function () {<br />
ddnav();<br />
ddnavsub();<br />
<br />
if($.browser.mozilla) {ddmozilla();}<br />
});<br />
</script><br />
<center><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2009/9/99/Category.png" width="965" height="235"><br />
<br />
<!-- logo --><br />
<div id="logo"><br />
</div><br />
<!-- END logo --><br />
<br />
<!-- main navigation --><br />
<div id="mainNav"><br />
<ul id="ddNav"><br />
<br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul">Home</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Team">Team</a><br />
</li><br />
<li><br />
<a>Project</a><br />
<div><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Overview">Overview</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Materials">Materials</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Experiment Dairy">Experiment Diary</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Result">Result</a><br />
</div><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Parts">Parts</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Notebook">Notebook</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Sponsors">Sponsors</a><br />
</li><br />
</ul><br />
<br />
</div><br />
<br />
<!-- END main navigation --><br />
<br />
</div><br />
</center><br />
</html><br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
{{:Team:KU_Seoul/Rightbar}}<br />
<html><br />
<style type="text/css"><br />
body {background-color:#f8f8f8;}<br />
</style><br />
</html></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/mainframe
Team:KU Seoul/mainframe
2009-10-21T08:22:49Z
<p>Roh329: </p>
<hr />
<div><html><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/main.css&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/dd.css&action=raw&ctype=text/css" /><br />
<!--[if IE]><br />
<style type="text/css"><br />
#utilNav ul li {list-style-image: none;}<br />
#suppNav ul li {list-style-image: none;}<br />
#mainNav ul li {list-style-image: none;}<br />
</style><br />
<![endif]--><br />
<script type="text/javascript" src="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/java.js&action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
function ddnav() {<br />
$('#ddNav li').hover(<br />
function () {<br />
$(this).find('div:first').css('display','block');},<br />
function () {<br />
$(this).find('div:first').css('display','none');}<br />
);<br />
}<br />
function ddnavsub() {<br />
$('#ddNav span > a').toggle(<br />
function () {<br />
$(this).removeClass("expand").addClass("collapse");<br />
$(this).parent().find('div:first').slideDown('fast');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#e5e5e0')},<br />
function (){$(this).css('background-color','#e5e5e0')});},<br />
function () {<br />
$(this).removeClass("collapse").addClass("expand");<br />
$(this).parent().find('div:first').css('display','none');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#F5F5F0')},<br />
function (){$(this).css('background-color','#FFFFFF')});}<br />
).addClass('expand');<br />
}<br />
<br />
function ddmozilla() {<br />
ddtoggle();<br />
}<br />
<br />
$(function () {<br />
ddnav();<br />
ddnavsub();<br />
<br />
if($.browser.mozilla) {ddmozilla();}<br />
});<br />
</script><br />
<center><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2009/9/99/Category.png" width="965" height="235"><br />
<br />
<!-- logo --><br />
<div id="logo"><br />
</div><br />
<!-- END logo --><br />
<br />
<!-- main navigation --><br />
<div id="mainNav"><br />
<ul id="ddNav"><br />
<br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul">Home</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Team">Team</a><br />
</li><br />
<li><br />
<a>Project</a><br />
<div><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Overview">Overview</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Materials">Materials</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Experiment Dairy">Experiment Dairy</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Result">Result</a><br />
</div><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Parts">Parts</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Notebook">Notebook</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Sponsors">Sponsors</a><br />
</li><br />
</ul><br />
<br />
</div><br />
<br />
<!-- END main navigation --><br />
<br />
</div><br />
</center><br />
</html><br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
{{:Team:KU_Seoul/Rightbar}}<br />
<html><br />
<style type="text/css"><br />
body {background-color:#f8f8f8;}<br />
</style><br />
</html></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T12:39:19Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=5>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.korea.ac.kr/"><img src="https://static.igem.org/mediawiki/2009/d/d5/KU_Seoul_Logo1.png"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.gist.ac.kr/"><img src="https://static.igem.org/mediawiki/2009/2/27/KU_Seoul_Gist.png"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Logo1.png
File:KU Seoul Logo1.png
2009-10-20T12:38:52Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T12:21:09Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=5>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.korea.ac.kr/"><img src="http://compbio.korea.ac.kr/wiki/images/f/f8/Logo_KOREAUNIV1.png"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.gist.ac.kr/"><img src="https://static.igem.org/mediawiki/2009/2/27/KU_Seoul_Gist.png"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T12:20:54Z
<p>Roh329: </p>
<hr />
<div><div id="sidebar"><br />
<br />
<center><strong><font size=5>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.korea.ac.kr/"><img src="http://compbio.korea.ac.kr/wiki/images/f/f8/Logo_KOREAUNIV1.png"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.gist.ac.kr/"><img src="https://static.igem.org/mediawiki/2009/2/27/KU_Seoul_Gist.png"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T12:20:13Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=5>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.korea.ac.kr/"><img src="http://compbio.korea.ac.kr/wiki/images/f/f8/Logo_KOREAUNIV1.png"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.gist.ac.kr/"><img src="https://static.igem.org/mediawiki/2009/2/27/KU_Seoul_Gist.png"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T12:19:55Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=3>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.korea.ac.kr/"><img src="http://compbio.korea.ac.kr/wiki/images/f/f8/Logo_KOREAUNIV1.png"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.gist.ac.kr/"><img src="https://static.igem.org/mediawiki/2009/2/27/KU_Seoul_Gist.png"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Gist.png
File:KU Seoul Gist.png
2009-10-20T12:19:08Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Parts
Team:KU Seoul/Parts
2009-10-20T12:12:39Z
<p>Roh329: /* Part 2 */</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
<br />
{|style= "background:#FFCC33;" align="justify"<br />
|<br />
<br />
===Note===<br />
<br />
=== Part 2 ===<br />
Mercury sensor - Mercury inducing promoter : Part:{{Part|BBa_I728456}} + amd gene<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Experiment_Dairy
