http://2009.igem.org/wiki/index.php?title=Special:Contributions/Sjee&feed=atom&limit=50&target=Sjee&year=&month=2009.igem.org - User contributions [en]2024-03-28T11:14:25ZFrom 2009.igem.orgMediaWiki 1.16.5http://2009.igem.org/Team:NTU-Singapore/Project/Prototype/SenseTeam:NTU-Singapore/Project/Prototype/Sense2009-10-22T03:38:34Z<p>Sjee: /* NorR characterization */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntuproject" class="grid_16"><br />
<span class="hidden">Welcome to the project page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">Hard at work!</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Project | <span class="selflink">pLaq''U''<span class="sup">e</span> Out!</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><div class="wrap_3 suffix_1" id="submenu"><br />
<div class="subtitle contrast grid_3 textright"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu textright"><br />
[[Team:NTU-Singapore/Project | '''p'''Laq''U''<span class="sup">e</span> '''Out''!''''']]<br />
[[Team:NTU-Singapore/Project/Approach | Research Approach]]<br />
[[Team:NTU-Singapore/Project/Prototype/Sense | Sensing Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Degrade | Degradation Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Image | Imaging Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Wetlab | Wetlab Highlights]]<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore Parts Submitted]<br />
[[Team:NTU-Singapore/Project/References | References]]<br />
</div></div><br />
<br />
<div class="grid_11 suffix_1 omega"><br />
<span class="title">Sensing <span class="bold">Device</span></span><br class="clear" /><br />
<br />
<br />
<div id="tock"> <br />
<div class="spiffyfg"><br />
__TOC__<br />
</div><html><br />
<b class="spiffy"><br />
<b class="spiffy5"></b><br />
<b class="spiffy4"></b><br />
<b class="spiffy3"></b><br />
<b class="spiffy2"><b></b></b><br />
<b class="spiffy1"><b></b></b></b><br />
</html></div><br />
<br />
<br />
The '''Sensing device''' will serve as the trigger for our system to start/stop its activity. As such, it is one of the most important constructs that we are working on.<br />
<br />
<br />
As we have elaborated earlier in the [[Team:NTU-Singapore/Project/Prototype | Prototype Design]] section, the '''device''' consists of mainly a a nitric oxide sensitive promoter that allows for transcription of TetR in high [NO], and is deactivated in low [NO].<br />
<br />
<br />
Let us now see how exactly the device works.<br class="clear" /><br />
<br />
== Abstract ==<br />
<br />
Nitric-oxide (NO) sensing promoter (pNO) is a sigma-54 promoter that is regulated by transcription factor NorR, a member of the prokaryotic EBP (enhancer binding protein) family [1].<br />
<br />
NorR is a NO responsive transcription factor which is activated by interaction with NO. Upon activation, NorR will convert the inactive promoter bound sigma-54 RNA polymerase complex to a transcriptionally competent complex in pNO to promote the downstream transcription of the gene [2].<br />
<br />
Thus, expression of the gene downstream of pNO can be regulated by input of NO. <br />
<br />
<br />
In our project to tackle atherosclerosis, we seek to locate the presence of the plaque via the detection of NO concentration in the blood vessels. It has been shown that the cholesterol-induced atherosclerosis would usually impair the NO synthesizing ability of the vascular endothelial cells, and thereby leads to a decrease of NO concentration in the plaque region.<br />
<br />
By equipping our host cells (preferably T-helper cells; however in our experiment, we have used E.coli) with pNO, our system Plaque Out! will sense the decrease in NO concentration in the plaque region [3].<br />
<br />
<br />
This will trigger an inverter module to:<br />
<br />
# secrete cholesterol esterase (CHE) to digest the plaque<br />
# produce infra-red signals to highlight the plaque’s location and<br />
# release NO to dilate the vessel after digestion of plaque.<br />
<br />
<br />
'''Hence, pNO would serve as the main switch for our system Plaque Out!.'''<br />
<br />
<br />
<br />
== Background ==<br />
<br />
Based on the above described function, we have decided to include the entire NorR-NorV/W intergenic region (in E.coli genome) as our pNO promoter sequence. NorV/W genes encode for flavorubredoxin and an associated flavoprotein which would reduce NO to nitrous oxide [4].<br />
<br />
<br />
[[Image:NTUnorr.png|center]]<br />
<br />
<br />
These NorR and NorVW genes can be found in most proteobacteria, especially E.coli. And they are part of an important mechanism that allows bacteria to survive in anaerobic conditions as well as during nitrosative stress. In these cases, NorR protein serves as a NO-responsive transcriptional activator that regulates expression of the norVW genes.<br />
<br />
<br />
<br />
=== Mechanism ===<br />
<br />
In the absence of NO, the N-terminal domain of transcription factor NorR typically represses the ATPase activity of NorR.<br />
<br />
It is only when NO binds to the ferrous iron center of NorR, it would stimulate ATP hydrolysis by NorR. The ATPase activity of NorR is boosted by binding of NorR to the three enhancer binding sites located upstream in the pNO.<br />
<br />
The energy released by ATP hydrolysis enables NorR to activate pNO bound sigma-54 RNA polymerase complex (or RNA polymerase holoenzyme), thus initiating the transcription process [2].<br />
<br />
<br />
<br />
=== Sequence ===<br />
<br />
Using NCBI’s reference sequence NC_000913.2, the 186 bp NorR-NorVW intergenic region sequence is obtained using E.coli (strain: K-12; sub-strain: MG1655) as the search organism. The sequence is found in genome position 2830311 – 2830496. The NorR-NorVW intergenic sequence is as follows (5’ - 3’):<br />
<br />
<br />
<div class="mono"><br />
TCTTTGCCTCACTGTCAATTTGACTATAGATATTGTCATATCGACCATTTGATTGATAGTCATTTTGACT<br /><br />
ACTCATTAATGGGCATAATTTTATTTATAGAGTAAAAACAATCAGATAAAAAA<span class="blu">CTGGCACGCAATCTGCA</span><br /><br />
ATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGC<br /><br />
</div><br />
<br />
<br />
The highlighted sequence is the sigma-54 promoter. The reason why we had included the entire intergenic region as our pNO promoter sequence is that there are 3 enhancer binding sites upstream of the sigma-54 promoter. These enhancer binding sites allow the transcription factor, NorR to bind to the DNA, thus leading to a localized increase in NorR concentration [2].<br />
<br />
As such, the increase in localized NorR concentration facilitates the NorR to make contact with the sigma 54 – RNA polymerase [5].<br />
<br />
<br />
<br />
== Construct Design ==<br />
<br />
In our system, Plaque Out!, we wish to regulate the production of TetR protein with respect to the concentration of NO.<br />
<br />
The TetR protein would in turn regulate the production of Cholesterol esterase (CHE), Haem Oxyenase (HO-1), and Infra-red protein (IFP). Thus, our NO sensing construct is as follows:<br />
<br />
<br />
[[Image:NTUsysnorr.png|center|651px]]<br />
<br />
<br />
<br />
=== Characteristic Equations ===<br />
<br />
<br />
'''Ligand binding''' :<br />
<br />
Using Hill equation to express the fraction of NO-bound NorR, we assume independent and non-cooperative binding of NO (i.e. Hill coefficient is taken to be 1).<br />
<br />
Thus, fraction of NO-bound NorR is described as follows:<br />
<br />
[[Image:NTUnorrfrac.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
Since the dissociation constant K<span class="sub">d1</span> can be illustrated as:<br />
<br />
[[Image:NTUnorrdiss.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
Fraction of NO-bound NorR can be expressed as a function of available NO concentration, [NO]<span class="sub">free</span><br />
<br />
[[Image:NTUnorrtrans.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
<br />
'''Transcription of TetR'''<br />
<br />
Deterministic first order differential equation (ODE) is used to depict the NO-regulated transcription of TetR.<br />
<br />
[[Image:NTUtetrtranscript.png|x50px|left]]<br class="clear" /><br />
<br />
Where V<span class="sub">max</span> is max transcription rate & D<span class="sub">m</span> is the degradation rate of mRNA.<br />
<br />
<br />
<br />
'''Translation of TetR'''<br />
<br />
Deterministic first order ODE is used again to represent the translation of TetR protein.<br />
<br />
[[Image:NTUtetrtransl.png|x50px|left]]<br class="clear"><br />
<br />
Where K<span class="sub">tl</span> is the translation rate of mRNA & D<span class="sub">p</span> is the degradation rate of TetR protein.<br />
<br />
<br />
<br />
=== Modelling & Simulation ===<br />
<br />
We make the following assumptions:<br />
<br />
# Biological systems of transcription and translation are assumed to be linear and time-invariant<br />
# Concentration of the transcription factor, NorR in E.coli is assumed to be in excess and constant. Hence, [NorR] is not taken into account in our model<br />
# There is no time lag for NO diffusion from ext. environment into the cell<br />
# Constant Degradation rates for mRNA as well as protein<br />
<br />
Instead of modelling with TetR, we are using GFP as our output. This is part of our effort in trying to predict the wetlab characterization of pNO.<br />
<br />
<br />
The following is our '''Sensing device''' represented as a Simulink system. ''Please click on it for a larger view''.<br />
<br />
[[Image:NTUpnosys.png|651px|center]]<br />
<br />
<br />
Using TinkerCell, a systems biology software, we can do deterministic (left) & stochastic (right) modelling side by side. ''Click on the images for a larger view.''<br />
<br />
<br />
Response to changing [NO] with regards to TetR and NorR is simulated. These simulations predict the relationships among NO, NorR, and TetR. ''NO (blue), NorR(Red), TetR (Green)''<br />
<br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnotime.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnotimestoc.png|285px]]</div><br class="clear" /><br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnonorr.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnonorrstoc.png|285px]]</div><br class="clear" /><br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnotetr.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnotetrstoc.png|285px]]</div><br class="clear" /><br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnono.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnonostoc.png|285px]]</div><br class="clear" /><br />
<br />
== Device Construction ==<br />
<br />
'''pNO-B0034-GFP-B0015 (pSB1A2)'''<br />
<br />
To study the strength of pNO, we have decided to use pNO for the expression of green fluorescence protein (GFP). <br />
<br />
pNO was first directly synthesized by GENEARTTM, one of the sponsors for iGEM. After digesting it with EcoRI and SpeI, it was ligated to B0034-GFP-B0015 as follows:<br />
<br />
<br />
[[Image:NTUpnotestcon.png|center]]<br />
<br />
<br />
The test construct, pNO-B0034-GFP-B0015 was characterized using fluorescence detecting microplate reader, '''Synergy HT''' from BioTek, U.S.A.<br />
<br />
<br />
<br />
'''J23119-B0034-NorR-B0015 (pSB1A2) / (pSB3K2)'''<br />
<br />
Though the transcription factor, NorR has been endogenously expressed in E.coli, our desired chassis is the macrophage. Thus, a NorR producing construct has to be created in order to equip the macrophage with the capability to detect NO.<br />
<br />
In addition, to reduce competitive binding of NorR between the endogenous NorR-NorVW intergenic region (in E.coli) and our pNO construct, large scale production of NorR is necessary.<br />
<br />
<br />
NorR sequence was first extracted from E.coli chromosomal DNA (K-12, DH10B) via polymerase chain reaction (PCR). Next, the linearized dsDNA was converted to a biobrick part by adding prefix and suffix using PCR.<br />
<br />
<br />
[[Image:NTUnorrcon.png|center]]<br />
<br />
<br />
Lastly, the biobrick NorR was digested with relevant restriction enzymes (EcoRI / XbaI / SpeI / PstI) in order to be ligated to form the stated construct. <br />
<br />
<br />
<br />
=== Device Characterization ===<br />
<br />
==== pNO characterization ====<br />
<br />
'''Characterisation of our novel nitric-oxide sensitive promoter (pNO) involved three steps''' :<br />
<br />
# Inoculation of the E. coli containing the test construct (GFP reporter) in the M9 supplemented medium<br />
# Treatment of the E. coli cells with varying concentrations of a nitric-oxide donor (sodium nitroprusside or SNP)<br />
# Fluorescence quantification using a fluorescence 96-well mircoplate reader. The full protocol was described by Kelly et al [6].<br />
<br />
Controls include untransformed cells and transformed cells that are not treated with SNP. <br />
<br />
<br />
[[Image:NTUpnoflor.jpg|651px]]<br />
<br />
<center>'''GFP fluorescence in E. coli culture treated with varying [SNP].'''</center><br />
<br />
Cells containing the construct produced a more intense green colouring with increasing [SNP] from 0.1mM – 10mM. 1000mM and 100mM are red due to the native colour of SNP. Cytotoxicity effects might have limited the output beyond 10mM.<br />
<br />
<br />
[[Image:NTUpnogfptime.png|651px]]<br />
<br />
<center>'''Response of pNO to varying [SNP]'''</center><br />
<br />
<br />
Untransformed cells (blue diamond) showed the least fluorescence output. E coli containing the test construct but are not treated with SNP (orange circle) showed a slight increase in fluorescence with respect to the untransformed cells, suggesting response to ambient NO. Treatment of E coli test constructs with increasing concentrations of SNP showed increasing GFP fluorescence, indicating dose-dependent response.<br />
<br />
<br />
[[Image:NTUpno3dgraph.png|651px]]<br />
<br />
<center>'''Response of pNO to increasing [SNP]'''</center><br />
<br />
<br />
Positive correlation of [SNP] and GFP fluorescence was observed. However, fluorescence output remained constant against time, suggesting that steady state has been reached before measurements were taken. <br />
<br />
<br />
Of note, the strength of our novel NO-inducible promoter was weaker than most established inducible promoters such as pLux and pLacI. SNP-induced relative GFP fluorescence from pNO as measured using our 96-well microplate reader was about 30 arbitrary units when induced with 10mM of SNP. On the other hand, the maximum IPTG-induced GFP fluorescence from pLacI was about a few hundred arbitrary units. Further work has to be done to optimise the applicability of the pNO promoter. However, primary characterisation studies have proven pNO to be a highly promising novel inducible promoter. <br />
<br />
<br />
<br />
==== NorR characterization ====<br />
<br />
<u>'''Primer synthesis'''</u><br />
<br />
Using NCBI’s reference sequence NC_000913.2 and E.coli (strain: K-12; substrain: MG1655) as search organism, the DNA sequence for NorR was obtained. The 1515 bp NorR resides at genome position 2828797 – 2830311, and the sequence is as follows:<br />
<br />
<br />
<div class="mono"><br />
ATGAGTTTTTCCGTTGATGTGCTGGCGAATATCGCCATCGAATTGCAGCGTGGGATTGGTCACCAGGATC<br /><br />
GTTTTCAGCGCCTGATCACCACGCTACGTCAGGTGCTGGAGTGCGATGCGTCTGCGTTGCTACGTTACGA<br /><br />
TTCGCGGCAGTTTATTCCGCTTGCCATCGACGGTCTGGCAAAGGATGTACTCGGTAGACGCTTTGCGCTG<br /><br />
GAAGGGCATCCACGGCTGGAAGCGATTGCCCGCGCCGGGGATGTGGTGCGCTTTCCCGCAGACAGCGAAT<br /><br />
TGCCCGATCCCTATGACGGTTTGATTCCTGGGCAGGAGAGTCTGAAGGTTCACGCCTGCGTTGGTCTGCC<br /><br />
ATTGTTTGCCGGGCAAAACCTGATCGGCGCACTGACGCTCGACGGGATGCAGCCCGATCAGTTCGATGTT<br /><br />
TTCAGCGACGAAGAGCTACGGCTGATTGCTGCGCTGGCGGCGGGAGCGTTAAGCAATGCGTTGCTGATTG<br /><br />
AACAACTGGAAAGCCAGAATATGCTGCCAGGCGATGCCACGCCGTTTGAAGCGGTGAAACAGACGCAGAT<br /><br />
GATTGGCTTGTCCCCTGGCATGACGCAACTGAAAAAAGAGATTGAGATTGTGGCGGCGTCCGATCTCAAC<br /><br />
GTCCTGATCAGCGGTGAGACTGGAACCGGTAAGGAGCTGGTGGCGAAAGCGATTCATGAAGCCTCGCCAC<br /><br />
GGGCGGTGAATCCGCTGGTCTATCTCAACTGTGCTGCACTGCCGGAAAGTGTGGCGGAAAGTGAGTTGTT<br /><br />
CGGGCATGTGAAAGGAGCGTTTACTGGCGCTATCAGTAATCGCAGCGGGAAGTTTGAAATGGCGGATAAC<br /><br />
GGCACGCTGTTTCTGGATGAGATCGGCGAGTTGTCGTTGGCATTGCAGGCCAAGCTGCTGAGGGTGTTGC<br /><br />
AGTATGGCGATATTCAGCGCGTTGGCGATGACCGTTGTTTGCGGGTCGATGTGCGCGTGCTGGCGGCGAC<br /><br />
TAACCGCGATTTACGCGAAGAGGTGCTGGCAGGGCGATTCCGCGCCGATTTGTTTCATCGCCTGAGCGTG<br /><br />
TTTCCACTTTCGGTGCCGCCGCTGCGTGAGCGGGGCGATGATGTCATTCTGCTGGCGGGGTATTTCTGCG<br /><br />
AGCAGTGTCGTTTGCGGCAGGGGCTCTCCCGCGTGGTATTAAGTGCCGGAGCGCGAAATTTACTGCAACA<br /><br />
CTACAGTTTTCCGGGAAACGTGCGCGAACTGGAACATGCTATTCATCGGGCGGTAGTTCTGGCGAGAGCC<br /><br />
ACCCGCAGCGGCGATGAAGTGATTCTTGAGGCGCAACATTTTGCTTTTCCTGAGGTGACGTTGCCGACGC<br /><br />
CAGAAGTGGCGGCGGTGCCCGTTGTTAAGCAAAACCTGCGTGAAGCGACAGAAGCGTTCCAGCGTGAAAC<br /><br />
TATTCGTCAGGCACTGGCACAAAATCATCACAACTGGGCTGCCTGCGCGCGGATGCTGGAAACCGACGTC<br /><br />
GCCAACCTGCATCGGCTGGCGAAACGTCTGGGATTGAAGGATTAA<br /><br />
</div><br />
<br />
<br />
To ensure that the endogenous NorR sequence can be directly converted into a biobrick part without any modification, the sequence was checked with Webcutter 2.0 (http://rna.lundberg.gu.se/cutter2/) for any presence of EcoRI / NotI / XbaI / SpeI / PstI restriction sites. Since none of these restriction sites was found in the endogenouse NorR genome, direct PCR extraction can be performed. PCR primers were designed using NCBI’s PrimerBlast.<br />
<br />
<br />
'''The primer sequences for NorR Extraction''' :<br />
<br />
''Forward Primer (27 bases)'': 5’-TTAATCCTTCAATCCCAGACGTTTCGC-3’<br />
<br />
''Reverse Primer (26 bases)'':5’- ATGAGTTTTTCCGTTGATGTGCTGGC-3’<br />
<br />
<br />