Team:KU Seoul/Experiment Dairy
2009-10-20T12:11:43Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of ''E. coli'' XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of ''E. coli'' DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of ''E. coli'' XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of ''E. coli'' DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of ''E. coli'' XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
::General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
::Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
:2. Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
::Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [PCR products of each part diluted 10-fold]] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
:2. Result (Figure 3)<br />
[[Image:KU_Seoul_3.jpg]]<br />
*090923<br />
:1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly<br />
::1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul<br />
::2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul<br />
::3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Reaction mixture<br />
! volume (μl)<br />
|-<br />
|Purified PCR product ||align="center"| 43<br />
|-<br />
|BSA (NEB) (10mg/ml) ||align="center"| 1<br />
|-<br />
|10x NEB buffer 2 ||align="center"| 5<br />
|-<br />
|T4 DNA polymerase (0.6U/μl) || align="center"| 1<br />
|}<br />
::4) Clean-up – eleution : 40ul<br />
::5) 0.8% agarose gel electrophoresis<br />
<br />
*090923~090924<br />
#Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5<br />
##Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min<br />
##Transformation to ''E. coli'' DH5a<br />
##Results >> vector only : 2, vector + INS : 4<br />
*090925-27, 090929~091001<br />
:1. Cloning results<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Plate<br />
! Number of colonies<br />
! Plasmid prep.<br />
|-<br />
|pSB3C5 vector || align="center"|2 ||align="center"| 1<br />
|-<br />
|pSB3C5 + Pars-gfp-Pznt-rfp || align="center"|5 ||align="center"| 1/3<br />
|-<br />
|pSB3T5 vector || align="center"|3 ||align="center"| 1<br />
|-<br />
|pSB3T5 + PyodA-AMD || align="center"|14 ||align="center"| 5/6<br />
|}<br />
:2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)<br />
[[Image:KU_Seoul_4.jpg]]<br />
*091005~091006<br />
#Sequencing by Macrogen<br />
#Transformation to ''E. coli'' DH5a<br />
*091010~091020<br />
#Procedure for detecting Zn<Sup>2+</Sup> and AsO<Sup>3-</Sup> & Construction of calibration curve for red fluorescence<br />
##''E. coli'' DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Zn<Sup>2+</Sup> (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO<Sup>3-</Sup> (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth<br />
##Incubation for 60min at 37℃<br />
##Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)<br />
#Procedure for detecting Cd<Sup>2+</Sup> & Construction of calibration curve<br />
##''E. coli'' DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Cd<Sup>2+</Sup> (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃<br />
##Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min<br />
##Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃<br />
##Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO<Sub>4</Sub> in 1.6 % (vol/vol) NH<Sub>4</Sub>OH. After 10 min of incubation at room temperature<br />
##The amount of p-aminophenol was determined by a spectrophotometer (615 nm)<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Experiment_Dairy
Team:KU Seoul/Experiment Dairy
2009-10-20T12:10:45Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of ''E. coli'' XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of ''E. coli'' DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of ''E. coli'' XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of ''E. coli'' DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of ''E. coli'' XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
::General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
::Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
:2. Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
::Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [PCR products of each part diluted 10-fold]] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
:2. Result (Figure 3)<br />
[[Image:KU_Seoul_3.jpg]]<br />
*090923<br />
:1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly<br />
::1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul<br />
::2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul<br />
::3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Reaction mixture<br />
! volume (μl)<br />
|-<br />
|Purified PCR product ||align="center"| 43<br />
|-<br />
|BSA (NEB) (10mg/ml) ||align="center"| 1<br />
|-<br />
|10x NEB buffer 2 ||align="center"| 5<br />
|-<br />
|T4 DNA polymerase (0.6U/μl) || align="center"| 1<br />
|}<br />
::4) Clean-up – eleution : 40ul<br />
::5) 0.8% agarose gel electrophoresis<br />
<br />
*090923~090924<br />
#Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5<br />
##Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min<br />
##Transformation to ''E. coli'' DH5a<br />
##Results >> vector only : 2, vector + INS : 4<br />
*090925-27, 090929~091001<br />
:1. Cloning results<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Plate<br />
! Number of colonies<br />
! Plasmid prep.<br />
|-<br />
|pSB3C5 vector || align="center"|2 ||align="center"| 1<br />
|-<br />
|pSB3C5 + Pars-gfp-Pznt-rfp || align="center"|5 ||align="center"| 1/3<br />
|-<br />
|pSB3T5 vector || align="center"|3 ||align="center"| 1<br />
|-<br />
|pSB3T5 + PyodA-AMD || align="center"|14 ||align="center"| 5/6<br />
|}<br />
:2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)<br />
[[Image:KU_Seoul_4.jpg]]<br />
*091005~091006<br />
#Sequencing by Macrogen<br />
#Transformation to ''E. coli'' DH5a<br />
*091010~091020<br />
#Procedure for detecting Zn<Sup>2+</Sup> and AsO<Sup>3-</Sup> & Construction of calibration curve for red fluorescence<br />
##''E. coli'' DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Zn<Sup>2+</Sup> (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO<Sup>3-</Sup> (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth<br />
##Incubation for 60min at 37℃<br />
##Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)<br />
#Procedure for detecting Cd<Sup>2+</Sup> & Construction of calibration curve<br />
##''E. coli'' DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Cd<Sup>2+</Sup> (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃<br />
##Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min<br />
##Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃<br />
##Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO4 in 1.6 % (vol/vol) NH<Sub>4</Sub>OH. After 10 min of incubation at room temperature<br />
##The amount of p-aminophenol was determined by a spectrophotometer (615 nm)<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Experiment_Dairy
Team:KU Seoul/Experiment Dairy
2009-10-20T12:06:27Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of ''E. coli'' XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