Since NorR sequence is on the anti-sense strand of E.coli genome, the biobrick prefix has to be added to the reverse primer, rather than forward primer, and vice-versa.<br />
<br />
'''The primer sequences for Biobrick conversion''' :<br />
<br />
''Addition of Preffix to Reverse primer – Forward Primer (50 bases)'' :<br />
<br />
5’-GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ATGAGTTTTTCCGTTGATGT-3’<br />
<br />
<br />
''Addition of Suffix to Forward primer – Reverse Primer (50 bases)'' :<br />
<br />
5’-GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTAATCCTTCAATCCCAGACG-3’<br />
<br />
<br />
The oligonucleotides were synthesized by one of our team’s sponsor, 1st Base Holdings, Singapore.<br />
<br />
<br />
<u>'''Ethanol Precipitation of E.coli Chromosomal DNA'''</u><br />
<br />
Invitrogen’s TOP10 cells were first grown for 16 hours in 5 ml LB media at 37 deg C, 250 rpm before being centrifuge at 4000 rpm for 10 mins. The supernatant was decanted, and the cells were lysed using QIAGEN miniprep kit’s P1, P2 and N3 buffers. Since QIAquick spin columns can only immobilized DNA strands up to 10kb, hence, it was not used for the extraction of E.coli chromosomal DNA. Instead, ethanol precipitation was performed.<br />
<br />
<br />
'''Procedures of ethanol precipitation''' :<br />
<br />
# 1/10 vol of 3M Sodium Acetate (pH 5.2) was added to the supernatant containing E.coli DNA, P1, P2 and N3 buffers. <br />
# 3 vol. of ice-cold absolute ethanol (stored at -20 deg C) was then added to the mixture. <br />
# Incubate the sample on ice for 30 mins before spinning the sample at 13,000 rpm for 15 min. <br />
# Decant the supernatant, and add 1 ml of 70 % ethanol was added to wash any salts present. <br />
# Centrifuge for another 10 min at 13,000 rpm before decanting the supernatant. Air-dry the sample for 15 min.<br />
# Add de-ionized water or Tris-HCl buffer (pH 7.5) to re-suspend the DNA precipitate.<br />
<br />
<br />
'''PCR extraction of NorR & Biobrick conversion'''<br />
<br />
PCR reaction was performed in the reaction vol of 50 µl containing PCR supermix (High Fidelity) from Invitrogen, 0.2 µM of each primer (Forward / Reverse), and 3 µg of E.coli chromosomal DNA. The cycling conditions were as followed: 30 sec at 94 °C followed by 30 cycles of 30 sec at 94°C, 30 sec at 58 °C, 2 min at 72 °C and a final extension of 10 min at 72 °C.<br />
<br />
<br />
The PCR products were ran in 1% gel for 40 min at 120V before subjecting to gel extraction using QIAGEN gel extraction kit. Addition of prefix and suffix was performed on the purified NorR DNA using the same PCR conditions mentioned above.<br />
. <br />
<br />
<br />
[[Image:NTUnorrbiobrick.jpg|651px]]<br />
<br />
'''1% agarose gel photo verifying the success of the PCR extraction and biobrick conversion'''<br />
<br />
<br />
<br />
'''Ligation to form J23119-B0034-NorR-B0015'''<br />
<br />
Biobrick NorR was first digested with XbaI and PstI in order to be ligated to B0034. The ligation order was as follows: <br />
<br />
# B0034 + NorR<br />
# B0034-NorR + B0015<br />
# J23119 + B0034-NorR-B0015<br />
<br />
<br />
The final J23119-B0034-NorR-B0015 is in pSB1A2 backbone. The displayed gel photos confirmed the presence of the successfully ligated construct of B0034-NorR-T (~1700bp) and J23119-B00340-NorR-B0015 (~1750 bp).<br />
<br />
<br />
[[Image:NTUnorrgel1.jpg|651px]]<br />
<br />
[[Image:NTUnorrgel2.jpg|651px]]<br />
<br />
<br />
<br />
<u>'''SDS PAGE of J23119-B0034-NorR-B0015'''</u><br />
<br />
The successful construct J23119-B0034-NorR-B0015 was ligated to pSB3K2 vector, and was later introduced into Invitrogen’s TOP10 cells. Transformed cells were grown for 16 hrs, at 37 deg C, 250 rpm, before undergoing cell lysis for SDS PAGE.<br />
<br />
The SDS PAGE results was reflected in the gel photo. Production of 55 kDa NorR protein had been confirmed by the result.<br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUnorrsds.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
<br />
'''55 kDa NorR band has been circled in red.'''<br />
<br class="clear" /><br />
<br />
<br />
<u>'''NorR Characterization via SDS PAGE'''</u><br />
<br />
Since the sole purpose of J23119-B0034-NorR-B0015 (BBa_K256007) is to produce NorR, we studied physicochemical factors that might affect the production of the protein. The transformed cells were incubated at 3 different environmental temperatures (i.e. 30, 37 and 42°C).<br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUnorrsds2.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
'''SDS PAGE results for different temperature'''<br class="clear" /><br />
<br />
It has been observed that at elevated temperature, i.e. 42°C, production of NorR had decreased as shown by the diminished intensity (see lane '42'). The production of NorR at 30°C and 37°C were comparable.<br />
<br />
'''Conclusion'''<br class="clear" /><br />
<br />
Our NorR producing construct had been verified to be successful and shown to be working well.<br />
<br />
== Literature / References ==<br />
<br />
<div class="ref"><br />
# M.I. Hutchings, N. Mandhana, and S. Spiro, “The NorR protein of Escherichia coli activates expression of the Flavorbredoxin gene NorV in response to reactive nitrogen species,” Journal of bacteriology, vol. 184, (no. 16), pp. 4640 - 4643, 2002.<br />
# N.P. Tucker, B.D. Autreaux, S. Spiro, and R. Dixon, “Mechanism of transcriptional regulation by Escherichia Coli nitric oxide sensor NorR,” Biochemical Society Transactions, vol. 34, (no. 1), pp. 191 - 194, 2006.<br />
# T.J.M. Anderson, “Nitric Oxide, Atherosclerosis and clinical relevance of endothelial dysfunction,” Heart Failure Reviews, vol. 8, pp. 71 - 86, 2003.<br />
# S.Spiro, “Nitric oxide-sensing mechanisms in Escherichia coli,” Biochemical Society Transactions, vol. 34, (no. 1), pp. 200 - 202, 2006.<br />
# N.P. Tucker, B. D’Autre´aux, D.J. Studholme, S. Spiro, and R. Dixon, “DNA Binding Activity of the Escherichia coli Nitric Oxide Sensor NorR Suggests a Conserved Target Sequence in Diverse Proteobacteria,” Journal of Bacteriology, vol. 186, (no. 19), pp. 6656–6660, 2004.<br />
# Kelly et al. (2009). "Measuring the activity of Biobrick promoters using an in vivo reference standard." Journal of Biological Engineering 3(4).<br />
</div><br />
<br />
Please proceed [[Team:NTU-Singapore/Project/References | here]] to view our full list of references.<br />
<br />
<br />
<br />
</div></div><br />
<br />
{{Template:NTUfootalt}}</div>Sjeehttp://2009.igem.org/File:NTUnorrsds2.jpgFile:NTUnorrsds2.jpg2009-10-22T03:36:40Z<p>Sjee: uploaded a new version of "Image:NTUnorrsds2.jpg"</p>
<hr />
<div></div>Sjeehttp://2009.igem.org/File:NTUnorrsds.jpgFile:NTUnorrsds.jpg2009-10-22T03:34:50Z<p>Sjee: uploaded a new version of "Image:NTUnorrsds.jpg"</p>
<hr />
<div></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Project/Prototype/SenseTeam:NTU-Singapore/Project/Prototype/Sense2009-10-22T03:29:40Z<p>Sjee: /* NorR characterization */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntuproject" class="grid_16"><br />
<span class="hidden">Welcome to the project page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">Hard at work!</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Project | <span class="selflink">pLaq''U''<span class="sup">e</span> Out!</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><div class="wrap_3 suffix_1" id="submenu"><br />
<div class="subtitle contrast grid_3 textright"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu textright"><br />
[[Team:NTU-Singapore/Project | '''p'''Laq''U''<span class="sup">e</span> '''Out''!''''']]<br />
[[Team:NTU-Singapore/Project/Approach | Research Approach]]<br />
[[Team:NTU-Singapore/Project/Prototype/Sense | Sensing Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Degrade | Degradation Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Image | Imaging Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Wetlab | Wetlab Highlights]]<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore Parts Submitted]<br />
[[Team:NTU-Singapore/Project/References | References]]<br />
</div></div><br />
<br />
<div class="grid_11 suffix_1 omega"><br />
<span class="title">Sensing <span class="bold">Device</span></span><br class="clear" /><br />
<br />
<br />
<div id="tock"> <br />
<div class="spiffyfg"><br />
__TOC__<br />
</div><html><br />
<b class="spiffy"><br />
<b class="spiffy5"></b><br />
<b class="spiffy4"></b><br />
<b class="spiffy3"></b><br />
<b class="spiffy2"><b></b></b><br />
<b class="spiffy1"><b></b></b></b><br />
</html></div><br />
<br />
<br />
The '''Sensing device''' will serve as the trigger for our system to start/stop its activity. As such, it is one of the most important constructs that we are working on.<br />
<br />
<br />
As we have elaborated earlier in the [[Team:NTU-Singapore/Project/Prototype | Prototype Design]] section, the '''device''' consists of mainly a a nitric oxide sensitive promoter that allows for transcription of TetR in high [NO], and is deactivated in low [NO].<br />
<br />
<br />
Let us now see how exactly the device works.<br class="clear" /><br />
<br />
== Abstract ==<br />
<br />
Nitric-oxide (NO) sensing promoter (pNO) is a sigma-54 promoter that is regulated by transcription factor NorR, a member of the prokaryotic EBP (enhancer binding protein) family [1].<br />
<br />
NorR is a NO responsive transcription factor which is activated by interaction with NO. Upon activation, NorR will convert the inactive promoter bound sigma-54 RNA polymerase complex to a transcriptionally competent complex in pNO to promote the downstream transcription of the gene [2].<br />
<br />
Thus, expression of the gene downstream of pNO can be regulated by input of NO. <br />
<br />
<br />
In our project to tackle atherosclerosis, we seek to locate the presence of the plaque via the detection of NO concentration in the blood vessels. It has been shown that the cholesterol-induced atherosclerosis would usually impair the NO synthesizing ability of the vascular endothelial cells, and thereby leads to a decrease of NO concentration in the plaque region.<br />
<br />
By equipping our host cells (preferably T-helper cells; however in our experiment, we have used E.coli) with pNO, our system Plaque Out! will sense the decrease in NO concentration in the plaque region [3].<br />
<br />
<br />
This will trigger an inverter module to:<br />
<br />
# secrete cholesterol esterase (CHE) to digest the plaque<br />
# produce infra-red signals to highlight the plaque’s location and<br />
# release NO to dilate the vessel after digestion of plaque.<br />
<br />
<br />
'''Hence, pNO would serve as the main switch for our system Plaque Out!.'''<br />
<br />
<br />
<br />
== Background ==<br />
<br />
Based on the above described function, we have decided to include the entire NorR-NorV/W intergenic region (in E.coli genome) as our pNO promoter sequence. NorV/W genes encode for flavorubredoxin and an associated flavoprotein which would reduce NO to nitrous oxide [4].<br />
<br />
<br />
[[Image:NTUnorr.png|center]]<br />
<br />
<br />
These NorR and NorVW genes can be found in most proteobacteria, especially E.coli. And they are part of an important mechanism that allows bacteria to survive in anaerobic conditions as well as during nitrosative stress. In these cases, NorR protein serves as a NO-responsive transcriptional activator that regulates expression of the norVW genes.<br />
<br />
<br />
<br />
=== Mechanism ===<br />
<br />
In the absence of NO, the N-terminal domain of transcription factor NorR typically represses the ATPase activity of NorR.<br />
<br />
It is only when NO binds to the ferrous iron center of NorR, it would stimulate ATP hydrolysis by NorR. The ATPase activity of NorR is boosted by binding of NorR to the three enhancer binding sites located upstream in the pNO.<br />
<br />
The energy released by ATP hydrolysis enables NorR to activate pNO bound sigma-54 RNA polymerase complex (or RNA polymerase holoenzyme), thus initiating the transcription process [2].<br />
<br />
<br />
<br />
=== Sequence ===<br />
<br />
Using NCBI’s reference sequence NC_000913.2, the 186 bp NorR-NorVW intergenic region sequence is obtained using E.coli (strain: K-12; sub-strain: MG1655) as the search organism. The sequence is found in genome position 2830311 – 2830496. The NorR-NorVW intergenic sequence is as follows (5’ - 3’):<br />
<br />
<br />
<div class="mono"><br />
TCTTTGCCTCACTGTCAATTTGACTATAGATATTGTCATATCGACCATTTGATTGATAGTCATTTTGACT<br /><br />
ACTCATTAATGGGCATAATTTTATTTATAGAGTAAAAACAATCAGATAAAAAA<span class="blu">CTGGCACGCAATCTGCA</span><br /><br />
ATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGC<br /><br />
</div><br />
<br />
<br />
The highlighted sequence is the sigma-54 promoter. The reason why we had included the entire intergenic region as our pNO promoter sequence is that there are 3 enhancer binding sites upstream of the sigma-54 promoter. These enhancer binding sites allow the transcription factor, NorR to bind to the DNA, thus leading to a localized increase in NorR concentration [2].<br />
<br />
As such, the increase in localized NorR concentration facilitates the NorR to make contact with the sigma 54 – RNA polymerase [5].<br />
<br />
<br />
<br />
== Construct Design ==<br />
<br />
In our system, Plaque Out!, we wish to regulate the production of TetR protein with respect to the concentration of NO.<br />
<br />
The TetR protein would in turn regulate the production of Cholesterol esterase (CHE), Haem Oxyenase (HO-1), and Infra-red protein (IFP). Thus, our NO sensing construct is as follows:<br />
<br />
<br />
[[Image:NTUsysnorr.png|center|651px]]<br />
<br />
<br />
<br />
=== Characteristic Equations ===<br />
<br />
<br />
'''Ligand binding''' :<br />
<br />
Using Hill equation to express the fraction of NO-bound NorR, we assume independent and non-cooperative binding of NO (i.e. Hill coefficient is taken to be 1).<br />
<br />
Thus, fraction of NO-bound NorR is described as follows:<br />
<br />
[[Image:NTUnorrfrac.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
Since the dissociation constant K<span class="sub">d1</span> can be illustrated as:<br />
<br />
[[Image:NTUnorrdiss.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
Fraction of NO-bound NorR can be expressed as a function of available NO concentration, [NO]<span class="sub">free</span><br />
<br />
[[Image:NTUnorrtrans.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
<br />
'''Transcription of TetR'''<br />
<br />
Deterministic first order differential equation (ODE) is used to depict the NO-regulated transcription of TetR.<br />
<br />
[[Image:NTUtetrtranscript.png|x50px|left]]<br class="clear" /><br />
<br />
Where V<span class="sub">max</span> is max transcription rate & D<span class="sub">m</span> is the degradation rate of mRNA.<br />
<br />
<br />
<br />
'''Translation of TetR'''<br />
<br />
Deterministic first order ODE is used again to represent the translation of TetR protein.<br />
<br />
[[Image:NTUtetrtransl.png|x50px|left]]<br class="clear"><br />
<br />
Where K<span class="sub">tl</span> is the translation rate of mRNA & D<span class="sub">p</span> is the degradation rate of TetR protein.<br />
<br />
<br />
<br />
=== Modelling & Simulation ===<br />
<br />
We make the following assumptions:<br />
<br />
# Biological systems of transcription and translation are assumed to be linear and time-invariant<br />
# Concentration of the transcription factor, NorR in E.coli is assumed to be in excess and constant. Hence, [NorR] is not taken into account in our model<br />
# There is no time lag for NO diffusion from ext. environment into the cell<br />
# Constant Degradation rates for mRNA as well as protein<br />
<br />
Instead of modelling with TetR, we are using GFP as our output. This is part of our effort in trying to predict the wetlab characterization of pNO.<br />
<br />
<br />
The following is our '''Sensing device''' represented as a Simulink system. ''Please click on it for a larger view''.<br />
<br />
[[Image:NTUpnosys.png|651px|center]]<br />
<br />
<br />
Using TinkerCell, a systems biology software, we can do deterministic (left) & stochastic (right) modelling side by side. ''Click on the images for a larger view.''<br />
<br />
<br />
Response to changing [NO] with regards to TetR and NorR is simulated. These simulations predict the relationships among NO, NorR, and TetR. ''NO (blue), NorR(Red), TetR (Green)''<br />
<br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnotime.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnotimestoc.png|285px]]</div><br class="clear" /><br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnonorr.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnonorrstoc.png|285px]]</div><br class="clear" /><br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnotetr.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnotetrstoc.png|285px]]</div><br class="clear" /><br />
<br />
<div class="grid_5 suffix_1 alpha">[[Image:NTUnono.png|285px]]</div><br />
<div class="grid_5 omega">[[Image:NTUnonostoc.png|285px]]</div><br class="clear" /><br />
<br />
== Device Construction ==<br />
<br />
'''pNO-B0034-GFP-B0015 (pSB1A2)'''<br />
<br />
To study the strength of pNO, we have decided to use pNO for the expression of green fluorescence protein (GFP). <br />
<br />
pNO was first directly synthesized by GENEARTTM, one of the sponsors for iGEM. After digesting it with EcoRI and SpeI, it was ligated to B0034-GFP-B0015 as follows:<br />
<br />
<br />
[[Image:NTUpnotestcon.png|center]]<br />
<br />
<br />
The test construct, pNO-B0034-GFP-B0015 was characterized using fluorescence detecting microplate reader, '''Synergy HT''' from BioTek, U.S.A.<br />