::General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
::Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
:2. Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
::Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [PCR products of each part diluted 10-fold]] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
:2. Result (Figure 3)<br />
[[Image:KU_Seoul_3.jpg]]<br />
*090923<br />
:1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly<br />
::1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul<br />
::2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul<br />
::3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Reaction mixture<br />
! volume (μl)<br />
|-<br />
|Purified PCR product ||align="center"| 43<br />
|-<br />
|BSA (NEB) (10mg/ml) ||align="center"| 1<br />
|-<br />
|10x NEB buffer 2 ||align="center"| 5<br />
|-<br />
|T4 DNA polymerase (0.6U/μl) || align="center"| 1<br />
|}<br />
::4) Clean-up – eleution : 40ul<br />
::5) 0.8% agarose gel electrophoresis<br />
<br />
*090923~090924<br />
#Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5<br />
##Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min<br />
##Transformation to E. coli DH5a<br />
##Results >> vector only : 2, vector + INS : 4<br />
*090925-27, 090929~091001<br />
:1. Cloning results<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Plate<br />
! Number of colonies<br />
! Plasmid prep.<br />
|-<br />
|pSB3C5 vector || align="center"|2 ||align="center"| 1<br />
|-<br />
|pSB3C5 + Pars-gfp-Pznt-rfp || align="center"|5 ||align="center"| 1/3<br />
|-<br />
|pSB3T5 vector || align="center"|3 ||align="center"| 1<br />
|-<br />
|pSB3T5 + PyodA-AMD || align="center"|14 ||align="center"| 5/6<br />
|}<br />
:2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)<br />
[[Image:KU_Seoul_4.jpg]]<br />
*091005~091006<br />
#Sequencing by Macrogen<br />
#Transformation to E. coli DH5a<br />
*091010~091020<br />
#Procedure for detecting Zn2+ and AsO3- & Construction of calibration curve for red fluorescence<br />
##E. coli DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Zn2+ (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO3- (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth<br />
##Incubation for 60min at 37℃<br />
##Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)<br />
#Procedure for detecting Cd2+ & Construction of calibration curve<br />
##E. coli DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Cd2+ (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃<br />
##Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min<br />
##Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃<br />
##Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO4 in 1.6 % (vol/vol) NH4OH. After 10 min of incubation at room temperature<br />
##The amount of p-aminophenol was determined by a spectrophotometer (615 nm)<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul
Team:KU Seoul
2009-10-20T12:04:21Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
----<br />
{|style= "background:#FFCC33;" align="center" <br />
|<b>Hello~ World!!! This is our first time applying for the iGEM and we are EXCITED!!! We are a [[Team:KU Seoul/Team|team]] of 10 undergraduate students from Korea University, South Korea. The current project we are working on is ''metal detecting bacteria'', through which we are trying to sense harmful metal ions inside water and see if it is suitable for drinking. We mainly discuss our ideas through [http://groups.google.com/group/synbiogroup?hl=ko|g Google] in Korean and then post the results on wiki.<br />
|</b><br />
|}<br />
<html><br />
<a href="http://www.easycounter.com/"><br />
<img src="http://www.easycounter.com/counter.php?bys131"<br />
border="0" alt="Website Hit Counters"></a><br />
</html><br />
<br />
<br />
<!--- The Mission, Experiments ---></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/mainframe
Team:KU Seoul/mainframe
2009-10-20T12:03:35Z
<p>Roh329: </p>
<hr />
<div><html><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/main.css&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/dd.css&action=raw&ctype=text/css" /><br />
<!--[if IE]><br />
<style type="text/css"><br />
#utilNav ul li {list-style-image: none;}<br />
#suppNav ul li {list-style-image: none;}<br />
#mainNav ul li {list-style-image: none;}<br />
</style><br />
<![endif]--><br />
<script type="text/javascript" src="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/java.js&action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
function ddnav() {<br />
$('#ddNav li').hover(<br />
function () {<br />
$(this).find('div:first').css('display','block');},<br />
function () {<br />
$(this).find('div:first').css('display','none');}<br />
);<br />
}<br />
function ddnavsub() {<br />
$('#ddNav span > a').toggle(<br />
function () {<br />
$(this).removeClass("expand").addClass("collapse");<br />
$(this).parent().find('div:first').slideDown('fast');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#e5e5e0')},<br />
function (){$(this).css('background-color','#e5e5e0')});},<br />
function () {<br />
$(this).removeClass("collapse").addClass("expand");<br />
$(this).parent().find('div:first').css('display','none');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#F5F5F0')},<br />
function (){$(this).css('background-color','#FFFFFF')});}<br />
).addClass('expand');<br />
}<br />
<br />
function ddmozilla() {<br />
ddtoggle();<br />
}<br />
<br />
$(function () {<br />
ddnav();<br />
ddnavsub();<br />
<br />
if($.browser.mozilla) {ddmozilla();}<br />
});<br />
</script><br />
<center><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/c1/KU_Seoul_logo.jpg" width="965" height="235"><br />
<br />
<!-- logo --><br />
<div id="logo"><br />
</div><br />
<!-- END logo --><br />
<br />
<!-- main navigation --><br />
<div id="mainNav"><br />
<ul id="ddNav"><br />
<br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul">Home</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Team">Team</a><br />
</li><br />
<li><br />
<a>Project</a><br />
<div><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Overview">Overview</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Materials">Materials</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Experiment Dairy">Experiment Dairy</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Result">Result</a><br />
</div><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Parts">Parts</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Notebook">Notebook</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Sponsors">Sponsors</a><br />
</li><br />
</ul><br />
<br />
</div><br />
<br />
<!-- END main navigation --><br />
<br />
</div><br />
</center><br />
</html><br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
{{:Team:KU_Seoul/Rightbar}}<br />
<html><br />
<style type="text/css"><br />
body {background-color:#f8f8f8;}<br />
</style><br />
</html></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Overview
Team:KU Seoul/Overview
2009-10-20T12:03:15Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== Overview ==<br />
[[Image:circuit1.png|center]]<br />
[[Image:cons1.png|center]]<br />
[[Image:circuit2.png|center]]<br />
[[Image:cons2.png|center]]<br />
<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Experiment_Dairy
Team:KU Seoul/Experiment Dairy
2009-10-20T12:02:28Z
<p>Roh329: New page: {{:Team:KU_Seoul/mainframe}} <html> <head> <style> #bodyContent {background-color: #7C001A;} #content {background-color: #7C001A;} #footer-box {background-color: #CCCCCC;} P {color: #0000...</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
::General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
::Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
:2. Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
::Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [PCR products of each part diluted 10-fold]] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
:2. Result (Figure 3)<br />
[[Image:KU_Seoul_3.jpg]]<br />
*090923<br />
:1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly<br />
::1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul<br />
::2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul<br />
::3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Reaction mixture<br />
! volume (μl)<br />
|-<br />
|Purified PCR product ||align="center"| 43<br />
|-<br />
|BSA (NEB) (10mg/ml) ||align="center"| 1<br />
|-<br />
|10x NEB buffer 2 ||align="center"| 5<br />
|-<br />
|T4 DNA polymerase (0.6U/μl) || align="center"| 1<br />
|}<br />
::4) Clean-up – eleution : 40ul<br />
::5) 0.8% agarose gel electrophoresis<br />
<br />
*090923~090924<br />
#Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5<br />
##Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min<br />
##Transformation to E. coli DH5a<br />
##Results >> vector only : 2, vector + INS : 4<br />
*090925-27, 090929~091001<br />
:1. Cloning results<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Plate<br />
! Number of colonies<br />
! Plasmid prep.<br />
|-<br />
|pSB3C5 vector || align="center"|2 ||align="center"| 1<br />
|-<br />
|pSB3C5 + Pars-gfp-Pznt-rfp || align="center"|5 ||align="center"| 1/3<br />
|-<br />
|pSB3T5 vector || align="center"|3 ||align="center"| 1<br />
|-<br />
|pSB3T5 + PyodA-AMD || align="center"|14 ||align="center"| 5/6<br />
|}<br />
:2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)<br />
[[Image:KU_Seoul_4.jpg]]<br />
*091005~091006<br />
#Sequencing by Macrogen<br />
#Transformation to E. coli DH5a<br />
*091010~091020<br />
#Procedure for detecting Zn2+ and AsO3- & Construction of calibration curve for red fluorescence<br />
##E. coli DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Zn2+ (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO3- (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth<br />
##Incubation for 60min at 37℃<br />
##Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)<br />
#Procedure for detecting Cd2+ & Construction of calibration curve<br />
##E. coli DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Cd2+ (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃<br />
##Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min<br />
##Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃<br />
##Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO4 in 1.6 % (vol/vol) NH4OH. After 10 min of incubation at room temperature<br />
##The amount of p-aminophenol was determined by a spectrophotometer (615 nm)<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Materials
Team:KU Seoul/Materials
2009-10-20T12:01:49Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Materials
Team:KU Seoul/Materials
2009-10-20T12:01:36Z
<p>Roh329: New page: {:Team:KU_Seoul/mainframe}} <html> <head> <style> #bodyContent {background-color: #7C001A;} #content {background-color: #7C001A;} #footer-box {background-color: #CCCCCC;} P {color: #00003...</p>
<hr />
<div>{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/mainframe
Team:KU Seoul/mainframe
2009-10-20T12:00:47Z
<p>Roh329: </p>
<hr />
<div><html><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/main.css&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/dd.css&action=raw&ctype=text/css" /><br />
<!--[if IE]><br />
<style type="text/css"><br />
#utilNav ul li {list-style-image: none;}<br />
#suppNav ul li {list-style-image: none;}<br />
#mainNav ul li {list-style-image: none;}<br />
</style><br />
<![endif]--><br />
<script type="text/javascript" src="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/java.js&action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
function ddnav() {<br />
$('#ddNav li').hover(<br />
function () {<br />
$(this).find('div:first').css('display','block');},<br />
function () {<br />
$(this).find('div:first').css('display','none');}<br />
);<br />
}<br />
function ddnavsub() {<br />
$('#ddNav span > a').toggle(<br />
function () {<br />
$(this).removeClass("expand").addClass("collapse");<br />
$(this).parent().find('div:first').slideDown('fast');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#e5e5e0')},<br />
function (){$(this).css('background-color','#e5e5e0')});},<br />
function () {<br />
$(this).removeClass("collapse").addClass("expand");<br />
$(this).parent().find('div:first').css('display','none');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#F5F5F0')},<br />
function (){$(this).css('background-color','#FFFFFF')});}<br />
).addClass('expand');<br />
}<br />
<br />
function ddmozilla() {<br />
ddtoggle();<br />
}<br />
<br />
$(function () {<br />
ddnav();<br />
ddnavsub();<br />
<br />
if($.browser.mozilla) {ddmozilla();}<br />
});<br />
</script><br />
<center><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/c1/KU_Seoul_logo.jpg" width="965" height="235"><br />
<br />
<!-- logo --><br />
<div id="logo"><br />
</div><br />
<!-- END logo --><br />
<br />
<!-- main navigation --><br />
<div id="mainNav"><br />
<ul id="ddNav"><br />
<br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul">Home</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Team">Team</a><br />
</li><br />
<li><br />
<a>Project</a><br />
<div><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Overview">Overview</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Modeling">Modeling</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Materials">Materials</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Experiment Dairy">Experiment Dairy</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Details">Details</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Result">Result</a><br />
</div><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Parts">Parts</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Notebook">Notebook</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Sponsors">Sponsors</a><br />
</li><br />
</ul><br />
<br />
</div><br />
<br />
<!-- END main navigation --><br />
<br />
</div><br />
</center><br />
</html><br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
{{:Team:KU_Seoul/Rightbar}}<br />
<html><br />
<style type="text/css"><br />
body {background-color:#f8f8f8;}<br />
</style><br />
</html></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/mainframe
Team:KU Seoul/mainframe
2009-10-20T11:59:07Z
<p>Roh329: </p>