<br />
<br />
<br />
'''J23119-B0034-NorR-B0015 (pSB1A2) / (pSB3K2)'''<br />
<br />
Though the transcription factor, NorR has been endogenously expressed in E.coli, our desired chassis is the macrophage. Thus, a NorR producing construct has to be created in order to equip the macrophage with the capability to detect NO.<br />
<br />
In addition, to reduce competitive binding of NorR between the endogenous NorR-NorVW intergenic region (in E.coli) and our pNO construct, large scale production of NorR is necessary.<br />
<br />
<br />
NorR sequence was first extracted from E.coli chromosomal DNA (K-12, DH10B) via polymerase chain reaction (PCR). Next, the linearized dsDNA was converted to a biobrick part by adding prefix and suffix using PCR.<br />
<br />
<br />
[[Image:NTUnorrcon.png|center]]<br />
<br />
<br />
Lastly, the biobrick NorR was digested with relevant restriction enzymes (EcoRI / XbaI / SpeI / PstI) in order to be ligated to form the stated construct. <br />
<br />
<br />
<br />
=== Device Characterization ===<br />
<br />
==== pNO characterization ====<br />
<br />
'''Characterisation of our novel nitric-oxide sensitive promoter (pNO) involved three steps''' :<br />
<br />
# Inoculation of the E. coli containing the test construct (GFP reporter) in the M9 supplemented medium<br />
# Treatment of the E. coli cells with varying concentrations of a nitric-oxide donor (sodium nitroprusside or SNP)<br />
# Fluorescence quantification using a fluorescence 96-well mircoplate reader. The full protocol was described by Kelly et al [6].<br />
<br />
Controls include untransformed cells and transformed cells that are not treated with SNP. <br />
<br />
<br />
[[Image:NTUpnoflor.jpg|651px]]<br />
<br />
<center>'''GFP fluorescence in E. coli culture treated with varying [SNP].'''</center><br />
<br />
Cells containing the construct produced a more intense green colouring with increasing [SNP] from 0.1mM – 10mM. 1000mM and 100mM are red due to the native colour of SNP. Cytotoxicity effects might have limited the output beyond 10mM.<br />
<br />
<br />
[[Image:NTUpnogfptime.png|651px]]<br />
<br />
<center>'''Response of pNO to varying [SNP]'''</center><br />
<br />
<br />
Untransformed cells (blue diamond) showed the least fluorescence output. E coli containing the test construct but are not treated with SNP (orange circle) showed a slight increase in fluorescence with respect to the untransformed cells, suggesting response to ambient NO. Treatment of E coli test constructs with increasing concentrations of SNP showed increasing GFP fluorescence, indicating dose-dependent response.<br />
<br />
<br />
[[Image:NTUpno3dgraph.png|651px]]<br />
<br />
<center>'''Response of pNO to increasing [SNP]'''</center><br />
<br />
<br />
Positive correlation of [SNP] and GFP fluorescence was observed. However, fluorescence output remained constant against time, suggesting that steady state has been reached before measurements were taken. <br />
<br />
<br />
Of note, the strength of our novel NO-inducible promoter was weaker than most established inducible promoters such as pLux and pLacI. SNP-induced relative GFP fluorescence from pNO as measured using our 96-well microplate reader was about 30 arbitrary units when induced with 10mM of SNP. On the other hand, the maximum IPTG-induced GFP fluorescence from pLacI was about a few hundred arbitrary units. Further work has to be done to optimise the applicability of the pNO promoter. However, primary characterisation studies have proven pNO to be a highly promising novel inducible promoter. <br />
<br />
<br />
<br />
==== NorR characterization ====<br />
<br />
<u>'''Primer synthesis'''</u><br />
<br />
Using NCBI’s reference sequence NC_000913.2 and E.coli (strain: K-12; substrain: MG1655) as search organism, the DNA sequence for NorR was obtained. The 1515 bp NorR resides at genome position 2828797 – 2830311, and the sequence is as follows:<br />
<br />
<br />
<div class="mono"><br />
ATGAGTTTTTCCGTTGATGTGCTGGCGAATATCGCCATCGAATTGCAGCGTGGGATTGGTCACCAGGATC<br /><br />
GTTTTCAGCGCCTGATCACCACGCTACGTCAGGTGCTGGAGTGCGATGCGTCTGCGTTGCTACGTTACGA<br /><br />
TTCGCGGCAGTTTATTCCGCTTGCCATCGACGGTCTGGCAAAGGATGTACTCGGTAGACGCTTTGCGCTG<br /><br />
GAAGGGCATCCACGGCTGGAAGCGATTGCCCGCGCCGGGGATGTGGTGCGCTTTCCCGCAGACAGCGAAT<br /><br />
TGCCCGATCCCTATGACGGTTTGATTCCTGGGCAGGAGAGTCTGAAGGTTCACGCCTGCGTTGGTCTGCC<br /><br />
ATTGTTTGCCGGGCAAAACCTGATCGGCGCACTGACGCTCGACGGGATGCAGCCCGATCAGTTCGATGTT<br /><br />
TTCAGCGACGAAGAGCTACGGCTGATTGCTGCGCTGGCGGCGGGAGCGTTAAGCAATGCGTTGCTGATTG<br /><br />
AACAACTGGAAAGCCAGAATATGCTGCCAGGCGATGCCACGCCGTTTGAAGCGGTGAAACAGACGCAGAT<br /><br />
GATTGGCTTGTCCCCTGGCATGACGCAACTGAAAAAAGAGATTGAGATTGTGGCGGCGTCCGATCTCAAC<br /><br />
GTCCTGATCAGCGGTGAGACTGGAACCGGTAAGGAGCTGGTGGCGAAAGCGATTCATGAAGCCTCGCCAC<br /><br />
GGGCGGTGAATCCGCTGGTCTATCTCAACTGTGCTGCACTGCCGGAAAGTGTGGCGGAAAGTGAGTTGTT<br /><br />
CGGGCATGTGAAAGGAGCGTTTACTGGCGCTATCAGTAATCGCAGCGGGAAGTTTGAAATGGCGGATAAC<br /><br />
GGCACGCTGTTTCTGGATGAGATCGGCGAGTTGTCGTTGGCATTGCAGGCCAAGCTGCTGAGGGTGTTGC<br /><br />
AGTATGGCGATATTCAGCGCGTTGGCGATGACCGTTGTTTGCGGGTCGATGTGCGCGTGCTGGCGGCGAC<br /><br />
TAACCGCGATTTACGCGAAGAGGTGCTGGCAGGGCGATTCCGCGCCGATTTGTTTCATCGCCTGAGCGTG<br /><br />
TTTCCACTTTCGGTGCCGCCGCTGCGTGAGCGGGGCGATGATGTCATTCTGCTGGCGGGGTATTTCTGCG<br /><br />
AGCAGTGTCGTTTGCGGCAGGGGCTCTCCCGCGTGGTATTAAGTGCCGGAGCGCGAAATTTACTGCAACA<br /><br />
CTACAGTTTTCCGGGAAACGTGCGCGAACTGGAACATGCTATTCATCGGGCGGTAGTTCTGGCGAGAGCC<br /><br />
ACCCGCAGCGGCGATGAAGTGATTCTTGAGGCGCAACATTTTGCTTTTCCTGAGGTGACGTTGCCGACGC<br /><br />
CAGAAGTGGCGGCGGTGCCCGTTGTTAAGCAAAACCTGCGTGAAGCGACAGAAGCGTTCCAGCGTGAAAC<br /><br />
TATTCGTCAGGCACTGGCACAAAATCATCACAACTGGGCTGCCTGCGCGCGGATGCTGGAAACCGACGTC<br /><br />
GCCAACCTGCATCGGCTGGCGAAACGTCTGGGATTGAAGGATTAA<br /><br />
</div><br />
<br />
<br />
To ensure that the endogenous NorR sequence can be directly converted into a biobrick part without any modification, the sequence was checked with Webcutter 2.0 (http://rna.lundberg.gu.se/cutter2/) for any presence of EcoRI / NotI / XbaI / SpeI / PstI restriction sites. Since none of these restriction sites was found in the endogenouse NorR genome, direct PCR extraction can be performed. PCR primers were designed using NCBI’s PrimerBlast.<br />
<br />
<br />
'''The primer sequences for NorR Extraction''' :<br />
<br />
''Forward Primer (27 bases)'': 5’-TTAATCCTTCAATCCCAGACGTTTCGC-3’<br />
<br />
''Reverse Primer (26 bases)'':5’- ATGAGTTTTTCCGTTGATGTGCTGGC-3’<br />
<br />
<br />
Since NorR sequence is on the anti-sense strand of E.coli genome, the biobrick prefix has to be added to the reverse primer, rather than forward primer, and vice-versa.<br />
<br />
'''The primer sequences for Biobrick conversion''' :<br />
<br />
''Addition of Preffix to Reverse primer – Forward Primer (50 bases)'' :<br />
<br />
5’-GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ATGAGTTTTTCCGTTGATGT-3’<br />
<br />
<br />
''Addition of Suffix to Forward primer – Reverse Primer (50 bases)'' :<br />
<br />
5’-GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTAATCCTTCAATCCCAGACG-3’<br />
<br />
<br />
The oligonucleotides were synthesized by one of our team’s sponsor, 1st Base Holdings, Singapore.<br />
<br />
<br />
<u>'''Ethanol Precipitation of E.coli Chromosomal DNA'''</u><br />
<br />
Invitrogen’s TOP10 cells were first grown for 16 hours in 5 ml LB media at 37 deg C, 250 rpm before being centrifuge at 4000 rpm for 10 mins. The supernatant was decanted, and the cells were lysed using QIAGEN miniprep kit’s P1, P2 and N3 buffers. Since QIAquick spin columns can only immobilized DNA strands up to 10kb, hence, it was not used for the extraction of E.coli chromosomal DNA. Instead, ethanol precipitation was performed.<br />
<br />
<br />
'''Procedures of ethanol precipitation''' :<br />
<br />
# 1/10 vol of 3M Sodium Acetate (pH 5.2) was added to the supernatant containing E.coli DNA, P1, P2 and N3 buffers. <br />
# 3 vol. of ice-cold absolute ethanol (stored at -20 deg C) was then added to the mixture. <br />
# Incubate the sample on ice for 30 mins before spinning the sample at 13,000 rpm for 15 min. <br />
# Decant the supernatant, and add 1 ml of 70 % ethanol was added to wash any salts present. <br />
# Centrifuge for another 10 min at 13,000 rpm before decanting the supernatant. Air-dry the sample for 15 min.<br />
# Add de-ionized water or Tris-HCl buffer (pH 7.5) to re-suspend the DNA precipitate.<br />
<br />
<br />
'''PCR extraction of NorR & Biobrick conversion'''<br />
<br />
PCR reaction was performed in the reaction vol of 50 µl containing PCR supermix (High Fidelity) from Invitrogen, 0.2 µM of each primer (Forward / Reverse), and 3 µg of E.coli chromosomal DNA. The cycling conditions were as followed: 30 sec at 94 °C followed by 30 cycles of 30 sec at 94°C, 30 sec at 58 °C, 2 min at 72 °C and a final extension of 10 min at 72 °C.<br />
<br />
<br />
The PCR products were ran in 1% gel for 40 min at 120V before subjecting to gel extraction using QIAGEN gel extraction kit. Addition of prefix and suffix was performed on the purified NorR DNA using the same PCR conditions mentioned above.<br />
. <br />
<br />
<br />
[[Image:NTUnorrbiobrick.jpg|651px]]<br />
<br />
'''1% agarose gel photo verifying the success of the PCR extraction and biobrick conversion'''<br />
<br />
<br />
<br />
'''Ligation to form J23119-B0034-NorR-B0015'''<br />
<br />
Biobrick NorR was first digested with XbaI and PstI in order to be ligated to B0034. The ligation order was as follows: <br />
<br />
# B0034 + NorR<br />
# B0034-NorR + B0015<br />
# J23119 + B0034-NorR-B0015<br />
<br />
<br />
The final J23119-B0034-NorR-B0015 is in pSB1A2 backbone. The displayed gel photos confirmed the presence of the successfully ligated construct of B0034-NorR-T (~1700bp) and J23119-B00340-NorR-B0015 (~1750 bp).<br />
<br />
<br />
[[Image:NTUnorrgel1.jpg|651px]]<br />
<br />
[[Image:NTUnorrgel2.jpg|651px]]<br />
<br />
<br />
<br />
<u>'''SDS PAGE of J23119-B0034-NorR-B0015'''</u><br />
<br />
The successful construct J23119-B0034-NorR-B0015 was ligated to pSB3K2 vector, and was later introduced into Invitrogen’s TOP10 cells. Transformed cells were grown for 16 hrs, at 37 deg C, 250 rpm, before undergoing cell lysis for SDS PAGE.<br />
<br />
The SDS PAGE results was reflected in the gel photo. Production of 55 kDa NorR protein had been confirmed by the result.<br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUnorrsds.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
<br />
'''55 kDa NorR band has been highlighted by the arrow.'''<br />
<br class="clear" /><br />
<br />
<br />
<u>'''NorR Characterization via SDS PAGE'''</u><br />
<br />
Since the sole purpose of J23119-B0034-NorR-B0015 (BBa_K256007) is to produce NorR, we studied physicochemical factors that might affect the production of the protein. The transformed cells were incubated at 3 different environmental temperatures (i.e. 30, 37 and 42°C).<br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUnorrsds2.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
'''SDS PAGE results for different temperature'''<br class="clear" /><br />
<br />
It has been observed that at elevated temperature, i.e. 42°C, production of NorR had decreased as shown by the diminished intensity (see lane '42'). The production of NorR at 30°C and 37°C were comparable.<br />
<br />
'''Conclusion'''<br class="clear" /><br />
<br />
Our NorR producing construct had been verified to be successful and shown to be working well.<br />
<br />
== Literature / References ==<br />
<br />
<div class="ref"><br />
# M.I. Hutchings, N. Mandhana, and S. Spiro, “The NorR protein of Escherichia coli activates expression of the Flavorbredoxin gene NorV in response to reactive nitrogen species,” Journal of bacteriology, vol. 184, (no. 16), pp. 4640 - 4643, 2002.<br />
# N.P. Tucker, B.D. Autreaux, S. Spiro, and R. Dixon, “Mechanism of transcriptional regulation by Escherichia Coli nitric oxide sensor NorR,” Biochemical Society Transactions, vol. 34, (no. 1), pp. 191 - 194, 2006.<br />
# T.J.M. Anderson, “Nitric Oxide, Atherosclerosis and clinical relevance of endothelial dysfunction,” Heart Failure Reviews, vol. 8, pp. 71 - 86, 2003.<br />
# S.Spiro, “Nitric oxide-sensing mechanisms in Escherichia coli,” Biochemical Society Transactions, vol. 34, (no. 1), pp. 200 - 202, 2006.<br />
# N.P. Tucker, B. D’Autre´aux, D.J. Studholme, S. Spiro, and R. Dixon, “DNA Binding Activity of the Escherichia coli Nitric Oxide Sensor NorR Suggests a Conserved Target Sequence in Diverse Proteobacteria,” Journal of Bacteriology, vol. 186, (no. 19), pp. 6656–6660, 2004.<br />
# Kelly et al. (2009). "Measuring the activity of Biobrick promoters using an in vivo reference standard." Journal of Biological Engineering 3(4).<br />
</div><br />
<br />
Please proceed [[Team:NTU-Singapore/Project/References | here]] to view our full list of references.<br />
<br />
<br />
<br />
</div></div><br />
<br />
{{Template:NTUfootalt}}</div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Project/WetlabTeam:NTU-Singapore/Project/Wetlab2009-10-22T02:34:09Z<p>Sjee: /* Characterization of NorR */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntuproject" class="grid_16"><br />
<span class="hidden">Welcome to the project page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">Hard at work!</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Project | <span class="selflink">pLaq''U''<span class="sup">e</span> Out!</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><div class="wrap_3 suffix_1" id="submenu"><br />
<div class="subtitle contrast grid_3 textright"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu textright"><br />
[[Team:NTU-Singapore/Project | '''p'''Laq''U''<span class="sup">e</span> '''Out''!''''']]<br />
[[Team:NTU-Singapore/Project/Approach | Research Approach]]<br />
[[Team:NTU-Singapore/Project/Prototype/Sense | Sensing Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Degrade | Degradation Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Image | Imaging Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Wetlab | Wetlab Highlights]]<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore Parts Submitted]<br />
[[Team:NTU-Singapore/Project/References | References]]<br />
</div></div><br />
<br />
<div class="grid_11 suffix_1 omega"><br />
<span class="title">Conclusive <span class="bold">Results</span></span><br class="clear" /><br />
<br />
<br />
<br />
<div id="tock"> <br />
<div class="spiffyfg"><br />
__TOC__<br />
</div><html><br />
<b class="spiffy"><br />
<b class="spiffy5"></b><br />
<b class="spiffy4"></b><br />
<b class="spiffy3"></b><br />
<b class="spiffy2"><b></b></b><br />
<b class="spiffy1"><b></b></b></b><br />
</html></div><br />
<br />
<br />
<br />
'''Our Working Constructs!!'''<br />
<br />
<br />
* '''J23119-B0034-NorR-B0015''', is a system construct, in that it was intended for our system to feature this as a functional part.<br />
* '''J23119-B0034-GFP-B0015''', is a characterization construct to characterize the modular function of the J23119 promoter in the transcription of NorR.<br />
* '''Lac(R0010)-B0034-CHE-B0015''', is also a test construct to only test and characterize the enzymatic activity of CHE.<br />
* '''J23119-B0034-IFP-B0015-J23119-B0034-HO1(I15008)-B0015''', is a test construct to only test the reporting ability of IFP.<br />
<br />
<br class="clear" /><br />
<br />
<br />
<br />
<br />
<br />
= <span class="title">NorR System Construct</span> =<br />
<br />
NorR is an important NO sensor that triggers the transcription at pNO. Thus, we want an NorR producing construct to improve on the sensitivity of pNO to optimise its efficiency at physiological levels.<br />
<br />
<br />
== Verification of construct ==<br />
<br />
<div class="grid_5 alpha suffix_1"><br />
'''Double Digestion'''<br />
<br />
<br />
[[Image:NTUnorrgel2.jpg|385px]]<br />
<br />
<center><br />
'''Successful construct verification''' of J23119-B0034-NorR-B0015<br />
<br />
''This indicates the presence of the construct.''<br />
</center><br />
<br />
</div><br />
<div class="grid_5 omega"><br />
'''SDS PAGE'''<br />
<br />
[[Image:SDS page for NorR on 16 Sep 09-edited.jpg|285px]]<br />
<br />
<br />
<center>'''Successful production of NorR'''</center><br />
<br />
</div><br />
<br class="clear" /><br />
<br />
<br />
==== Characterization of NorR ====<br />
<br />
<br />
[[Image:NorR-temp.jpg|400px|center]]<br />
<br />
<center>'''SDS PAGE results for NorR expressed at different inoculation temperatures'''</center><br />
<br />
<br />
Since the sole purpose of J23119-B0034-NorR-B0015 (<partinfo>K256007</partinfo>) is to produce NorR, we shall dwell into the factors that might affect the production of the protein. The transformed cells were incubated at 3 different environmental temperatures (30 / 37 / 42°C).<br />
<br />
'''SDS PAGE characterization was carried out''' (''top right'').<br />
<br />
<br />
It has been observed that at elevated temperature, i.e. 42°C, production of NorR had decreased as shown by the diminished intensity (see 2nd lane). The production of NorR at 30°C and 37°C carried no significant difference.<br />
<br />
== <span class="title">Characterization of J23119</span> ==<br />
<br />
'''Since J23119 (<partinfo>K256003</partinfo>) was used as the constitutive promoter for NorR producing construct, it is necessary for us to understand its modular function and how it would affect NorR production.'''<br />
<br />
<br />
[[Image:NTU119temp.png|651px]]<br />
<br />
<center>'''Characterization of J23119 w.r.t Temp (deg C)'''</center><br />
<br />
<br />
Preliminary characterisation of J23119 showed that the activity of the promoter to be the strongest at 25°C and weakest at 37°C with 30°C being something of an intermediate. Activity of the J23119 was independent of time. Noteworthy was that there was a drastic drop in activity of the J23119 promoter at 16min, 37°C. <br />
<br />
<br />
<br />
[[Image:NTU119culture.png|651px]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in different medium'''</center><br />
<br />
<br />
It shows that the supplemented M9 medium is the ideal choice for the characterization of the J23119 promoter. M9 is most likely to be the ideal medium for characterisation of other promoters in general.<br />
<br />
<br />
<br />
[[Image:NTU119backbone.png|651px|]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in steady state (M9)'''</center><br />
<br />
<br />
Vector backbone did not seem to have much of an effect on the strengths of J23119, although pSB1A2 has a slight positive effect on the activity of the J23119.<br />
<br />
<br />
<br />
[[Image:NTU119diffprom.png|651px]]<br />
<br />
<center>'''Comparison of J23119 with other promoters'''</center><br />
<br />
<br />
Based on our preliminary characterization results, it appeared that J23101 produced a much stronger signal than J23119 and pTet. This was quite surprising because J23119 promoter is supposed to be stronger then the J23101.<br />
<br />
<br />
<br />
[[Image:NTU119diffchassis.png|651px]]<br />
<br />
<center>'''Characterization of J23119 in different chassis'''</center><br />
<br />
<br />
J23119 performance appeared to be the best in Origami B.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
= <span class="title">Expression of working Cholesteryl Esterase</span> =<br />
<br />
To examine the enzymatic activity of cholesteryl esterase, a test construct, '''pLac (R0010)-B0034-CHE-B0015''' (<partinfo>K256028</partinfo>) was synthesized.<br />
<br />
CHE production was induced by l0mM lactose. The cells were sonicated, and the cell lysate containing CHE was characterized using Amplex® Red Cholesterol Assay Kit. The characterization results is shown below.<br />
<br />
<br />
[[Image:NTUcheresult.png|651px]]<br />
<br />
<center>'''Cholesterol Assay with CHE Construct'''</center><br />
From the graph, the cell lysate containing CHE had achieved higher fluorescence readings than the negative control. The increase in fluorescence reading is due to enzyme-coupled reaction that detects free cholesterol concentration. Hence, we have proven that CHE had indeed been produced from this construct and had been working to our expectation.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
= <span class="title">Expression of Infrared Fluoresence Protein with infrared signal</span> =<br />
<br />
The purpose of creating a constitutively expressed Heme oxygenase and Infrared protein (IFP) is to characterize the reporting ability of IFP. The exact construct used was '''J23119-RBS-IFP1.4-Term-J23119-RBS-HO1-Term'''. <br />
<br />
<br />
[[Image:NTUifpsignal.png|651px]]<br />
<br />
<br />
The cell culture were irradiated with a 660nm laser diode for excitation. A spectrometer was used to detect the infrared emission at circa 708nm. Our emission peak (''purple'') closely follows the shape profile of our positive control, IFP1.4 from the Tsien Lab vector. On top of that, our signal is even slightly higher than the Tsien Lab signal (''green''). Future work is recommended on optimising the variables that affect the reproducibility of amplitude.<br />
</div></div><br />
<br />
{{Template:NTUfootalt}}</div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Project/WetlabTeam:NTU-Singapore/Project/Wetlab2009-10-22T02:33:28Z<p>Sjee: /* Verification of construct */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntuproject" class="grid_16"><br />
<span class="hidden">Welcome to the project page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">Hard at work!</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Project | <span class="selflink">pLaq''U''<span class="sup">e</span> Out!</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><div class="wrap_3 suffix_1" id="submenu"><br />
<div class="subtitle contrast grid_3 textright"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu textright"><br />
[[Team:NTU-Singapore/Project | '''p'''Laq''U''<span class="sup">e</span> '''Out''!''''']]<br />
[[Team:NTU-Singapore/Project/Approach | Research Approach]]<br />
[[Team:NTU-Singapore/Project/Prototype/Sense | Sensing Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Degrade | Degradation Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Image | Imaging Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Wetlab | Wetlab Highlights]]<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore Parts Submitted]<br />
[[Team:NTU-Singapore/Project/References | References]]<br />
</div></div><br />
<br />
<div class="grid_11 suffix_1 omega"><br />
<span class="title">Conclusive <span class="bold">Results</span></span><br class="clear" /><br />
<br />
<br />
<br />
<div id="tock"> <br />
<div class="spiffyfg"><br />
__TOC__<br />
</div><html><br />
<b class="spiffy"><br />
<b class="spiffy5"></b><br />
<b class="spiffy4"></b><br />
<b class="spiffy3"></b><br />
<b class="spiffy2"><b></b></b><br />
<b class="spiffy1"><b></b></b></b><br />
</html></div><br />
<br />
<br />
<br />
'''Our Working Constructs!!'''<br />
<br />
<br />
* '''J23119-B0034-NorR-B0015''', is a system construct, in that it was intended for our system to feature this as a functional part.<br />
* '''J23119-B0034-GFP-B0015''', is a characterization construct to characterize the modular function of the J23119 promoter in the transcription of NorR.<br />
* '''Lac(R0010)-B0034-CHE-B0015''', is also a test construct to only test and characterize the enzymatic activity of CHE.<br />
* '''J23119-B0034-IFP-B0015-J23119-B0034-HO1(I15008)-B0015''', is a test construct to only test the reporting ability of IFP.<br />
<br />
<br class="clear" /><br />
<br />
<br />
<br />
<br />
<br />
= <span class="title">NorR System Construct</span> =<br />
<br />
NorR is an important NO sensor that triggers the transcription at pNO. Thus, we want an NorR producing construct to improve on the sensitivity of pNO to optimise its efficiency at physiological levels.<br />
<br />
<br />
== Verification of construct ==<br />
<br />
<div class="grid_5 alpha suffix_1"><br />
'''Double Digestion'''<br />
<br />
<br />
[[Image:NTUnorrgel2.jpg|385px]]<br />
<br />
<center><br />
'''Successful construct verification''' of J23119-B0034-NorR-B0015<br />
<br />
''This indicates the presence of the construct.''<br />
</center><br />
<br />
</div><br />
<div class="grid_5 omega"><br />
'''SDS PAGE'''<br />
<br />
[[Image:SDS page for NorR on 16 Sep 09-edited.jpg|285px]]<br />
<br />
<br />
<center>'''Successful production of NorR'''</center><br />
<br />
</div><br />
<br class="clear" /><br />
<br />
<br />
==== Characterization of NorR ====<br />
<br />
<br />
[[Image:NTUnorrsds2.jpg|400px|center]]<br />
<br />
<center>'''SDS PAGE results for NorR expressed at different inoculation temperatures'''</center><br />
<br />
<br />
Since the sole purpose of J23119-B0034-NorR-B0015 (<partinfo>K256007</partinfo>) is to produce NorR, we shall dwell into the factors that might affect the production of the protein. The transformed cells were incubated at 3 different environmental temperatures (30 / 37 / 42°C).<br />
<br />
'''SDS PAGE characterization was carried out''' (''top right'').<br />
<br />
<br />
It has been observed that at elevated temperature, i.e. 42°C, production of NorR had decreased as shown by the diminished intensity (see 2nd lane). The production of NorR at 30°C and 37°C carried no significant difference.<br />
<br />
== <span class="title">Characterization of J23119</span> ==<br />
<br />
'''Since J23119 (<partinfo>K256003</partinfo>) was used as the constitutive promoter for NorR producing construct, it is necessary for us to understand its modular function and how it would affect NorR production.'''<br />
<br />
<br />
[[Image:NTU119temp.png|651px]]<br />
<br />
<center>'''Characterization of J23119 w.r.t Temp (deg C)'''</center><br />
<br />
<br />
Preliminary characterisation of J23119 showed that the activity of the promoter to be the strongest at 25°C and weakest at 37°C with 30°C being something of an intermediate. Activity of the J23119 was independent of time. Noteworthy was that there was a drastic drop in activity of the J23119 promoter at 16min, 37°C. <br />
<br />
<br />
<br />
[[Image:NTU119culture.png|651px]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in different medium'''</center><br />
<br />
<br />
It shows that the supplemented M9 medium is the ideal choice for the characterization of the J23119 promoter. M9 is most likely to be the ideal medium for characterisation of other promoters in general.<br />
<br />
<br />
<br />
[[Image:NTU119backbone.png|651px|]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in steady state (M9)'''</center><br />
<br />
<br />
Vector backbone did not seem to have much of an effect on the strengths of J23119, although pSB1A2 has a slight positive effect on the activity of the J23119.<br />
<br />
<br />
<br />
[[Image:NTU119diffprom.png|651px]]<br />
<br />
<center>'''Comparison of J23119 with other promoters'''</center><br />
<br />
<br />
Based on our preliminary characterization results, it appeared that J23101 produced a much stronger signal than J23119 and pTet. This was quite surprising because J23119 promoter is supposed to be stronger then the J23101.<br />
<br />
<br />
<br />
[[Image:NTU119diffchassis.png|651px]]<br />
<br />
<center>'''Characterization of J23119 in different chassis'''</center><br />
<br />
<br />
J23119 performance appeared to be the best in Origami B.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
= <span class="title">Expression of working Cholesteryl Esterase</span> =<br />
<br />
To examine the enzymatic activity of cholesteryl esterase, a test construct, '''pLac (R0010)-B0034-CHE-B0015''' (<partinfo>K256028</partinfo>) was synthesized.<br />
<br />
CHE production was induced by l0mM lactose. The cells were sonicated, and the cell lysate containing CHE was characterized using Amplex® Red Cholesterol Assay Kit. The characterization results is shown below.<br />
<br />
<br />
[[Image:NTUcheresult.png|651px]]<br />
<br />
<center>'''Cholesterol Assay with CHE Construct'''</center><br />
From the graph, the cell lysate containing CHE had achieved higher fluorescence readings than the negative control. The increase in fluorescence reading is due to enzyme-coupled reaction that detects free cholesterol concentration. Hence, we have proven that CHE had indeed been produced from this construct and had been working to our expectation.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
= <span class="title">Expression of Infrared Fluoresence Protein with infrared signal</span> =<br />
<br />
The purpose of creating a constitutively expressed Heme oxygenase and Infrared protein (IFP) is to characterize the reporting ability of IFP. The exact construct used was '''J23119-RBS-IFP1.4-Term-J23119-RBS-HO1-Term'''. <br />
<br />
<br />
[[Image:NTUifpsignal.png|651px]]<br />
<br />
<br />
The cell culture were irradiated with a 660nm laser diode for excitation. A spectrometer was used to detect the infrared emission at circa 708nm. Our emission peak (''purple'') closely follows the shape profile of our positive control, IFP1.4 from the Tsien Lab vector. On top of that, our signal is even slightly higher than the Tsien Lab signal (''green''). Future work is recommended on optimising the variables that affect the reproducibility of amplitude.<br />
</div></div><br />
<br />
{{Template:NTUfootalt}}</div>Sjeehttp://2009.igem.org/File:NorR-temp.jpgFile:NorR-temp.jpg2009-10-22T02:33:15Z<p>Sjee: </p>
<hr />
<div></div>Sjeehttp://2009.igem.org/File:SDS_page_for_NorR_on_16_Sep_09-edited.jpgFile:SDS page for NorR on 16 Sep 09-edited.jpg2009-10-22T02:31:30Z<p>Sjee: </p>
<hr />
<div></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Project/WetlabTeam:NTU-Singapore/Project/Wetlab2009-10-22T01:59:33Z<p>Sjee: /* Expression of working Cholesteryl Esterase */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntuproject" class="grid_16"><br />
<span class="hidden">Welcome to the project page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">Hard at work!</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Project | <span class="selflink">pLaq''U''<span class="sup">e</span> Out!</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><div class="wrap_3 suffix_1" id="submenu"><br />
<div class="subtitle contrast grid_3 textright"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu textright"><br />
[[Team:NTU-Singapore/Project | '''p'''Laq''U''<span class="sup">e</span> '''Out''!''''']]<br />
[[Team:NTU-Singapore/Project/Approach | Research Approach]]<br />
[[Team:NTU-Singapore/Project/Prototype/Sense | Sensing Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Degrade | Degradation Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Image | Imaging Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Wetlab | Wetlab Highlights]]<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore Parts Submitted]<br />
[[Team:NTU-Singapore/Project/References | References]]<br />
</div></div><br />
<br />
<div class="grid_11 suffix_1 omega"><br />
<span class="title">Conclusive <span class="bold">Results</span></span><br class="clear" /><br />
<br />
<br />
== Our working constructs! ==<br />
<br />
* '''J23119-B0034-NorR-B0015''', is a system construct, in that it was intended for our system to feature this as a functional part.<br />
* '''J23119-B0034-GFP-B0015''', is a characterization construct to characterize the modular function of the J23119 promoter in the transcription of NorR.<br />
* '''Lac(R0010)-B0034-CHE-B0015''', is also a test construct to only test and characterize the enzymatic activity of CHE.<br />
* '''J23119-B0034-IFP-B0015-J23119-B0034-HO1(I15008)-B0015''', is a test construct to only test the reporting ability of IFP.<br />
<br />
<br />
=== <span class="special">NorR System Construct Characterization</span> ===<br />
<br />
NorR is an important NO sensor that triggers the transcription at pNO. Thus, we want an NorR producing construct to improve on the sensitivity of pNO.<br />
<br />
<br />
<br />
==== Double Digest verification ====<br />
<br />
<div class="grid_7 alpha">[[Image:NTUnorrgel2.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
'''Successful construct verification''' of J23119-B0034-NorR-B0015 by Double Digestion!<br />
<br class="clear" /><br />
<br />
<div class="grid_5 alpha suffix_1"><br />
==== SDS PAGE verification of NorR ====<br />
<br />
<br />
[[Image:NTUnorrsds.jpg|285px]]<br />
<br />
<center>'''Successful expression of NorR'''</center><br />
<br />
</div><br />
<br />
<div class="grid_5 omega"><br />
==== SDS PAGE characterization of NorR ====<br />
<br />
<br />
[[Image:NTUnorrsds2.jpg|285px]]<br />
<br />
<center>'''SDS PAGE results for NorR expressed at different inoculation temperatures'''</center><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
Since the sole purpose of J23119-B0034-NorR-B0015 (<partinfo>K256007</partinfo>) is to produce NorR, we shall dwell into the factors that might affect the production of the protein. The transformed cells were incubated at 3 different environmental temperatures (30 / 37 / 42°C).<br />
<br />
'''SDS PAGE characterization was carried out''' (''top right'').<br />
<br />
<br />
It has been observed that at elevated temperature, i.e. 42°C, production of NorR had decreased as shown by the diminished intensity (see 2nd lane). The production of NorR at 30°C and 37°C carried no significant difference.<br />
<br />
<br />
<br />
=== <span class="special">Characterization of J23119</span> ===<br />
<br />
Since J23119 (<partinfo>K256003</partinfo>) was used as the constitutive promoter for NorR producing construct, it is necessary for us to understand its modular function and how it would affect NorR production.<br />
<br />
<br />
[[Image:NTU119temp.png|651px]]<br />
<br />
<center>'''Characterization of J23119 w.r.t Temp (deg C)'''</center><br />
<br />
<br />
Preliminary characterisation of J23119 showed that the activity of the promoter to be the strongest at 25°C and weakest at 37°C with 30°C being something of an intermediate. Activity of the J23119 was independent of time. Noteworthy was that there was a drastic drop in activity of the J23119 promoter at 16min, 37°C. <br />
<br />
<br />
<br />
[[Image:NTU119culture.png|651px]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in different medium'''</center><br />
<br />
<br />
It shows that the supplemented M9 medium is the ideal choice for the characterization of the J23119 promoter. M9 is most likely to be the ideal medium for characterisation of other promoters in general.<br />
<br />
<br />
<br />
[[Image:NTU119backbone.png|651px|]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in steady state (M9)'''</center><br />
<br />
<br />
Vector backbone did not seem to have much of an effect on the strengths of J23119, although pSB1A2 has a slight positive effect on the activity of the J23119.<br />
<br />
<br />
<br />
[[Image:NTU119diffprom.png|651px]]<br />
<br />
<center>'''Comparison of J23119 with other promoters'''</center><br />
<br />
<br />
Based on our preliminary characterization results, it appeared that J23101 produced a much stronger signal than J23119 and pTet. This was quite surprising because J23119 promoter is supposed to be stronger then the J23101.<br />