<hr />
<div><html><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/main.css&action=raw&ctype=text/css" /><br />
<link rel="stylesheet" type="text/css" href="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/dd.css&action=raw&ctype=text/css" /><br />
<!--[if IE]><br />
<style type="text/css"><br />
#utilNav ul li {list-style-image: none;}<br />
#suppNav ul li {list-style-image: none;}<br />
#mainNav ul li {list-style-image: none;}<br />
</style><br />
<![endif]--><br />
<script type="text/javascript" src="https://2009.igem.org/wiki/index.php?title=User:Home_World/wiki/java.js&action=raw&ctype=text/javascript"></script><br />
<script type="text/javascript"><br />
function ddnav() {<br />
$('#ddNav li').hover(<br />
function () {<br />
$(this).find('div:first').css('display','block');},<br />
function () {<br />
$(this).find('div:first').css('display','none');}<br />
);<br />
}<br />
function ddnavsub() {<br />
$('#ddNav span > a').toggle(<br />
function () {<br />
$(this).removeClass("expand").addClass("collapse");<br />
$(this).parent().find('div:first').slideDown('fast');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#e5e5e0')},<br />
function (){$(this).css('background-color','#e5e5e0')});},<br />
function () {<br />
$(this).removeClass("collapse").addClass("expand");<br />
$(this).parent().find('div:first').css('display','none');<br />
$(this).hover(<br />
function (){$(this).css('background-color','#F5F5F0')},<br />
function (){$(this).css('background-color','#FFFFFF')});}<br />
).addClass('expand');<br />
}<br />
<br />
function ddmozilla() {<br />
ddtoggle();<br />
}<br />
<br />
$(function () {<br />
ddnav();<br />
ddnavsub();<br />
<br />
if($.browser.mozilla) {ddmozilla();}<br />
});<br />
</script><br />
<center><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/c1/KU_Seoul_logo.jpg" width="965" height="235"><br />
<br />
<!-- logo --><br />
<div id="logo"><br />
</div><br />
<!-- END logo --><br />
<br />
<!-- main navigation --><br />
<div id="mainNav"><br />
<ul id="ddNav"><br />
<br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul">Home</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Team">Team</a><br />
</li><br />
<li><br />
<a>Project</a><br />
<div><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Overview">Overview</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Modeling">Modeling</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Details">Details</a><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Result">Result</a><br />
</div><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Parts">Parts</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Notebook">Notebook</a><br />
</li><br />
<li><br />
<a href="https://2009.igem.org/Team:KU_Seoul/Sponsors">Sponsors</a><br />
</li><br />
</ul><br />
<br />
</div><br />
<br />
<!-- END main navigation --><br />
<br />
</div><br />
</center><br />
</html><br />
<br />
<br><br />
<br><br />
<br><br />
<br><br />
<br />
<br />
{{:Team:KU_Seoul/Rightbar}}<br />
<html><br />
<style type="text/css"><br />
body {background-color:#f8f8f8;}<br />
</style><br />
</html></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T10:20:58Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=3>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://www.korea.ac.kr/"><img src="http://compbio.korea.ac.kr/wiki/images/f/f8/Logo_KOREAUNIV1.png"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Logo_KOREAUNIV.jpg
File:KU Seoul Logo KOREAUNIV.jpg
2009-10-20T10:15:24Z
<p>Roh329: uploaded a new version of "Image:KU Seoul Logo KOREAUNIV.jpg": Reverted to version as of 09:49, 20 October 2009</p>
<hr />
<div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Logo_KOREAUNIV.jpg
File:KU Seoul Logo KOREAUNIV.jpg
2009-10-20T09:52:10Z
<p>Roh329: uploaded a new version of "Image:KU Seoul Logo KOREAUNIV.jpg"</p>
<hr />
<div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Logo_KOREAUNIV.jpg
File:KU Seoul Logo KOREAUNIV.jpg
2009-10-20T09:49:25Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T09:47:16Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=3>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
</div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T09:46:31Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=3>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src=https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br><br />
<br />
</div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T09:46:09Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=3>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src=https://static.igem.org/mediawiki/2009/1/1d/Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Rightbar
Team:KU Seoul/Rightbar
2009-10-20T09:45:42Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU Seoul/RightBarCSS}}<br />
<br />
<div id="sidebar"><br />
<br />
<center><strong><font size=3>Sponsors</font></strong></center><br />
<br />
<br><br />
<br />
<center><html><a href = "http://compbio.korea.ac.kr/wiki/index.php/Main_Page"><img src="https://2009.igem.org/Image:Logo_CSBL.jpeg"></a></html></center><br />
<br />
<br />
</div></div>
Roh329
http://2009.igem.org/File:Logo_CSBL.jpeg
File:Logo CSBL.jpeg
2009-10-20T09:45:17Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Result
Team:KU Seoul/Result
2009-10-20T09:43:10Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
<br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
<br />
== Results ==<br />
:1. Synthetic Circuit - I : pSB3C5/Pars-gfp-Pznt-rfp<br />
::1)Pznt-rfp<br />
{| style="color:Black; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
|align="center"|Zn<Sup>2+</Sup> (mM) <br />
| align="center"| 0 <br />
| align="center"| 0.5 <br />
| align="center"| 0.75 <br />
| align="center"| 1 <br />
| align="center"| 1.5 <br />
| align="center"| 2<br />
|-<br />
|align="center"|OD<sub>600</sub><br />
| align="center"| 0.490 ± 0.003 <br />
| align="center"| 0.459 ± 0.004 <br />
| align="center"| 0.433 ± 0.008 <br />
| align="center"| 0.418 ± 0.005 <br />
| align="center"| 0.275 ± 0.011 <br />
| align="center"| 0.243 ± 0.008<br />
|-<br />
|align="center"|Red fluorescence (RF) <br />
| align="center"| 26628 ± 706 <br />
| align="center"| 27856 ± 292 <br />
| align="center"| 29333 ± 292 <br />
| align="center"| 31217 ± 66<br />
| align="center"| 46044 ± 237 <br />
| align="center"| 49188 ± 174<br />
|-<br />
|align="center"|OD<sub>600</sub>/RF <br />
| align="center"| 54376 ± 1203 <br />
| align="center"| 60646 ± 787 <br />
| align="center"| 67803 ± 573<br />
| align="center"| 74687 ± 755 <br />
| align="center"| 167833 ± 7202 <br />
| align="center"| 202565 ± 6428<br />
|-<br />
|align="center"|Background <br />
| align="center"| 0 <br />
| align="center"| 6270 ± 520 <br />
| align="center"| 13427 ± 1719 <br />
| align="center"| 20311 ± 475<br />
| align="center"| 113457 ± 6016 <br />
| align="center"| 148189 ± 6731<br />
|}<br />
[[Image:KU Seoul Result RFP.jpeg]]<br />
::2)Pars-gfp<br />
{| style="color:Black; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
|align="center"|AsO<Sup>3-</Sup> (mM)<br />
| align="center"| 0 <br />
| align="center"| 0.00625 <br />
| align="center"| 0.125<br />
| align="center"| 0.25 <br />
| align="center"| 0.5<br />
| align="center"| 0.75<br />
| align="center"| 1<br />
|-<br />
|align="center"|OD<sub>600</sub><br />
| align="center"| 0.553 ± 0.009<br />
| align="center"| 0.519 ± 0.002<br />
| align="center"| 0.480 ± 0.005<br />
| align="center"| 0.395 ± 0.007<br />
| align="center"| 0.315 ± 0.006<br />
| align="center"| 0.286 ± 0.004<br />
| align="center"| 0.273 ± 0.006<br />
|-<br />
|align="center"|Green fluorescence (GF)<br />
| align="center"| 27740 ± 226<br />
| align="center"| 26411 ± 169<br />
| align="center"| 25267 ± 267<br />
| align="center"| 25536 ± 213<br />
| align="center"| 25407 ± 259<br />
| align="center"| 24849 ± 152<br />
| align="center"| 26479 ± 149<br />
|-<br />
|align="center"|OD<sub>600</sub>/GF <br />
| align="center"| 50206 ± 1225<br />
| align="center"| 50855 ± 123<br />
| align="center"| 52606 ± 689<br />
| align="center"| 64669 ± 1684<br />
| align="center"| 80665 ± 603<br />
| align="center"| 86897 ± 1321<br />
| align="center"| 96784 ± 2165<br />
|-<br />
|align="center"|Background <br />
| align="center"| 0 <br />
| align="center"| 648 ± 1314<br />
| align="center"| 2399 ± 969<br />
| align="center"| 14463 ± 2896<br />
| align="center"| 30459 ± 1631<br />
| align="center"| 36691 ± 1636<br />
| align="center"| 46578 ± 3220<br />
|}<br />
[[Image:KU Seoul Result GFP.jpeg]]<br />
[[Image:KU Seoul Calibrationcurve.jpeg]]<br />
:2.Synthetic circuit – II : PyodA-AMD<br />
{| style="color:Black; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
|align="center"|Cd<Sup>2+</Sup> (mM)<br />
| align="center"| 0 <br />
| align="center"| 0.05 <br />
| align="center"| 0.1 <br />
| align="center"| 0.2<br />
| align="center"| 0.4 <br />
| align="center"| 0.8<br />
|-<br />
|align="center"|OD<sub>615</sub><br />
| align="center"| 0.242 ± 0.005<br />
| align="center"| 0.258 ± 0.008<br />
| align="center"| 0.274 ± 0.011<br />
| align="center"| 0.284 ± 0.01<br />
| align="center"| 0.293 ± 0.011 <br />
| align="center"| 0.302 ± 0.01<br />
|-<br />
|align="center"|Background<br />
| align="center"| 0<br />
| align="center"| 0.016 ± 0.004<br />
| align="center"| 0.032 ± 0.006<br />
| align="center"| 0.043 ± 0.005<br />
| align="center"| 0.052 ± 0.007<br />
| align="center"| 0.060 ± 0.007<br />
|}<br />
[[Image:KU Seoul Expression.jpeg]]<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Result
Team:KU Seoul/Result
2009-10-20T09:41:29Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
<br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
<br />
== Results ==<br />
:1. Synthetic Circuit - I : pSB3C5/Pars-gfp-Pznt-rfp<br />
::1)Pznt-rfp<br />
{| style="color:Black; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
|align="center"|Zn<Sup>2+</Sup> (mM) <br />
| align="center"| 0 <br />
| align="center"| 0.5 <br />
| align="center"| 0.75 <br />
| align="center"| 1 <br />
| align="center"| 1.5 <br />
| align="center"| 2<br />
|-<br />
|align="center"|OD<sub>600</sub><br />
| align="center"| 0.490 ± 0.003 <br />
| align="center"| 0.459 ± 0.004 <br />
| align="center"| 0.433 ± 0.008 <br />
| align="center"| 0.418 ± 0.005 <br />
| align="center"| 0.275 ± 0.011 <br />
| align="center"| 0.243 ± 0.008<br />
|-<br />
|align="center"|Red fluorescence (RF) <br />
| align="center"| 26628 ± 706 <br />
| align="center"| 27856 ± 292 <br />
| align="center"| 29333 ± 292 <br />
| align="center"| 31217 ± 66<br />
| align="center"| 46044 ± 237 <br />
| align="center"| 49188 ± 174<br />
|-<br />
|align="center"|OD<sub>600</sub>/RF <br />
| align="center"| 54376 ± 1203 <br />
| align="center"| 60646 ± 787 <br />
| align="center"| 67803 ± 573<br />
| align="center"| 74687 ± 755 <br />
| align="center"| 167833 ± 7202 <br />
| align="center"| 202565 ± 6428<br />
|-<br />
|align="center"|Background <br />
| align="center"| 0 <br />
| align="center"| 6270 ± 520 <br />
| align="center"| 13427 ± 1719 <br />
| align="center"| 20311 ± 475<br />
| align="center"| 113457 ± 6016 <br />
| align="center"| 148189 ± 6731<br />
|}<br />
[[Image:KU Seoul Result RFP.jpeg]]<br />
::2)Pars-gfp<br />
{| style="color:Black; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
|align="center"|AsO<Sup>3-</Sup> (mM)<br />
| align="center"| 0 <br />
| align="center"| 0.00625 <br />
| align="center"| 0.125<br />
| align="center"| 0.25 <br />
| align="center"| 0.5<br />
| align="center"| 0.75<br />
| align="center"| 1<br />
|-<br />
|align="center"|OD<sub>600</sub><br />
| align="center"| 0.553 ± 0.009<br />
| align="center"| 0.519 ± 0.002<br />
| align="center"| 0.480 ± 0.005<br />
| align="center"| 0.395 ± 0.007<br />
| align="center"| 0.315 ± 0.006<br />
| align="center"| 0.286 ± 0.004<br />
| align="center"| 0.273 ± 0.006<br />
|-<br />
|align="center"|Green fluorescence (GF)<br />
| align="center"| 27740 ± 226<br />
| align="center"| 26411 ± 169<br />
| align="center"| 25267 ± 267<br />
| align="center"| 25536 ± 213<br />
| align="center"| 25407 ± 259<br />
| align="center"| 24849 ± 152<br />
| align="center"| 26479 ± 149<br />
|-<br />
|align="center"|OD<sub>600</sub>/GF <br />
| align="center"| 50206 ± 1225<br />
| align="center"| 50855 ± 123<br />
| align="center"| 52606 ± 689<br />
| align="center"| 64669 ± 1684<br />
| align="center"| 80665 ± 603<br />
| align="center"| 86897 ± 1321<br />
| align="center"| 96784 ± 2165<br />
|-<br />
|align="center"|Background <br />
| align="center"| 0 <br />
| align="center"| 648 ± 1314<br />
| align="center"| 2399 ± 969<br />
| align="center"| 14463 ± 2896<br />
| align="center"| 30459 ± 1631<br />
| align="center"| 36691 ± 1636<br />
| align="center"| 46578 ± 3220<br />
|}<br />
[[Image:KU Seoul Result GFP.jpeg]]<br />
[[Image:KU Seoul Calibrationcurve.jpeg]]<br />
:2.Synthetic circuit – II : PyodA-AMD<br />
{| style="color:Black; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
|align="center"|Cd<Sup>2+</Sup> (mM)<br />
| align="center"| 0 <br />
| align="center"| 0.05 <br />
| align="center"| 0.1 <br />
| align="center"| 0.2<br />
| align="center"| 0.4 <br />
| align="center"| 0.8<br />
|-<br />
|align="center"|OD<sub>615</sub><br />
| align="center"| 0.242 ± 0.005<br />
| align="center"| 0.258 ± 0.008<br />
| align="center"| 0.274 ± 0.011<br />
| align="center"| 0.284 ± 0.01<br />
| align="center"| 0.293 ± 0.011 <br />
| align="center"| 0.302 ± 0.01<br />
|-<br />
|align="center"|Background<br />
| align="center"| 26628 ± 706 <br />
| align="center"| 27856 ± 292 <br />
| align="center"| 29333 ± 292 <br />
| align="center"| 31217 ± 66<br />
| align="center"| 46044 ± 237 <br />
| align="center"| 49188 ± 174<br />
|}<br />
|}</div>
Roh329
http://2009.igem.org/File:KU_Seoul_Result_RFP.jpeg
File:KU Seoul Result RFP.jpeg
2009-10-20T09:30:46Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Result_GFP.jpeg
File:KU Seoul Result GFP.jpeg
2009-10-20T09:30:27Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Expression.jpeg
File:KU Seoul Expression.jpeg
2009-10-20T09:30:02Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/File:KU_Seoul_Calibrationcurve.jpeg
File:KU Seoul Calibrationcurve.jpeg
2009-10-20T09:29:28Z
<p>Roh329: </p>
<hr />
<div></div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Result