<br />
<br />
<br />
[[Image:NTU119diffchassis.png|651px]]<br />
<br />
<center>'''Characterization of J23119 in different chassis'''</center><br />
<br />
<br />
J23119 performance appeared to be the best in Origami B.<br />
<br />
<br />
<br />
== <span class="special">Expression of working Cholesteryl Esterase</span> ==<br />
<br />
To examine the enzymatic activity of cholesteryl esterase, a test construct, '''pLac (R0010)-B0034-CHE-B0015''' (<partinfo>K256028</partinfo>) was synthesized.<br />
<br />
CHE production was induced by l0mM lactose. The cells were sonicated, and the cell lysate containing CHE was characterized using Amplex® Red Cholesterol Assay Kit. The characterization results is shown below.<br />
<br />
<br />
[[Image:NTUcheresult.png|651px]]<br />
<br />
<center>'''Cholesterol Assay with CHE Construct'''</center><br />
From the graph, the cell lysate containing CHE had achieved higher fluorescence readings than the negative control. The increase in fluorescence reading is due to enzyme-coupled reaction that detects free cholesterol concentration. Hence, we have proven that CHE had indeed been produced from this construct and had been working to our expectation.<br />
<br />
== <span class="special">Expression of Infrared Fluoresence Protein with infrared signal</span> ==<br />
<br />
The purpose of creating a constitutively expressed Heme oxygenase and Infrared protein (IFP) is to characterize the reporting ability of IFP. The exact construct used was '''J23119-RBS-IFP1.4-Term-J23119-RBS-HO1-Term'''. <br />
<br />
<br />
[[Image:NTUifpsignal.png|651px]]<br />
<br />
<br />
The cell culture were irradiated with a 660nm laser diode for excitation. A spectrometer was used to detect the infrared emission at circa 708nm. Our emission peak (''purple'') closely follows the shape profile of our positive control, IFP1.4 from the Tsien Lab vector. On top of that, our signal is even slightly higher than the Tsien Lab signal (''green''). Future work is recommended on optimising the variables that affect the reproducibility of amplitude.<br />
</div></div><br />
<br />
{{Template:NTUfootalt}}</div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/BrainstormingTeam:NTU-Singapore/Notebook/Brainstorming2009-10-22T01:38:49Z<p>Sjee: </p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Brainstorming <span class="bold">Ideas</span></span><br />
<br />
<br />
== Health & medicine ==<br />
<br />
* Create an insulin delivery system which response to low glucose level or time controlled release<br />
<br />
<br />
* Vitamin synthesis?<br />
<br />
<br />
* Hinder carcinogenics <br />
** Maslinic acid (olive skin)-tritrepenoid compound <br />
** Can we study anti-tumoral and apoptotic effect of this compound? <br />
** E coli to interfere in the carcinogenic pathways <br />
** Mimic the maslinic effect to the carcinogenic cells? <br />
** Surface markers? <br />
<br />
<br />
* Trap parasites in host cells by disabling the protease <br />
** Can we remove the trap parasites? <br />
** Terminate parasites? <br />
<br />
<br />
* Genetic modified bacteria that have anticoagulant properties. <br />
<br />
<br />
* Eczema relief<br />
<br />
<br />
* Bacteria to treat gangrene <br />
** To eat up dead tissues <br />
** Bacteria to deliver growth factors <br />
<br />
<br />
* Collagen producing bacteria <br />
<br />
<br />
* Bacteria that absorbs cholesterol <br />
<br />
<br />
* Constipation pill <br />
<br />
<br />
* Synthesis specific growth factors <br />
<br />
<br />
* Bacteria that produce PDGF <br />
<br />
<br />
* Using bacteria to breakdown blockage in blood vessels <br />
<br />
<br />
* Malaria vaccine <br />
** Forcibly expresses a certain gene and create a vaccine against it <br />
** Proof of concept<br />
<br />
<br />
* Cancer treatment - colon cancer(CA marker) <br />
** Fusion protein to signal the expression of perforin (e coli as NKC) <br />
<br />
<br />
* Streptococcus vaccine <br />
<br />
<br />
* p-Falciparum gene expression stabilization for malaria <br />
<br />
<br />
* Intestinal vaccine delivery<br />
<br />
<br />
* Bacteria to target the larvae<br />
<br />
<br />
*To separate Tamoxifen (possibly a chiral drug) by uptake the drugs into modified E Coli and bind it to the receptor inside the bacteria.<br />
<br />
<br />
<br />
== Biosensor ==<br />
<br />
* Biosensor that sense the present of allergen and release drugs to prevent allergenic response <br />
<br />
<br />
* Mimic allergy response-to determine allergen? <br />
<br />
<br />
* Fingerprint detection <br />
<br />
<br />
* Can cells response to magnetic fields? <br />
** Bird GPS ?? <br />
** Magnetic field biosensor <br />
<br />
<br />
* Biosensor to detect cancer <br />
<br />
<br />
<br />
== Environmental ==<br />
<br />
* E coli to detect toxins in food and flu strain in animals. <br />
<br />
<br />
* Biomask<br />
** For absorption<br />
<br />
<br />
* Create a water purifying system that recognize and trap toxic <br />
** to uptake salt and others- sea water purification <br />
<br />
<br />
* Bacteria producing water for the use of photosynthesis so that plants can grow well in dry area <br />
** Is it possible to construct water using certain metabolism pathway? <br />
<br />
<br />
<br />
== Signalling ==<br />
<br />
* Multi-color display according to inputs <br />
** to improve signal inputs <br />
* DNA methylation as memory storage <br />
* suffocate the cells <br />
* baccine <br />
* To construct guiding E Coli that guide pathogenic bacteria to a region of toxin/UV light.<br />
<br />
<br />
==Application ==<br />
<br />
* bacterial barometer<br />
* fill up crack <br />
* dust repel <br />
* microscopic spring-using spirobac <br />
* To construct a Sound sensing bacteria<br />
<br />
<br />
==Modeling==<br />
<br />
* modeling the trend of evolution of flu viruses<br />
<br />
<br />
==Bioproduction==<br />
<br />
* Methanol in E-coli<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Project/Prototype/ImageTeam:NTU-Singapore/Project/Prototype/Image2009-10-22T01:23:49Z<p>Sjee: /* Device Construction */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntuproject" class="grid_16"><br />
<span class="hidden">Welcome to the project page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">Hard at work!</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Project | <span class="selflink">pLaq''U''<span class="sup">e</span> Out!</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><div class="wrap_3 suffix_1" id="submenu"><br />
<div class="subtitle contrast grid_3 textright"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu textright"><br />
[[Team:NTU-Singapore/Project | '''p'''Laq''U''<span class="sup">e</span> '''Out''!''''']]<br />
[[Team:NTU-Singapore/Project/Approach | Research Approach]]<br />
[[Team:NTU-Singapore/Project/Prototype/Sense | Sensing Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Degrade | Degradation Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Image | Imaging Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Wetlab | Wetlab Highlights]]<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore Parts Submitted]<br />
[[Team:NTU-Singapore/Project/References | References]]<br />
</div></div><br />
<br />
<div class="grid_11 suffix_1 omega"><br />
<span class="title">Imaging <span class="bold">Device</span></span><br class="clear" /><br />
<br />
<br />
<div id="tock"> <br />
<div class="spiffyfg"><br />
__TOC__<br />
</div><html><br />
<b class="spiffy"><br />
<b class="spiffy5"></b><br />
<b class="spiffy4"></b><br />
<b class="spiffy3"></b><br />
<b class="spiffy2"><b></b></b><br />
<b class="spiffy1"><b></b></b></b><br />
</html></div><br />
<br />
<br />
The '''Imaging device''' is also one of our featured parts.<br />
<br />
As we have elaborated earlier in the [[Team:NTU-Singapore/Project/Prototype | Prototype Design]] section, the '''device''' consists of mainly pTet regulated expression of IFP & HO-1, which in turn generate a unique fluorescence signal in the infrared spectrum!<br />
<br />
<br />
'''We are extremely pleased to report that we have successfully converted this novel reporter protein into a standard Biobrick!''' Let us now see how exactly the device works.<br class="clear" /><br />
<br />
== Abstract ==<br />
<br />
As part of the imaging capability we want for our system, we have eschewed traditional reporter proteins like GFP or YFP and have identified a novel reporter protein, infrared fluorescent protein (IFP). A recent work by Xiaokun et al. (Tsien Lab, UCSD) has shown successful mammalian expression of infrared fluorescent protein engineered from a bacterial phytochrome. Xiaokun et al. have also expressed the infrared fluorescent protein in ''E. coli'' strain TOP10.<br />
<br />
<br />
IFP is preferred for our system over other fluorescent proteins such as GFP or YFP because it has unique excitation and emission maxima, which fit so well with the wavelength range of typical ''in vivo'' optical imaging in deep tissues of animals. At wavelength range between 650 and 900 nm, the absorbance by haemoglobin, water and lipids, as well as light-scattering are minimal.<br />
<br />
'''Therefore, IFP is particularly suitable for our ideal system as we desire to locate the atherosclerotic plaque site non-invasively.'''<br />
<br />
<br />
<br />
== Background ==<br />
<br />
Our '''p'''Laq''U''<span class="sup">e</span> Out! system must be capable of highlighting the atherosclerotic plaque site upon detection by the preceding sensing mechanism of nitric oxide sensing promoter (pNO). The first thing that came to our mind was the variety of known fluorescent proteins (FPs) such as GFP, RFP, YFP, CFP. However, since our ultimate environment for our '''p'''Laq''U''<span class="sup">e</span> Out! system is ''in vivo'', we envisioned an ideal system that can express a novel reporter protein with properties suitable for ''in vivo'' optical imaging. IFP was chosen as a potential candidate.<br />
<br />
<br />
The gene encoding IFP used in our expression system is essentially the gene for IFP1.4. Xiaokun et al. obtained IFP1.4 by saturation, random mutagenesis, and DNA shuffling of a gene encoding IFP1.0; and it was shown to be about four times brighter than IFP1.0.<br />
<br />
<br />
Overall, IFP has an excitation and emission maxima of 684 nm and 708 nm, respectively. The excitation and emission maxima for other fluorescent proteins have not exceeded 598 and 655 nm, respectively.<br />
<br />
<br />
<br />
=== Mechanism ===<br />
<br />
Infrared fluorescent protein is a monomeric protein engineered from a bacterial phytochrome of the species ''Deinococcus radiodurans''.<br />
<br />
<br />
This bacteriophytochrome incorporates biliverdin IXα (BV) as the chromophore. Biliverdin IXα is in fact a natural product of heme catabolism by the enzyme heme oxygenase-1 (HO-1). BV is essential because in a mouse experiment conducted by Xiaokun et al., BV has been shown to increase the infrared fluorescence to a maximal fivefold 1 hour after BV injection in the mouse with exogenously added BV.<br />
<br />
In a phone call made to Dr. Xiaokun Shu, we have also been told that BV helps to stabilize the infrared fluorescent protein. Hence, it is essential that we incorporate HO-1 into our system to generate biliverdin IXα.<br />
<br />
<br />
<br />
== Construct Design ==<br />
<br />
As you recall, our ideal system is designed to be in a T-helper cell chassis. However, for infrared fluorescent protein production purposes, we have used ''E. coli'' strain K12 as our model system. In order to realize the production system, we have incorporated two parts into the device: the genes encoding infrared fluorescent protein (IFP) and heme oxygenase-1 (HO-1). <br />
<br />
<br />
The '''Imaging Device''' is designed to function only in low [NO] conditions (i.e. in atherosclerotic plaque sites):<br />
<br />
[[Image:NTUifpprosys.png|center]]<br />
<br />
<br />
After TetR repression stops at plaque site with low [NO], both HO-1 & IFP are produced. The HO-1 catalyzes the conversion of haem to biliverdin, which then binds to IFP to allow generation of infrared signal. Once infrared signalling has begun, we can begin imaging for the plaque site using conventional imaging modality, and establish the location of the plaque site.<br />
<br />
<br />
'''Of course, at this stage we also foresee numerous other medical/non-medical uses for the IFP protein!'''<br />
<br />
<br />
<br />
=== Characteristic Equations ===<br />
<br />
'''Transcription of IFP / HO-1'''<br />
<br />
First, we can define the stoichiometric ratio of IFP to HO-1 transcribed.<br />
<br />
[[Image:NTUifpstoi.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
Next, we establish the deterministic repression-regulated transcription rate of IFP & HO-1.<br />
<br />
[[Image:NTUifptransc.png|x50px|left]]<br class="clear" /><br />
<br />
Where V<span class="sub">max</span> is max transcription rate & D<span class="sub">m</span> is the degradation rate of mRNA.<br />
<br />
<span class="grey">Again, bracketed term generates the fraction of pTet not bound with TetR i.e. actively promoting pTet sites.</span><br />
<br />
<br />
<br />
'''Translation of IFP / HO-1'''<br />
<br />
Deterministic first order ODE is used again to represent the translation of IFP / HO-1 protein. ''Same eqn with appropriate term and constants changed.''<br />
<br />
[[Image:NTUifptransl.png|x50px|left]]<br class="clear"><br />
<br />
Where K<span class="sub">tl</span> is the translation rate of mRNA & D<span class="sub">p</span> is the degradation rate of IFP / H0-1 protein.<br />
<br />
<br />
<br />
'''Infrared signal production'''<br />
<br />
Before the infrared signal can be produced, HO-1 must first convert haem to biliverdin.<br />
<br />
[[Image:NTUifpbil.png|x50px|left]]<br class="clear" /><br />
<br />
<br />
And then finally we can determine an equation for rate of infrared signal, (assuming that intensity of infrared signal is directly proportional to the amount of bound-IFP-biliverdin in the system).<br />
<br />
[[Image:NTUifpsig.png|x50px]] based on the ratio of bound / activated to total [IFP] available: [[Image:NTUifpact.png|x50px]]<br />
<br />
<br />
<br />
=== Modelling & Simulation ===<br />
<br />
We make the following assumptions:<br />
<br />
# Biological systems of transcription and translation are assumed to be linear and time-invariant.<br />
# Concentration of the haem is considered to be non-limiting.<br />
# There is no time lag between expression & activity.<br />
# Constant Degradation rates for mRNA as well as protein.<br />
# Intensity of infrared signal is directly proportional to [IFP-BV] complex.<br />
<br />
<br />
The following is our '''Sensing Device''' represented as a Simulink system. ''Please click on it for a larger view''.<br />
<br />
[[Image:NTUifpsys.png|651px|center]]<br />
<br />
<br />
<br />
== Device Construction ==<br />
<br />
Researchers at Tsien’s Lab graciously provided us the gene sequence of IFP1.4 optimized for ''E. coli'', and we had the gene encoding IFP1.4 synthesized by GeneArt in accordance with the standard stated by the Registry of Standard Biological Parts.<br />
<br />
'''Part: BBa_I15008''' from the Registry of Standard Biological Parts contains the HO-1 gene sequence of cyanobacteria, ''Synechocystis'', and therefore is extracted directly for our needs.<br />
<br />
<br />
In order to achieve the final construct as described in the device construction, the following Biobricks have been successfully constructed:<br />
<br />
# '''IFP''' <br />
# '''RBS-HO1'''<br />
# '''IFP-T'''<br />
# '''RBS-IFP'''<br />
# '''RBS-HO1-T''' <br />
# '''RBS-IFP-T'''<br />
# '''RBS-HO1-RBS-IFP-T'''<br />
# '''pTet-RBS-HO1-T'''<br />
# '''J23119-RBS-HO1-T'''<br />
# '''J23119-RBS-IFP-T'''<br />
# '''J23119-RBS-IFP-T-J23119-RBS-HO1-T'''<br />
# '''J23119-R-IFP-T''' in '''KAN vector'''<br />
<br />
<br />
<br />
Our parts listed above have been verified through the correct DNA fragments sizes by running both PCR and double digestion products on agarose gel electrophoresis. Additionally, 1stBASE has sequenced the part J23119-RBS-IFP-T that we have constructed and the results are positive! The summary of the sequencing results is as follows:<br />
<br />
<br />
<div class="grid_7 alpha"><br />
[[Image:NTU119-1.png|407px]]<br />
<br />
[[Image:NTU119-2.png|407px]]<br />
</div><br />
<br />
<br />
<br />
'''J23119 Sequencing'''<br />
<br />
<span class="grey">The first 10 base pairs of the promoter cannot be verified due to limitation of the sequencer.</span><br class="clear" /><br />
<br />
<br />
<div class="grid_7 alpha"><br />
[[Image:NTUrbs.png|407px]]<br />
</div><br />
<br />
<br />
<br />
'''RBS 5 (Part: BBa_B0034)'''<br />
<br />
<span class="grey">100% verified!</span><br class="clear" /><br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUifpterm.png|407px]]</div><br />
<br />
<br />
<br />
'''Terminator (Part: BBa_B0015)'''<br />
<br />
<span class="grey">100% sequence identity.</span><br class="clear" /><br />
<br />
<br />
<br />
==== IFP verification ====<br />
<br />
We had sent our IFP gene sequence in the final construct for verification and it came back indicating '''100% match'''. '''This means that our entire construct has perfect identity to that of reported sequence, and sure enough, it WORKS!'''<br />
<br />
<br />
'''Sequence alignment of our IFP gene (top) with literature sequence (bottom).'''<br />
<br />
[[Image:NTUifpver.jpg|651px]]<br />
[[Image:NTUifpver2.jpg|651px]]<br />
<br />
<br />
<br />
=== Device Verification ===<br />
<br />
<br />