Team:KU Seoul/Result
2009-10-20T08:10:47Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
<br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
:1. Synthetic Circuit - I : pSB3C5/Pars-gfp-Pznt-rfp<br />
== Results ==<br />
{| style="color:Black; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
|align="center"|Zn2+ (mM) || align="center"| 0 || align="center"| 0.5 || align="center"| 0.75 || align="center"| 1 || align="center"| 1.5 || align="center"| 2<br />
|-<br />
|align="center"|OD<sub>600</sub || align="center"| 0.490 ± 0.003 || align="center"| 0.459<br />
± 0.004 || align="center"| 0.433<br />
± 0.008 || align="center"| 0.418<br />
± 0.005 || align="center"| 0.275<br />
± 0.011 || align="center"| 0.243<br />
± 0.008<br />
|-<br />
|align="center"|Red fluorescence (RF) || align="center"| 26628<br />
± 706 || align="center"| 27856<br />
± 292 || align="center"| 29333<br />
± 292 || align="center"| 31217<br />
± 66 || align="center"| 46044<br />
± 237 || align="center"| 49188<br />
± 174<br />
|-<br />
|align="center"|OD<sub>600</sub/RF || align="center"| 54376<br />
± 1203 || align="center"| 60646<br />
± 787 || align="center"| 67803<br />
± 573 || align="center"| 74687<br />
± 755 || align="center"| 167833<br />
± 7202 || align="center"| 202565<br />
± 6428<br />
|-<br />
|align="center"|Background || align="center"| 6270<br />
± 520 || align="center"| 13427<br />
± 1719 || align="center"| 20311<br />
± 475 || align="center"| 113457<br />
± 6016 || align="center"| 1.5 || align="center"| 148189<br />
± 6731<br />
|}<br />
(''Or you can choose different headings. But you must have a team page, a project page, and a notebook page.'')<br />
Your abstract<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Details
Team:KU Seoul/Details
2009-10-20T07:59:01Z
<p>Roh329: </p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== The Experiments ==<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
::General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
::Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
:2. Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
::Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [PCR products of each part diluted 10-fold]] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
:2. Result (Figure 3)<br />
[[Image:KU_Seoul_3.jpg]]<br />
*090923<br />
:1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly<br />
::1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul<br />
::2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul<br />
::3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Reaction mixture<br />
! volume (μl)<br />
|-<br />
|Purified PCR product ||align="center"| 43<br />
|-<br />
|BSA (NEB) (10mg/ml) ||align="center"| 1<br />
|-<br />
|10x NEB buffer 2 ||align="center"| 5<br />
|-<br />
|T4 DNA polymerase (0.6U/μl) || align="center"| 1<br />
|}<br />
::4) Clean-up – eleution : 40ul<br />
::5) 0.8% agarose gel electrophoresis<br />
<br />
*090923~090924<br />
#Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5<br />
##Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min<br />
##Transformation to E. coli DH5a<br />
##Results >> vector only : 2, vector + INS : 4<br />
*090925-27, 090929~091001<br />
:1. Cloning results<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Plate<br />
! Number of colonies<br />
! Plasmid prep.<br />
|-<br />
|pSB3C5 vector || align="center"|2 ||align="center"| 1<br />
|-<br />
|pSB3C5 + Pars-gfp-Pznt-rfp || align="center"|5 ||align="center"| 1/3<br />
|-<br />
|pSB3T5 vector || align="center"|3 ||align="center"| 1<br />
|-<br />
|pSB3T5 + PyodA-AMD || align="center"|14 ||align="center"| 5/6<br />
|}<br />
:2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)<br />
[[Image:KU_Seoul_4.jpg]]<br />
*091005~091006<br />
#Sequencing by Macrogen<br />
#Transformation to E. coli DH5a<br />
*091010~091020<br />
#Procedure for detecting Zn2+ and AsO3- & Construction of calibration curve for red fluorescence<br />
##E. coli DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Zn2+ (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO3- (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth<br />
##Incubation for 60min at 37℃<br />
##Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)<br />
#Procedure for detecting Cd2+ & Construction of calibration curve<br />
##E. coli DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Cd2+ (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃<br />
##Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min<br />
##Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃<br />
##Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO4 in 1.6 % (vol/vol) NH4OH. After 10 min of incubation at room temperature<br />
##The amount of p-aminophenol was determined by a spectrophotometer (615 nm)<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Details
Team:KU Seoul/Details
2009-10-20T07:54:38Z
<p>Roh329: /* Experiment Dairy */</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== The Experiments ==<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
::General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
::Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
:2. Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
::Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [PCR products of each part diluted 10-fold]] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
:2. Result (Figure 3)<br />
[[Image:KU_Seoul_3.jpg]]<br />
*090923<br />
:1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly<br />
::1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul<br />
::2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul<br />
::3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Reaction mixture<br />
! volume (μl)<br />
|-<br />
|Purified PCR product ||align="center"| 43<br />
|-<br />
|BSA (NEB) (10mg/ml) ||align="center"| 1<br />
|-<br />
|10x NEB buffer 2 ||align="center"| 5<br />
|-<br />
|T4 DNA polymerase (0.6U/μl) || align="center"| 1<br />
|}<br />
::4) Clean-up – eleution : 40ul<br />
::5) 0.8% agarose gel electrophoresis<br />
<br />
*090923~090924<br />
#Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5<br />
##Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min<br />
##Transformation to E. coli DH5a<br />
##Results >> vector only : 2, vector + INS : 4<br />
*090925-27, 090929~091001<br />
:1. Cloning results<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Plate<br />
! Number of colonies<br />
! Plasmid prep.<br />
|-<br />
|pSB3C5 vector || align="center"|2 ||align="center"| 1<br />
|-<br />
|pSB3C5 + Pars-gfp-Pznt-rfp || align="center"|5 ||align="center"| 1/3<br />
|-<br />
|pSB3T5 vector || align="center"|3 ||align="center"| 1<br />
|-<br />
|pSB3T5 + PyodA-AMD || align="center"|14 ||align="center"| 5/6<br />
|}<br />
:2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)<br />
[[Image:KU_Seoul_4.jpg]]<br />
*091005~091006<br />
#Sequencing by Macrogen<br />
#Transformation to E. coli DH5a<br />
*091010~091020<br />
#Procedure for detecting Zn2+ and AsO3- & Construction of calibration curve for red fluorescence<br />