We performed two verification experiments in the laboratory to determine the successful production of infrared fluorescent protein (IFP) or heme oxygenase-1 (HO-1) and thus the functionality of our imaging device. A test construct ('''J23119-RBS-IFP-T-J23119-RBS-HO1-T''') was constructed for this purpose.<br />
<br />
<br />
The first approach is by running '''agarose gel electrophoresis''' of the double digested plasmids and PCR products to verify the correct DNA fragment size as well as the presence of HO-1 and IFP genes in the test construct. <br />
<br />
<br />
<br />
<div class="grid_6 alpha">[[Image:NTUifp_ho1_dd.jpg|346px]]</div><br />
<br />
'''Gel electrophoresis to verify our final construct: J23119-R-IFP-T-J23119-R-HO1-T.'''<br />
<br />
<span class="grey">Lane 2, 3, 6 and 7 correspond to four different colonies picked from the ligation of J23119-R-HO1-T (insert) into J23119-R-IFP-T (vector). Single band was observed as the size of the vector and the complete construct (J23119-R-IFP-T-J23119-R-HO1-T) are similar (approximately 2400 bp). Lane 8 is the size of pSB1A2 vector in which the final construct resides. Lane 9 corresponds to the single digestion of Lane 6 to show that the lane 2, 3, 6, and 7 are not the band corresponding to single digest. The DNA gel ladder used was Fermentas GeneRuler 100bp plus.</span><br class="clear" /><br />
<br />
<br />
<div class="grid_4 alpha">[[Image:NTUho1pcr.jpg|224px]]</div><br />
<br />
<br />
<br />
'''Gel electrophoresis to verify HO1 gene in the final construct.'''<br />
<br />
<span class="grey">Lane 1 is the HO-1 positive control. Lane 3, 4, 7 and 8 correspond to four different colonies picked from the ligation of J23119-R-HO1-T (insert) into J23119-R-IFP-T (vector). The result confirmed the presence of HO-1 gene in our construct: J23119-R-IFP-T-J23119-R-HO1-T. </span><br class="clear" /><br />
<br />
<br />
<div class="grid_4 alpha">[[Image:NTUifppcr.jpg|224px]]</div><br />
<br />
<br />
<br />
'''Gel electrophoresis to verify IFP gene in the final construct.'''<br />
<br />
<span class="grey">Lane 1 is the HO-1 positive control. Lane 1 is the IFP positive control. Lane 3,4,7 and 8 correspond to four different colonies picked from the ligation of J23119-R-HO1-T (insert) into J23119-R-IFP-T (vector). The result confirmed the presence of IFP gene in our construct: J23119-R-IFP-T-J23119-R-HO1-T.</span><br class="clear" /><br />
<br />
<br />
<br />
'''SDS-PAGE to determine the presence of IFP protein'''<br />
The production of IFP in our imaging device was confirmed by SDS-PAGE on a NuPAGE® Novex 4-12% Bis-Tris gel. Protein ladder used is BenchMark™ Protein Ladder (Invitrogen Cat. No. 10747-012).<br />
<br />
<br />
<div class="grid_5 alpha">[[Image:NTUifpsds.jpg|285px]]</div><br />
<br />
'''SDS-PAGE to test for the presence of IFP protein.'''<br />
<br />
<span class="grey">The first lane is the negative control, followed by our construct: J23119-R-IFP-T-J23119-R-HO1-T and the third lane is the positive control, using the sample from Tsien’s Lab. The band corresponding to the size of IFP is pointed as in the figure (for positive control). The result suggests that IFP is indeed present in our sample. The vector for the positive control is pBAD which is an inducible over-expression vector. Hence this may explain the difference in the intensities of both bands corresponding to our construct and the positive control.</span><br class="clear" /><br />
<br />
<br />
Imaging experiments with the appropriate optical instruments for the detection of the infrared fluorescence emission of our constructs are also conducted repeatedly. The excitation and emission maxima of IFP are 684 and 708 nm, respectively; thus, our experimental setup must be equipped with the appropriate optical components that are of this wavelength range.<br />
<br />
Our positive control for all detection of infrared fluorescence emission in the following optical imaging experiments is cell culture containing plasmids which was generously provided by Tsien’s Lab. (We signed a Materials Transfer Agreement with them!).<br />
<br />
We extracted the DNA sample from the paper spot according to the protocol of plasmid resuspension from iGEM paper spots. ''E. coli'' strain K12 was transformed with the DNA resuspension. As the gene was being expressed, the cell culture turned green yellowish, indicating the presence of biliverdin in the cell culture.<br />
<br />
=== Fluorescence Microscopy ===<br />
<br />
As most of the microscopes are equipped with excitation and emission filters of wavelengths that are not in our desired range, we resorted to a customized optical experimental setup. With this in mind, we had collaborated with '''Prof. Lee Kijoon''' on the fluorescence imaging.<br />
<br />
Our first attempt in imaging our cell culture for the construct '''J23119-RBS-HO1-RBS-IFP-T''' was through the '''Axiovert 200 (Zeiss) fluorescence microscope'''. The only drawback of the fluorescence microscope was that the filter was of the excitation range of 575-625 nm and emission range of 660-710 nm [far red/cy5]. We further hypothesized that we did not manage to image the infrared fluorescence due to the limitation of appropriate filter for the fluorescence microscope.<br />
<br />
<br />
<br />
=== Optical Experiment Setup ===<br />
<br />
<br />
'''Ocean Optics USB-4000 Portable Spectrometer'''<br />
<br />
A '''660 nm Melles Griot 56ICS254/HS plus 56IMA022 laser''' is used as the light source. The 660 nm laser source fits almost perfectly with the ideal excitation maximum at 684 nm.<br />
<br />
<br />
We shine the 660 nm laser onto our four-hour re-inoculated cell culture. The '''Ocean Optics USB-4000 Portable Spectrometer''' detects any signal emitted by the cell culture with an optical fiber connected to the spectrometer. The optical fiber is pointed and directed towards the cell culture for signal receiving.<br />
<br />
<br />
In order to block the excitation light from entering the spectrometer, we included '''Semrock FF665-Di01-25-D''' dichroic mirror placed at 45-degree angle of incidence. The emission spectrum for our construct is generated with Ocean Optics SpectraSuite software.<br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUifpsetup.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
'''Ocean Optics USB-4000 Portable Spectrometer'''<br />
<br />
<span class="grey">Experimental setup for infrared emission spectrum measurement.</span><br class="clear" /><br />
<br />
<br />
In our attempts to optimize the experimental setup, we conducted repeated experiments with the positive control (sample of Tsien’s Lab) to generate the maximum signal intensity.<br />
<br />
'''Our optical experimental setup proved to be working well when we managed to optimize our readings to a maximum peak of intensity (counts) of 1500 for a 16-hour cell culture incubated at 37°C (fluoresence emission spectrum attached as below)''' :<br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUifptsienres.jpg|407px]]</div><br />
<br />
<br />
<br />
'''Fluorescence emission spectrum of 16-hour Tsien Lab cell culture'''<br />
<br />
<span class="grey">Note excitation near the peak excitation wavelength at 660 nm. This fluorescence emission spectrum was obtained with electric dark correction.</span><br class="clear" /><br />
<br />
<br />
This strongly suggests that this optical experiment setup with the Ocean Optics USB-4000 Portable Spectrometer is capable of detecting signals from our cells containing the infrared signal reporter. <br />
<br />
<br />
The successfully constructed device: J23119-RBS-IFP-T-J23119-RBS-HO1-T (J23119:B0034:K256008:B0015:J23119:B0034:I15008:B0015) was tested for infrared signal activity with this similar setup. For simplicity, this device will be called 119-IFP-119-HO1 in subsequent text. <br />
2mL of the overnight culture of 119-IFP-119-HO1 was pipetted into the fluorimetric four-clear-side cuvette. The cuvette was placed in the cuvette holder for detection of infrared signal. A positive control which was the sample from Tsien’s Lab and a negative control which was competent cells (E. coli strain K12) were included. However no fluorescence emission signal was generated from 119-IFP-119-HO1. <br />
<br />
<br />
Possibilities are the concentration of the cells might be too low to generate the fluorescence emission peak. The same overnight culture of 20mL of 119-IFP-119-HO1 was centrifuged at 4000rpm for 10 minutes and the pelleted cells were resuspended in 2mL of LB for a 10x concentrated volume of cells. Anticipating a greenish pelleted cells for this device due to the heme-oxygenase 1 that will generate the biliverdin (a green pigment), the pelleted cells of 119-IFP-119-HO1 were compared and contrast by observation with pelleted competent cells (''E. coli'' strain K12) and pelleted GFP-containing cells. Indeed, the pelleted cells of 119-IFP-119-HO1 was greenish in colour!<br />
<br />
<br />
<br />
<br />
<div class="grid_7 alpha">[[Image:NTUtsiencell.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
'''Cell Pellet Comparison'''<br />
<br />
<br />
<span class="grey">119-IFP-119-HO1 was greenish in colour, different from greenish of GFP.</span><br class="clear" /><br />
<br />
<br />
The resuspended 2mL cell culture was pipetted into a fluorimetric four-clear-side cuvette and placed into the cuvette holder. Detection of signal was performed with the optical fiber. The followings spectra were generated with Ocean Optics SpectraSuite:<br />
1. A dark spectrum (with light source turned off)<br />
2. A blank spectrum (negative control - ''E. coli'' K12 cells)<br />
3. Intensity spectrum (positive control – sample from Tsien’s Lab)<br />
4. Intensity spectrum (for 119-IFP-119-HO1)<br />
<br />
<br />
Upon detection of signal from our construct, the 119-IFP-119-HO1; there was a considerable large peak formed at the desirable emission peak wavelength (emission maximum of 708 nm).<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The resuspended 2mL cell culture was pipetted into a fluorimetric four-clear-side cuvette and placed into the cuvette holder. Detection of signal was performed with the optical fiber. The followings spectra were generated with Ocean Optics SpectraSuite:<br />
1. A dark spectrum (with light source turned off)<br />
2. A blank spectrum (negative control - ''E. coli'' K12 cells)<br />
3. Intensity spectrum (positive control – sample from Tsien’s Lab)<br />
4. Intensity spectrum (for 119-IFP-119-HO1)<br />
<br />
Upon detection of signal from our construct, the 119-IFP-119-HO1; there was a considerable large peak formed at the desirable emission peak wavelength (emission maximum of 708 nm).<br />
<br />
<br />
*5 plots <br />
<br />
<br />
<br />
<br />
<br />
'''Nikon Eclipse TS100 Inverted Microscope'''<br />
<br />
In parallel with the emission spectrum measurement, cell culture live imaging is performed as well.<br />
<br />
<br />
The previous optical experiment setup is modified with the inclusion of '''Nikon Eclipse TS100 Inverted Microscope''' coupled to '''DS-Fi1''' camera to image the cells. The software '''NIS Elements D''' is used for image capturing from the microscope.<br />
<br />
Another modification we have made to this experimental setup is the replacement of the '''Semrock FF665-Di01-25-D dichroic mirror''' with an emission filter, to enable this microscope to function as a fluorescence microscope. The emission filter is the '''Semrock FF01-710/40-25 single bandpass filter''' with the centre wavelength at 710 nm with average transmission of 93% over a range of 40 nm, which covers most of our expected emission range that has maximum at 708 nm. <br />
<br />
<br />
[[Image:NTUifpsetup2.jpg|651px]]<br />
<br />
<center class="grey">Our customized optical experiment setup for infrared protein detection</center><br />
<br />
<br />
We performed the cell culture imaging with the excitation light source of 660 nm laser diode and the '''Semrock FF01-710/40-25 single bandpass filter''' which serves as our emission filter. This modification was done to make '''Nikon Eclipse TS100 Inverted Microscope''' functions almost as a fluorescence microscope for our imaging purposes.<br />
<br />
== Characterization == <br />
<br />
<br />
Xiaokun Shu et. al. has also shown that the fluorescence of IFP is dependent upon pH. Hence, we characterized the pH dependence of IFP protein by analysing the fluorescent activity. We carried out the experiment in pH 4, 7 and 10. These pHs are of interest because the normalized fluorescence is stable over the range of pH 5 to 9. Two approaches were carried out. The first approach was to culture the cells at 37 deg C and 225 rpm for 14 hours and the cell culture was centrifuged at 4000 rpm for 10 minutes. The cell pellet was resuspended in 2 mL of Phosphate Buffered Saline adjusted to the corresponding pH. The samples were subjected to the optical experiment setup with Ocean Optics USB4000 Spectrometer as before. In the second approach, the preceding procedures remain the same. However, the resuspended cells are sonificated so that the IFP protein is better exposed to the pH condition. <br />
<br />
<br />
Besides pH, concentration and temperature dependence of IFP protein by fluorescence emission measurement were also conducted. Cell cultures were incubated for 14 hours at 225 rpm at three different temperatures: 25deg C, 30 deg C and 37 deg C. Centrifugation and resuspension in 2 mL of LB were done as before.<br />
<br />
<br />
<br />
== Literature / References ==<br />
<br />
Please proceed [[Team:NTU-Singapore/Project/References | here]] to view our full list of references.<br />
<br />
<br />
<br />
</div></div><br />
<br />
{{Template:NTUfootalt}}</div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Project/WetlabTeam:NTU-Singapore/Project/Wetlab2009-10-22T00:37:48Z<p>Sjee: /* Characterization of J23119 */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntuproject" class="grid_16"><br />
<span class="hidden">Welcome to the project page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">Hard at work!</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Project | <span class="selflink">pLaq''U''<span class="sup">e</span> Out!</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><div class="wrap_3 suffix_1" id="submenu"><br />
<div class="subtitle contrast grid_3 textright"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu textright"><br />
[[Team:NTU-Singapore/Project | '''p'''Laq''U''<span class="sup">e</span> '''Out''!''''']]<br />
[[Team:NTU-Singapore/Project/Approach | Research Approach]]<br />
[[Team:NTU-Singapore/Project/Prototype/Sense | Sensing Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Degrade | Degradation Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Prototype/Image | Imaging Device &laquo;&nbsp;&nbsp;]]<br />
[[Team:NTU-Singapore/Project/Wetlab | Wetlab Highlights]]<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore Parts Submitted]<br />
[[Team:NTU-Singapore/Project/References | References]]<br />
</div></div><br />
<br />
<div class="grid_11 suffix_1 omega"><br />
<span class="title">Conclusive <span class="bold">Results</span></span><br class="clear" /><br />
<br />
<br />
== Our working constructs! ==<br />
<br />
* '''J23119-B0034-NorR-B0015''', is a system construct, in that it was intended for our system to feature this as a functional part.<br />
* '''J23119-B0034-GFP-B0015''', is a characterization construct to characterize the modular function of the J23119 promoter in the transcription of NorR.<br />
* '''Lac(R0010)-B0034-CHE-B0015''', is also a test construct to only test and characterize the enzymatic activity of CHE.<br />
* '''J23119-B0034-IFP-B0015-J23119-B0034-HO1(I15008)-B0015''', is a test construct to only test the reporting ability of IFP.<br />
<br />
<br />
=== NorR System Construct Characterization ===<br />
<br />
NorR is an important NO sensor that triggers the transcription at pNO. Thus, we want an NorR producing construct to improve on the sensitivity of pNO.<br />
<br />
<br />
<br />
==== Double Digest verification ====<br />
<br />
<div class="grid_7 alpha">[[Image:NTUnorrgel2.jpg|407px]]</div><br />
<br />
<br />
<br />
<br />
'''Successful construct verification''' of J23119-B0034-NorR-B0015 by Double Digestion!<br />
<br class="clear" /><br />
<br />
<div class="grid_5 alpha suffix_1"><br />
==== SDS PAGE verification of NorR ====<br />
<br />
<br />
[[Image:NTUnorrsds.jpg|285px]]<br />
<br />
<center>'''Successful expression of NorR'''</center><br />
<br />
</div><br />
<br />
<div class="grid_5 omega"><br />
==== SDS PAGE characterization of NorR ====<br />
<br />
<br />
[[Image:NTUnorrsds2.jpg|285px]]<br />
<br />
<center>'''SDS PAGE results for NorR expressed at different inoculation temperatures'''</center><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
Since the sole purpose of J23119-B0034-NorR-B0015 (<partinfo>K256007</partinfo>) is to produce NorR, we shall dwell into the factors that might affect the production of the protein. The transformed cells were incubated at 3 different environmental temperatures (30 / 37 / 42°C).<br />
<br />
'''SDS PAGE characterization was carried out''' (''top right'').<br />
<br />
<br />
It has been observed that at elevated temperature, i.e. 42°C, production of NorR had decreased as shown by the diminished intensity (see 2nd lane). The production of NorR at 30°C and 37°C carried no significant difference.<br />
<br />
<br />
<br />
=== Characterization of J23119 ===<br />
<br />
Since J23119 (<partinfo>K256003</partinfo>) was used as the constitutive promoter for NorR producing construct, it is necessary for us to understand its modular function and how it would affect NorR production.<br />
<br />
<br />
[[Image:NTU119temp.png|651px]]<br />
<br />
<center>'''Characterization of J23119 w.r.t Temp (deg C)'''</center><br />
<br />
<br />
Preliminary characterisation of J23119 showed that the activity of the promoter to be the strongest at 25°C and weakest at 37°C with 30°C being something of an intermediate. Activity of the J23119 was independent of time. Noteworthy was that there was a drastic drop in activity of the J23119 promoter at 16min, 37°C. <br />
<br />
<br />
<br />
[[Image:NTU119culture.png|651px]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in different medium'''</center><br />
<br />
<br />
It shows that the supplemented M9 medium is the ideal choice for the characterization of the J23119 promoter. M9 is most likely to be the ideal medium for characterisation of other promoters in general.<br />
<br />
<br />
<br />
[[Image:NTU119backbone.png|651px|]]<br />
<br />
<center>'''Average GFP/OD of J23119-GFP in steady state (M9)'''</center><br />
<br />
<br />
Vector backbone did not seem to have much of an effect on the strengths of J23119, although pSB1A2 has a slight positive effect on the activity of the J23119.<br />
<br />
<br />
<br />
[[Image:NTU119diffprom.png|651px]]<br />
<br />
<center>'''Comparison of J23119 with other promoters'''</center><br />
<br />
<br />
Based on our preliminary characterization results, it appeared that J23101 produced a much stronger signal than J23119 and pTet. This was quite surprising because J23119 promoter is supposed to be stronger then the J23101.<br />
<br />
<br />
<br />
[[Image:NTU119diffchassis.png|651px]]<br />
<br />
<center>'''Characterization of J23119 in different chassis'''</center><br />
<br />
<br />
J23119 performance appeared to be the best in Origami B.<br />
<br />
== R0010-B0034-CHE-B0015 (K256028) ==<br />
<br />
To examine the enzymatic activity of cholesteryl esterase, a test construct was synthesized. CHE production was induced by l0mM lactose. The cells were sonicated, and the cell lysate containing CHE was characterized using Amplex® Red Cholesterol Assay Kit. The characterization results is shown below.<br />
<br />
<div class="grid_6 alpha">[[Image:NTUcheresult.png|346px]]</div><br />
<br />
<br />
'''Cholesterol Assay with CHE Construct'''<br />
<br />
<br class="clear" /><br />
<br />
<br />
From the graph, the cell lysate containing CHE had achieved higher fluorescence readings than the negative control. The increase in fluorescence reading is due to enzyme-coupled reaction that detects free cholesterol concentration. Hence, we have proven that CHE had indeed been produced from this construct and had been working to our expectation.<br />
<br />
<br />
<br />
</div></div><br />
<br />
{{Template:NTUfootalt}}</div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/BrainstormingTeam:NTU-Singapore/Notebook/Brainstorming2009-10-21T21:21:50Z<p>Sjee: /* Health & medicine */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== Health & medicine ==<br />
<br />
* Create an insulin delivery system which response to low glucose level or time controlled release<br />
* Vitamin synthesis?<br />
* Hinder carcinogenics <br />
** Maslinic acid (olive skin)-tritrepenoid compound <br />
** Can we study anti-tumoral and apoptotic effect of this compound? <br />
** E coli to interfere in the carcinogenic pathways <br />
** mimic the maslinic effect to the carcinogenic cells? <br />
** surface markers? <br />
* trap parasites in host cells by disabling the protease <br />
** Can we remove the trap parasites? <br />
** Terminate parasites? <br />
* genetic modified bacteria that have anticoagulant properties. <br />
* eczema relief<br />
* bacteria to treat gangrene <br />
** to eat up dead tissues <br />
** bac to deliver growth factors <br />
* collagen producing bacteria <br />
* bacteria that absorbs cholesterol <br />
* constipation pill <br />
* synthesis specific growth factors <br />
* bacteria tt produce PDGF <br />
* using bacteria to breakdown blockage in blood vessels <br />
* malaria vaccine <br />
** forcibly experesses a certain gene and create a vaccine against it <br />
** to prove the concept <br />
* cancer treatment-colon cancer(CA marker) <br />
** fusion protein to signal the expression of perforin (e coli as NKC) <br />
* streptococcus vaccine <br />
* p-falciparum gene expression stabilization ; Malaria <br />
* intestinal vaccine delivery <br />
* bac to target the larvae; Malaria<br />
*To separate Tamoxifen (possibly a chiral drug) by uptake the drugs into modified E Coli and bind it to the receptor inside the bacteria.<br />
<br />
<br />
== Biosensor ==<br />
<br />
* biosensor that sense the present of allergen and release drugs to prevent allergenic response <br />
* Mimic allergy response-to determine allergen? <br />
* fingerprint detection <br />
* Can cells response to magnetic fields? <br />
** Bird GPS ?? <br />
** magnetic field biosensor <br />
* biosensor to detect cancer <br />
<br />
<br />
== Environmental ==<br />
<br />
* E coli to detect toxins in food and flu strain in animals. <br />
* Biomask<br />
** For absorption<br />
* create a water purifying system that recognize and trap toxic <br />
** to uptake salt and others- sea water purification <br />
* bacteria producing water for the use of photosynthesis so that plants can grow well in dry area <br />
** is it possible to construct water using certain metabolism pathway? <br />
<br />
<br />
== Signalling ==<br />
<br />
* Multi-color display according to inputs <br />
** to improve signal inputs <br />
* DNA methylation as memory storage <br />
* suffocate the cells <br />
* baccine <br />
* To construct guiding E Coli that guide pathogenic bacteria to a region of toxin/UV light.<br />
<br />
<br />
==Application ==<br />
<br />
* bacterial barometer<br />
* fill up crack <br />
* dust repel <br />
* microscopic spring-using spirobac <br />
* To construct a Sound sensing bacteria<br />
<br />
<br />
==Modeling==<br />
<br />
* modeling the trend of evolution of flu viruses<br />
<br />
<br />
==Bioproduction==<br />
<br />
* Methanol in E-coli<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/BrainstormingTeam:NTU-Singapore/Notebook/Brainstorming2009-10-21T21:07:43Z<p>Sjee: /* June */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== Health & medicine ==<br />
<br />
* Create an insulin delivery system which response to low glucose level or time controlled release<br />
* Vitamin synthesis?<br />
* Hinder carcinogenics <br />
** Maslinic acid (olive skin)-tritrepenoid compound <br />
** Can we study anti-tumoral and apoptotic effect of this compound? <br />
** E coli to interfere in the carcinogenic pathways <br />
** mimic the maslinic effect to the carcinogenic cells? <br />
** surface markers? <br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/NotebookTeam:NTU-Singapore/Notebook2009-10-21T19:39:22Z<p>Sjee: /* September */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== June ==<br />
<br />
<u>'''18th June'''</u><br />
* Preparation of LB medium<br />
* Amplification of parts from registry (pTet, TetR, HO1, Low copy plasmid)<br />
<br />
<br />
<u>'''19th June'''</u><br />
* Antibiotic stock preparation<br />
* Inoculation<br />
<br />
<br />
<u>'''20th June'''</u><br />
* Our first Plasmid Extraction (PE)!<br />
<br />
<br />
<u>'''22nd June'''</u><br />
* First Double Digestion (DD) and Gel Check!<br />
<br />
<br />
<u>'''23rd June '''</u><br />
* PE & DD of the registry constructs….<br />
<br />
<br />
<u>'''24th June '''</u><br />
*Our direct synthesized parts finally arrived. We now have CHE (cholesterol esterase), IFP(Infrared protein 1.4) and pNO (NO sensing promoter).<br />
<br />
<br />
<u>'''26th June'''</u><br />
*PE , DD and Gel check for the direct synthesized gene sequence.<br />
<br />
<br />
<u>'''27th June '''</u><br />
*Gel Check for CHE, IFP and pNO<br />
<br />
<br />
==July==<br />
<br />
<br />
<u>'''1st July'''</u><br />
* PE for plaqIQ, J23101, J23119, B0034(rbs), B0015(Term-T for short), B0034-GFP-B0015<br />
<br />
<br />
<u>'''2nd July'''</u><br />
* PE for pNO, IFP, CHE<br />
* DD of pNO, J23119, J23101, rbs-GFP-T<br />
* Our first ligation!<br />
<br />
<br />
<u>'''3rd July'''</u><br />
* DD of CHE, IFP and B0015, plaqIQ and plux. <br />
* Ligation.<br />
<br />
<br />
<u>'''4th July'''</u><br />
* PE: pNO-GFP; J23101-GFP; J23119-GFP; HO1<br />
* DD: HO1<br />
<br />
<br />
<u>'''7th July'''</u><br />
* PE: CHE, IFP, placIQ<br />
* DD:CHE-T, IFP-T. HO1, Term<br />
* Ligation<br />
<br />
<br />
<u>'''8th July'''</u><br />
* DD: pNO-GFP; J23101-GFP; J23119-GFP<br />
<br />
<br />
<u>'''9th July'''</u><br />
* PE<br />
* DD: ptet. r-CHE-T, r-HO1, r-IFP-T<br />
* Ligation: r-HO1 +r-IFP-T<br />
<br />
<br />
<u>'''10th July'''</u><br />
* PE<br />
* DD: ptet; r-CHE-T, Term, tetR<br />
<br />
<br />
<u>'''11th July'''</u><br />
* PE<br />
* DD: r-CHE-T; r-HO1-r-IFP-T;CHE-T; r-CHE-T<br />
<br />
<br />
<u>'''13th July'''</u><br />
* DD: ptet; r-CHE-T; r-HO1-r-IFP-T; TetR; Term<br />
* Ligation: ptet + r-CHE-T; ptet + r-HO1-r-IFP-T; TetR + Term<br />
<br />
<br />
<u>'''15th July'''</u><br />
* PE<br />
* DD: pTet; rbs; IFP; CHE; TetR-T<br />
<br />
<br />
<u>'''16th July'''</u><br />
* DD: pTet; r-CHE-T; Inv; r-HO1-r-IFP-T; Term; TetR<br />
* Ligation<br />
<br />
<br />
<u>'''18th July'''</u><br />
* PE<br />
* DD and Single Digestion (SD) :r-HO1-r-IFP-T (because they have the same size)<br />
<br />
<br />
<u>'''20th July'''</u><br />
* DD:pTet; J23119; r-HO1-r-IFP-T; TetR; Term; placIQ; inv<br />
* Ligation: pTet +r-HO1-r-IFP-T; J23119 + r-HO1-r-IFP-T; placIQ +Inv; TetR +Term<br />
* PE <br />
<br />
<br />
<u>'''23rd July'''</u><br />
* PE<br />
* DD:J23119; Inv; r-HO1; r-GFP-T; pTet; placIQ-Inv; TetR-T<br />
<br />
<br />
<u>'''24th July'''</u><br />
* PE<br />
* DD: J23119; r-CHE-T; pTet; inv;r-HO1-r-IFP-T; ptet-IFP<br />
* Ligation: J23119+r-CHE-T; ptet+r-CHE-T; ptet+r-HO1-r-IFP-T; J23119+Inv<br />
<br />
<br />
<u>'''28th July'''</u><br />
* PE<br />
* DD: r-HO1; r-GFP-T; J23119;r-CHE-T;r-HO1-r-IFP-t; ptet; r-CHE-T<br />
* Ligation: r-HO1 +r-GFP-T; J23119 +r-CHE-T; J23119 + r-HO1-r-IFP-T; pTet +r-CHE-T; pTet +r-GFP-T<br />
<br />
<br />
<u>'''30th July'''</u><br />
* PE<br />
*DD : J23119-r-CHE-T; ptet-r-CHE-T; J23119-r-HO1-r-IFP-T; ptet-r-HO1-r-IFP-T; r-HO1-r-GFP-T; J23119; pTet; TetR; rbs<br />
* Ligation: r-HO1 +r-GFP-T; J23119 +r-CHE-T; J23119+r-HO1-IFP-T; ptet+r-CHE-T; ptet+r-GFP-T <br />
<br />
<br />
== August ==<br />
<br />
<br />
<u>'''4th August'''</u><br />
* DD :rbs; NorR<br />
<br />
<br />
<u>'''5th August'''</u><br />
* PE<br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''12th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''14th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''17th August'''</u><br />
* DD<br />
* Our first SDS-PAGE—J23119-r-CHE-T; pTet-r-CHE-T<br />
<br />
<br />
<u>'''18th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''21st August'''</u><br />
* DD<br />
* Characterization of J23119<br />
<br />
<br />
<u>'''24th August'''</u><br />
* PCR verification –HO1, pTet constructs<br />
<br />
<br />
<u>'''25th August'''</u><br />
* pTet characterization<br />
<br />
<br />
<u>'''26th August'''</u><br />
* DD<br />
<br />
<br />
<u>'''27th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''28th August'''</u><br />
* PCR verification – CHE constructs<br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''29th August'''</u><br />
* DD <br />
* Ligation<br />
* PCR verification –IFP constructs<br />
<br />
<br />
<u>'''31st August'''</u><br />
* PCR verification –HO1, CHE constructs<br />
* DD<br />
* Ligation <br />
<br />
<br />
==September==<br />
<br />
<br />
<u>'''1st September'''</u><br />
* PCR verification –IFP, NorR, pNO<br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''2nd September'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''3rd September'''</u><br />
* DD <br />
* Ligation<br />
<br />
<br />
<u>'''4th September'''</u><br />
* DD <br />
* Ligation<br />
<br />
<br />
<u>'''6th September'''</u><br />
* PCR --J23119-r-NorR-T <br />
<br />
<br />
<br />
<u>'''7th September'''</u><br />
* DD, <br />
* Ligation<br />
<br />
<br />
<br />
<u>'''8th September'''</u><br />
* PCR verification –IFP, HO1 constructs<br />
<br />
<br />
<br />
<u>'''9th September'''</u><br />
* PCR verification –HO1 constructs<br />
<br />
<br />
<br />
<u>'''10th September'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<br />
<u>'''11th September'''</u><br />
* PCR verification –NorR, IFP, HO1 constructs<br />
* Ligation<br />
<br />
<u>'''12thS eptember'''</u><br />
* PCR verification – NorR, IFP, HO1 constructs<br />
<br />
<br />
<u>'''14thSeptember'''</u><br />
* PCR verification – IFP, HO1 constructs<br />
<br />
<br />
<u>'''15th September'''</u><br />
* DD <br />
* Ligation<br />
* SDS-Page<br />
<br />
<br />
<u>'''16th September'''</u><br />
* pNO characterization<br />
<br />
<br />
<u>'''17th September'''</u><br />
* Ligation<br />
<br />
<br />
<u>'''18th September'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''19th September'''</u><br />
* DD<br />
<br />
<br />
<u>'''20th September'''</u><br />
* Ligation<br />
<br />
<br />
<u>'''22nd September'''</u><br />
* PCR verification –IFP, HO1<br />
* pNO characterization<br />
<br />
<br />
<u>'''23rd September'''</u><br />
* PCR verification --CHE<br />
<br />
<br />
<u>'''24th September'''</u><br />
* PCR verification –CHE, HO1<br />
* DD<br />
* Ligation<br />
* Optimization of CHE characterization experiment<br />
<br />
<br />
<u>'''26th September'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/NotebookTeam:NTU-Singapore/Notebook2009-10-21T19:31:14Z<p>Sjee: /* August */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== June ==<br />
<br />
<u>'''18th June'''</u><br />
* Preparation of LB medium<br />
* Amplification of parts from registry (pTet, TetR, HO1, Low copy plasmid)<br />
<br />
<br />
<u>'''19th June'''</u><br />
* Antibiotic stock preparation<br />
* Inoculation<br />
<br />
<br />
<u>'''20th June'''</u><br />
* Our first Plasmid Extraction (PE)!<br />
<br />
<br />
<u>'''22nd June'''</u><br />
* First Double Digestion (DD) and Gel Check!<br />
<br />
<br />
<u>'''23rd June '''</u><br />
* PE & DD of the registry constructs….<br />
<br />
<br />
<u>'''24th June '''</u><br />
*Our direct synthesized parts finally arrived. We now have CHE (cholesterol esterase), IFP(Infrared protein 1.4) and pNO (NO sensing promoter).<br />
<br />
<br />
<u>'''26th June'''</u><br />
*PE , DD and Gel check for the direct synthesized gene sequence.<br />
<br />
<br />
<u>'''27th June '''</u><br />
*Gel Check for CHE, IFP and pNO<br />
<br />
<br />
==July==<br />
<br />
<br />
<u>'''1st July'''</u><br />
* PE for plaqIQ, J23101, J23119, B0034(rbs), B0015(Term-T for short), B0034-GFP-B0015<br />
<br />
<br />
<u>'''2nd July'''</u><br />
* PE for pNO, IFP, CHE<br />
* DD of pNO, J23119, J23101, rbs-GFP-T<br />
* Our first ligation!<br />
<br />
<br />
<u>'''3rd July'''</u><br />
* DD of CHE, IFP and B0015, plaqIQ and plux. <br />
* Ligation.<br />
<br />
<br />
<u>'''4th July'''</u><br />
* PE: pNO-GFP; J23101-GFP; J23119-GFP; HO1<br />
* DD: HO1<br />
<br />
<br />
<u>'''7th July'''</u><br />
* PE: CHE, IFP, placIQ<br />
* DD:CHE-T, IFP-T. HO1, Term<br />
* Ligation<br />
<br />
<br />
<u>'''8th July'''</u><br />
* DD: pNO-GFP; J23101-GFP; J23119-GFP<br />
<br />
<br />
<u>'''9th July'''</u><br />
* PE<br />
* DD: ptet. r-CHE-T, r-HO1, r-IFP-T<br />
* Ligation: r-HO1 +r-IFP-T<br />
<br />
<br />
<u>'''10th July'''</u><br />
* PE<br />
* DD: ptet; r-CHE-T, Term, tetR<br />
<br />
<br />
<u>'''11th July'''</u><br />
* PE<br />
* DD: r-CHE-T; r-HO1-r-IFP-T;CHE-T; r-CHE-T<br />
<br />
<br />
<u>'''13th July'''</u><br />
* DD: ptet; r-CHE-T; r-HO1-r-IFP-T; TetR; Term<br />
* Ligation: ptet + r-CHE-T; ptet + r-HO1-r-IFP-T; TetR + Term<br />
<br />
<br />
<u>'''15th July'''</u><br />
* PE<br />
* DD: pTet; rbs; IFP; CHE; TetR-T<br />
<br />
<br />
<u>'''16th July'''</u><br />
* DD: pTet; r-CHE-T; Inv; r-HO1-r-IFP-T; Term; TetR<br />
* Ligation<br />
<br />
<br />
<u>'''18th July'''</u><br />
* PE<br />
* DD and Single Digestion (SD) :r-HO1-r-IFP-T (because they have the same size)<br />
<br />
<br />
<u>'''20th July'''</u><br />
* DD:pTet; J23119; r-HO1-r-IFP-T; TetR; Term; placIQ; inv<br />
* Ligation: pTet +r-HO1-r-IFP-T; J23119 + r-HO1-r-IFP-T; placIQ +Inv; TetR +Term<br />
* PE <br />
<br />
<br />
<u>'''23rd July'''</u><br />
* PE<br />
* DD:J23119; Inv; r-HO1; r-GFP-T; pTet; placIQ-Inv; TetR-T<br />
<br />
<br />
<u>'''24th July'''</u><br />
* PE<br />
* DD: J23119; r-CHE-T; pTet; inv;r-HO1-r-IFP-T; ptet-IFP<br />
* Ligation: J23119+r-CHE-T; ptet+r-CHE-T; ptet+r-HO1-r-IFP-T; J23119+Inv<br />
<br />
<br />
<u>'''28th July'''</u><br />
* PE<br />
* DD: r-HO1; r-GFP-T; J23119;r-CHE-T;r-HO1-r-IFP-t; ptet; r-CHE-T<br />
* Ligation: r-HO1 +r-GFP-T; J23119 +r-CHE-T; J23119 + r-HO1-r-IFP-T; pTet +r-CHE-T; pTet +r-GFP-T<br />
<br />
<br />
<u>'''30th July'''</u><br />
* PE<br />
*DD : J23119-r-CHE-T; ptet-r-CHE-T; J23119-r-HO1-r-IFP-T; ptet-r-HO1-r-IFP-T; r-HO1-r-GFP-T; J23119; pTet; TetR; rbs<br />
* Ligation: r-HO1 +r-GFP-T; J23119 +r-CHE-T; J23119+r-HO1-IFP-T; ptet+r-CHE-T; ptet+r-GFP-T <br />
<br />
<br />
== August ==<br />
<br />
<br />
<u>'''4th August'''</u><br />
* DD :rbs; NorR<br />
<br />
<br />
<u>'''5th August'''</u><br />
* PE<br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''12th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''14th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''17th August'''</u><br />