##E. coli DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Zn2+ (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO3- (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth<br />
##Incubation for 60min at 37℃<br />
##Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)<br />
#Procedure for detecting Cd2+ & Construction of calibration curve<br />
##E. coli DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation at 37℃ for 12h<br />
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃<br />
##Addition of various concentration of Cd2+ (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃<br />
##Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min<br />
##Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃<br />
##Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO4 in 1.6 % (vol/vol) NH4OH. After 10 min of incubation at room temperature<br />
##The amount of p-aminophenol was determined by a spectrophotometer (615 nm)<br />
<br />
<br />
<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Details
Team:KU Seoul/Details
2009-10-20T07:08:02Z
<p>Roh329: /* Experiment Dairy */</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== The Experiments ==<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
::General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
::Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
:2. Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
#Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Details
Team:KU Seoul/Details
2009-10-20T07:05:22Z
<p>Roh329: /* Experiment Dairy */</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== The Experiments ==<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃ <br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
#Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
#Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
#Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Details
Team:KU Seoul/Details
2009-10-20T06:59:07Z
<p>Roh329: /* Experiment Dairy */</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== The Experiments ==<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
#PCR of BioBrick Parts<br />
#General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
*Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
#:Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
#Part linkage PCR<br />
#Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Details
Team:KU Seoul/Details
2009-10-20T06:57:33Z
<p>Roh329: /* Experiment Dairy */</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== The Experiments ==<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
*PCR of BioBrick Parts<br />
*General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
*Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
*Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
*090922<br />
*Part linkage PCR<br />
*Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
<br />
|}</div>
Roh329
http://2009.igem.org/Team:KU_Seoul/Details
Team:KU Seoul/Details
2009-10-20T06:56:39Z
<p>Roh329: /* Experiment Dairy */</p>
<hr />
<div>{{:Team:KU_Seoul/mainframe}}<br />
<html><br />
<head><br />
<style><br />
<br />
#bodyContent {background-color: #7C001A;}<br />
#content {background-color: #7C001A;}<br />
#footer-box {background-color: #CCCCCC;}<br />
P {color: #000033;}<br />
body {background-color: #DDD0BD;}<br />
<br />
</style><br />
</head><br />
</html><br />
{|style= "background:#FFCC33;" align="center"<br />
|<br />
== The Experiments ==<br />
=== Materials ===<br />
*Backbone Plasmids <br />
**Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C]<br />
**Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C]<br />
*Promoters<br />
**Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue<br />
*Protein Coding Sequences<br />
**{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G]<br />
**{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F]<br />
**Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]<br />
*Primers<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! Template <br />
! Primer <br />
! Sequence <br />
! Length(bp)<br />
|-<br />
|rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34<br />
|-<br />
|pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42<br />
|-<br />
|rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49<br />
|-<br />
|pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33<br />
|-<br />
|rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38<br />
|-<br />
|PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38<br />
|-<br />
|rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78<br />
|-<br />
|gtaaaggagaagaacttttcactg<br />
|-<br />
|rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84<br />
|-<br />
|TCTAGTttattaaacagcagcagcgtagttttcg<br />
|-<br />
|rowspan="4"|Red fluorescent protein<br />
|rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75<br />
|-<br />
|gcttcctccgaagacgttatca<br />
|-<br />
|rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59<br />
|-<br />
|agtgacgac<br />
|-<br />
|rowspan="3"|Aryl acylamidase<br />
|AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37<br />
|-<br />
|rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55<br />
|-<br />
|CGTCCGGCG<br />
|}<br />
*Chemicals<br />
**Acetaminophen (Sigma)<br />
**CdCl2∙H2O (Junsei)<br />
**ZnCl2 (Sigma)<br />
**KH2AsO3 (Sigma)<br />
**Luria-Bertani broth & Bacto agar (Difco)<br />
**o-Cresol (Sigma)<br />
**CuSO4∙5H2O (Sigma)<br />
=== Experiment Dairy ===<br />
*090914<br />
#Streaking of E. coli XL-1 Blue<br />
#Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours<br />
#Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell<br />
#Design of cloning primers & ordering the primers<br />
*090915<br />
#Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction<br />
#Preparation of E. coli DH5a competent cell (based on BSGC protocol)<br />
*090917<br />
#Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)<br />
#Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit<br />
*090918<br />
#Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth<br />
<br />
<br />
*090919<br />
#Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit<br />
#0.8% agarose gel electrophoresis (Figure 1)<br />
[[Image:KU_Seoul_1.jpeg]]<br />
<br />
*090921<br />
*PCR of BioBrick Parts<br />
*General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.5<br />
|-<br />
|D.W. || align="center"| 35.5<br />
|}<br />
*Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃<br />
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"<br />
! PCR mixture <br />
! volume (μl)<br />
|-<br />
|Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] ||align="center"| 1<br />
|-<br />
|2.5mM dNTP ||align="center"| 4<br />
|-<br />
|forward-primer (10pmol/μl) ||align="center"| 2<br />
|-<br />
|reverse-primer (10pmol/μl) || align="center"| 2<br />
|-<br />
|10x Synergy™ buffer || align="center"| 5<br />
|-<br />
|S5x Q-solution || align="center"| 10<br />
|-<br />
|Hot start taq™ (Qiagen) (5U/μl) || align="center"| 0.05<br />
|-<br />
|D.W. || align="center"| 25.5<br />
|}<br />
*Result (Figure 2)<br />
[[Image:KU_Seoul_2.jpg]]<br />
<br />
|}</div>
Roh329