* DD<br />
* Our first SDS-PAGE—J23119-r-CHE-T; pTet-r-CHE-T<br />
<br />
<br />
<u>'''18th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''21st August'''</u><br />
* DD<br />
* Characterization of J23119<br />
<br />
<br />
<u>'''24th August'''</u><br />
* PCR verification –HO1, pTet constructs<br />
<br />
<br />
<u>'''25th August'''</u><br />
* pTet characterization<br />
<br />
<br />
<u>'''26th August'''</u><br />
* DD<br />
<br />
<br />
<u>'''27th August'''</u><br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''28th August'''</u><br />
* PCR verification – CHE constructs<br />
* DD<br />
* Ligation<br />
<br />
<br />
<u>'''29th August'''</u><br />
* DD <br />
* Ligation<br />
* PCR verification –IFP constructs<br />
<br />
<br />
<u>'''31st August'''</u><br />
* PCR verification –HO1, CHE constructs<br />
* DD<br />
* Ligation <br />
<br />
<br />
==September==<br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
<br />
<u>''''''</u><br />
* <br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/NotebookTeam:NTU-Singapore/Notebook2009-10-21T19:21:02Z<p>Sjee: /* July */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== June ==<br />
<br />
<u>'''18th June'''</u><br />
* Preparation of LB medium<br />
* Amplification of parts from registry (pTet, TetR, HO1, Low copy plasmid)<br />
<br />
<br />
<u>'''19th June'''</u><br />
* Antibiotic stock preparation<br />
* Inoculation<br />
<br />
<br />
<u>'''20th June'''</u><br />
* Our first Plasmid Extraction (PE)!<br />
<br />
<br />
<u>'''22nd June'''</u><br />
* First Double Digestion (DD) and Gel Check!<br />
<br />
<br />
<u>'''23rd June '''</u><br />
* PE & DD of the registry constructs….<br />
<br />
<br />
<u>'''24th June '''</u><br />
*Our direct synthesized parts finally arrived. We now have CHE (cholesterol esterase), IFP(Infrared protein 1.4) and pNO (NO sensing promoter).<br />
<br />
<br />
<u>'''26th June'''</u><br />
*PE , DD and Gel check for the direct synthesized gene sequence.<br />
<br />
<br />
<u>'''27th June '''</u><br />
*Gel Check for CHE, IFP and pNO<br />
<br />
<br />
==July==<br />
<br />
<br />
<u>'''1st July'''</u><br />
* PE for plaqIQ, J23101, J23119, B0034(rbs), B0015(Term-T for short), B0034-GFP-B0015<br />
<br />
<br />
<u>'''2nd July'''</u><br />
* PE for pNO, IFP, CHE<br />
* DD of pNO, J23119, J23101, rbs-GFP-T<br />
* Our first ligation!<br />
<br />
<br />
<u>'''3rd July'''</u><br />
* DD of CHE, IFP and B0015, plaqIQ and plux. <br />
* Ligation.<br />
<br />
<br />
<u>'''4th July'''</u><br />
* PE: pNO-GFP; J23101-GFP; J23119-GFP; HO1<br />
* DD: HO1<br />
<br />
<br />
<u>'''7th July'''</u><br />
* PE: CHE, IFP, placIQ<br />
* DD:CHE-T, IFP-T. HO1, Term<br />
* Ligation<br />
<br />
<br />
<u>'''8th July'''</u><br />
* DD: pNO-GFP; J23101-GFP; J23119-GFP<br />
<br />
<br />
<u>'''9th July'''</u><br />
* PE<br />
* DD: ptet. r-CHE-T, r-HO1, r-IFP-T<br />
* Ligation: r-HO1 +r-IFP-T<br />
<br />
<br />
<u>'''10th July'''</u><br />
* PE<br />
* DD: ptet; r-CHE-T, Term, tetR<br />
<br />
<br />
<u>'''11th July'''</u><br />
* PE<br />
* DD: r-CHE-T; r-HO1-r-IFP-T;CHE-T; r-CHE-T<br />
<br />
<br />
<u>'''13th July'''</u><br />
* DD: ptet; r-CHE-T; r-HO1-r-IFP-T; TetR; Term<br />
* Ligation: ptet + r-CHE-T; ptet + r-HO1-r-IFP-T; TetR + Term<br />
<br />
<br />
<u>'''15th July'''</u><br />
* PE<br />
* DD: pTet; rbs; IFP; CHE; TetR-T<br />
<br />
<br />
<u>'''16th July'''</u><br />
* DD: pTet; r-CHE-T; Inv; r-HO1-r-IFP-T; Term; TetR<br />
* Ligation<br />
<br />
<br />
<u>'''18th July'''</u><br />
* PE<br />
* DD and Single Digestion (SD) :r-HO1-r-IFP-T (because they have the same size)<br />
<br />
<br />
<u>'''20th July'''</u><br />
* DD:pTet; J23119; r-HO1-r-IFP-T; TetR; Term; placIQ; inv<br />
* Ligation: pTet +r-HO1-r-IFP-T; J23119 + r-HO1-r-IFP-T; placIQ +Inv; TetR +Term<br />
* PE <br />
<br />
<br />
<u>'''23rd July'''</u><br />
* PE<br />
* DD:J23119; Inv; r-HO1; r-GFP-T; pTet; placIQ-Inv; TetR-T<br />
<br />
<br />
<u>'''24th July'''</u><br />
* PE<br />
* DD: J23119; r-CHE-T; pTet; inv;r-HO1-r-IFP-T; ptet-IFP<br />
* Ligation: J23119+r-CHE-T; ptet+r-CHE-T; ptet+r-HO1-r-IFP-T; J23119+Inv<br />
<br />
<br />
<u>'''28th July'''</u><br />
* PE<br />
* DD: r-HO1; r-GFP-T; J23119;r-CHE-T;r-HO1-r-IFP-t; ptet; r-CHE-T<br />
* Ligation: r-HO1 +r-GFP-T; J23119 +r-CHE-T; J23119 + r-HO1-r-IFP-T; pTet +r-CHE-T; pTet +r-GFP-T<br />
<br />
<br />
<u>'''30th July'''</u><br />
* PE<br />
*DD : J23119-r-CHE-T; ptet-r-CHE-T; J23119-r-HO1-r-IFP-T; ptet-r-HO1-r-IFP-T; r-HO1-r-GFP-T; J23119; pTet; TetR; rbs<br />
* Ligation: r-HO1 +r-GFP-T; J23119 +r-CHE-T; J23119+r-HO1-IFP-T; ptet+r-CHE-T; ptet+r-GFP-T <br />
<br />
<br />
== August ==<br />
<br />
<br />
<u>''' '''</u><br />
* <br />
<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<u>''' '''</u><br />
* <br />
<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<br />
<u>''' '''</u><br />
* <br />
<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/NotebookTeam:NTU-Singapore/Notebook2009-10-21T19:10:39Z<p>Sjee: /* July */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== June ==<br />
<br />
<u>'''18th June'''</u><br />
* Preparation of LB medium<br />
* Amplification of parts from registry (pTet, TetR, HO1, Low copy plasmid)<br />
<br />
<br />
<u>'''19th June'''</u><br />
* Antibiotic stock preparation<br />
* Inoculation<br />
<br />
<br />
<u>'''20th June'''</u><br />
* Our first Plasmid Extraction (PE)!<br />
<br />
<br />
<u>'''22nd June'''</u><br />
* First Double Digestion (DD) and Gel Check!<br />
<br />
<br />
<u>'''23rd June '''</u><br />
* PE & DD of the registry constructs….<br />
<br />
<br />
<u>'''24th June '''</u><br />
*Our direct synthesized parts finally arrived. We now have CHE (cholesterol esterase), IFP(Infrared protein 1.4) and pNO (NO sensing promoter).<br />
<br />
<br />
<u>'''26th June'''</u><br />
*PE , DD and Gel check for the direct synthesized gene sequence.<br />
<br />
<br />
<u>'''27th June '''</u><br />
*Gel Check for CHE, IFP and pNO<br />
<br />
<br />
==July==<br />
<br />
<br />
<u>'''1st July'''</u><br />
* PE for plaqIQ, J23101, J23119, B0034(rbs), B0015(Term-T for short), B0034-GFP-B0015<br />
<br />
<br />
<u>'''2nd July'''</u><br />
* PE for pNO, IFP, CHE<br />
* DD of pNO, J23119, J23101, rbs-GFP-T<br />
* Our first ligation!<br />
<br />
<br />
<u>'''3rd July'''</u><br />
* DD of CHE, IFP and B0015, plaqIQ and plux. <br />
* Ligation.<br />
<br />
<br />
<u>'''4th July'''</u><br />
* PE: pNO-GFP; J23101-GFP; J23119-GFP; HO1<br />
* DD: HO1<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<br />
<u>''' '''</u><br />
* <br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/NotebookTeam:NTU-Singapore/Notebook2009-10-21T19:07:49Z<p>Sjee: /* June */</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== June ==<br />
<br />
<u>'''18th June'''</u><br />
* Preparation of LB medium<br />
* Amplification of parts from registry (pTet, TetR, HO1, Low copy plasmid)<br />
<br />
<br />
<u>'''19th June'''</u><br />
* Antibiotic stock preparation<br />
* Inoculation<br />
<br />
<br />
<u>'''20th June'''</u><br />
* Our first Plasmid Extraction (PE)!<br />
<br />
<br />
<u>'''22nd June'''</u><br />
* First Double Digestion (DD) and Gel Check!<br />
<br />
<br />
<u>'''23rd June '''</u><br />
* PE & DD of the registry constructs….<br />
<br />
<br />
<u>'''24th June '''</u><br />
*Our direct synthesized parts finally arrived. We now have CHE (cholesterol esterase), IFP(Infrared protein 1.4) and pNO (NO sensing promoter).<br />
<br />
<br />
<u>'''26th June'''</u><br />
*PE , DD and Gel check for the direct synthesized gene sequence.<br />
<br />
<br />
<u>'''27th June '''</u><br />
*Gel Check for CHE, IFP and pNO<br />
<br />
<br />
==July==<br />
<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<u>''' '''</u><br />
*<br />
<br />
<br />
<u>''' '''</u><br />
* <br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/BrainstormingTeam:NTU-Singapore/Notebook/Brainstorming2009-10-21T18:59:51Z<p>Sjee: New page: {{Template:NTUGlobalt}} <div id="plaquebanner" class="clearfix"> <div id="ntunotebook" class="grid_16"> <span class="hidden">Welcome to the notebook page!</span> </div> </div> <div id="me...</p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Experiment <span class="bold">Timeline</span></span><br />
<br />
<br />
== June ==<br />
<br />
<u>'''18th June'''</u><br />
* Preparation of LB medium<br />
* Amplification of parts from registry (pTet, TetR, HO1, Low copy plasmid)<br />
<br />
<br />
<u>'''19th June'''</u><br />
* Antibiotic stock preparation<br />
* Inoculation<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/DeliverablesTeam:NTU-Singapore/Notebook/Deliverables2009-10-21T17:53:55Z<p>Sjee: </p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | Notebook]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Our <span class="bold">Accomplishments</span></span><br />
<br />
<br />
This is the quick checklist of what we have achieved. Please click on the titles to see the details of what we did.<br />
<br />
<br />
* We have '''THREE''' working new parts!<br />
** Our '''Imaging device''' is emitting infrared signals. Check [[Team:NTU-Singapore/Project/Prototype/Image#Device_Characterization | this]] out!<br />
** Our '''degrading enzyme''' is actively degrading cholesteryl esters. Find out [[Team:NTU-Singapore/Project/Prototype/Degrade#Device_Characterization | more]]!<br />
** Our construct is secreting a specific transcription factor, '''NorR'''. See [[Team:NTU-Singapore/Project/Prototype/Sense#Device Characterization | more]]!<br />
<br />
<br />
* We have submitted '''SEVENTEEN''' new parts and documentation can be found in the link below!<br />
** Click here to see our comprehensive [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=NTU-Singapore list of Biobricks submitted].<br />
<br />
<br />
* We have characterized '''ONE''' existing Biobrick part!<br />
** We characterized J23119 & J23101 family of constitutive promoters.<br />
<br />
<br />
* We have improved '''TWO''' existing parts!<br />
** Link to the two.<br />
<br />
<br />
* We looked into the fledgling hobbyist phenomenon '''DIYbio''' for [[Team:NTU-Singapore/HPA | Human Practices Advance]]!<br />
** [[Team:NTU-Singapore/HPA/Essay | Researched on and discussed]] DIYbio<br />
** Conducted an extensive [[Team:NTU-Singapore/HPA/Survey | Public Survey]]<br />
** [[Team:NTU-Singapore/HPA/Interview | Interviewed]] prominent DIYbiologists<br />
<br />
<br />
* We helped '''THREE''' teams with their iGEM projects!<br />
** Helped '''Team Valencia''' with their [https://2009.igem.org/Team:Valencia/Human_Practice/Medalls Human Practices Advance survey]<br />
** Assisted '''Team Paris''' with [https://2009.igem.org/Team:Paris/Collaborations#top opinions on their actions] on building a new mobile lab management system<br />
** Collaborated with '''Team PKU''' to discuss and improve Molecular & Synthetic Biology Techniques<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/ProtocolsTeam:NTU-Singapore/Notebook/Protocols2009-10-21T14:54:19Z<p>Sjee: </p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Our <span class="bold">Protocols</span></span><br class="clear" /><br />
<br />
<br />
<br />
== Plasmid resuspension from IGEM paper spots and well ==<br />
(''Estimated time: 25 min + 5 min for every part if you use scalpel/tweezers or + 15 min for every part if you use punch tool'') <br />
<br />
<br />
'''Materials needed''' : <br />
* Pre-warmed at 42°C TE <br />
* Desired spot location information <br />
* punch tool<br />
* ddH20 <br />
* 99% ethanol <br />
* 0.5 ml tubes <br />
<br />
<br />
'''Protocol''' <br />
# Put 10 µL of pre-warmed TE into a 0.5 ml tube. <br />
# Cut paper spots using punch tool, following the instructions provided with the IGEM kit. <br />
# Put the cut paper into the 0.5 ml tube. <br />
# Clean punch tool with water and ethanol every time after cutting a spot; be careful to dry the punch tool. <br />
# Incubate at 42°C for 20 min. <br />
# Vortex and spin down. <br />
# Pipttee 4-6 µl of DNA resuspension for transformation <br />
<br />
<br />
<br />
== Plasmid resuspension from Well ==<br />
<br />
<br />
'''Materials Needed'''<br />
* DI water<br />
<br />
<br />
'''Protocol'''<br />
# With a pipette tip, punch a hole through the foil cover into the corresponding well to the Biobrick™-standard part that you want. Make sure oriented the plate is properly oriented. Foil cover is recommended not to be removed, as it could lead to cross contamination between the wells.<br />
# Add 15uL of diH2O (deionized water)<br />
# Take 2uL DNA and transform into your desired competent cells, plate bacteria with the appropriate antibiotic* and grow overnight.<br />
# Pick a single colony and inoculate broth (again, with the correct antibiotic) and grow for 18 hours.<br />
# Use the resulting culture to miniprep the DNA AND make your own glycerol stock<br />
<br />
<br />
<br />
== BioBrick digestion with restriction enzymes == <br />
(''estimated time: 3 hours'') <br />
<br />
<br />
'''Materials needed: Double Digestion mixture composition (total volume: 50 µL)'''<br />
* DNA 1mg (usually 4~5 µL)<br />
* Enzyme-1 1 µL<br />
* Enzyme-2 1 µL<br />
* NEBBuffer-2 5 µL (1/10 of total volume, check double digestion table for which buffer to use)<br />
* BSA 0.5 µL (1/10 of buffer volume)<br />
* Mili-Q water 37.5 µL <br />
<br />
<br />
'''Protocol''' <br />
# Measure plasmid concentration by Nano-drop <br />
# Pipette apropraite amount of vector (usually 4~5 µl for 1 µg)<br />
# Take out NEBuffer and BSA to thaw (usually stored at -20 deg C), vortex for well mix<br />
# Adding the following components sequentially into 200 µL PCR tube, following the order: Mili-Q water → Enzyme Buffer → BSA (optional) → DNA → Enzyme<br />
# Pulse spin the tube and incubate at 37 deg C for 2 hours (2.5hrs)<br />
# Do MiniElute PCR purification for all the tubes to remove enzymes and buffers <br />
# Load the 10 µL plasmid with 2 µL loading dye for gel running<br />
<br />
<br />
'''Notes''' <br />
*check 37 deg C incubator is on, take out buffer, BSA, to thaw and vortex before adding, when adding buffer, enzymes, DNA (not BSA), putting the whole pipette tip into the solution, and then pipette up and down. For adding BSA, just push strongly and fast all the way down.<br />
<br />
<br />
<br />
== LB - Agar Plate Preparation Protocol == <br />
(''Estimated time: 3 hours + 1 hour pouring process'') <br />
<br />
<br />
'''Materials needed''' <br />
* LB broth <br />
* Agar <br />
* Autoclave bottle <br />
* Petri dishes<br />
<br />
<br />
'''Protocol''' <br />
# Weigh 25g of LB-Agar powder mix (or 15g LB powder + 10g agar) per liter of media desired. One liter makes 40-50 plates<br />
# Select an appropriate bottle and dissolve LB-Agar in autoclaved Mili-Q water. Add a stir bar and use a magnetic stirrer to speed dissolve process<br />
# Cover the bottle with aluminum foil, and secure the foil with autoclave tape. The foil should be somewhat loose (to avoid building pressure in the bottle while sterilizing and blowing the foil off).<br />
# Load the bottle into the autoclave, and sterilize it <br />
# Once the autoclave finishes venting (which can take twice as long as the sterilization proper), Unload the hot bottle using the insulated oven gloves <br />
# Allow the media to cool until it can be handled without the oven mits. <br />
# Once media is cool, add appropriate amount of ampicilin stock (stock 50mg/ml, final 100ug/ml, To achieve final concentrations, add 2mL of stock per 1L of media), use the magnetic stirrer (added before autoclave) to mix. <br />
# Pour directly from the bottle into sterile petri plates. Use a inoculation loop to snuff out bubbles that form during pouring. Bubbles can allow cells to access nutrients without being exposed to the plate's antibiotic, and should be blown out immediately before the gel can set.<br />
# Allow the plates to stand right side up until the gel sets. Plates should be stored upside down to keep condensation from falling on the media. Store petri plates in the plastic bags they ship in, in the 4°C fridge.<br />
<br />
<br />
<br />
== Transformation == <br />
(''Estimated time: 3 hours and 30 min + 12-16 hours overnight incubation'') <br />
<br />
<br />
'''Materials needed'''<br />
* LB agar plates with proper antibiotic added (Ampicilin) <br />
* Thawed Invitrogen TOP10 cells (every tube contains 50 µl of cell suspension) <br />
* Resuspended DNA <br />
* SOC medium <br />
<br />
<br />
'''Protocol''' <br />
# Put 4-6 µl of DNA resuspension into TOP10 tube. <br />
# Incubate on ice for 30 min. <br />
# Heat shock: 42°C for 1 min. <br />
# Put transformed TOP10 tube on ice for 2mins and then add 200 µl SOC medium into the tube. <br />
# Incubate for 1 hour at 37°C, 225 rpm. <br />
# Plate 200 µl of solution on a proper agar plate (with Ampicilin resistence). <br />
# Incubate overnight at 37°C. <br />
<br />
<br />
<br />
== Inoculation for overnight growth == <br />
(''Estimated time: 10 min + 12-16 hours overnight incubation'') <br />
<br />
<br />
'''Materials needed''' <br />
* 50mL Falcon tube.<br />
* 5 mL LB medium <br />
* Suitable Antibiotic <br />
* Single colonies on a plate<br />
<br />
<br />
'''Protocol''' <br />
# Pipet 5uL 1000X antibiotic into culture tube <br />
# Add 5mL LB medium with Ampicilin resistance<br />
# Select a single colony using a sterile inoculation loop <br />
# Place inoculation loop in culture tube and stir <br />
# Remove inoculation loop and place culture tube in incubator at 37°C overnight shaking vigorously (250 rpm) <br />
<br />
<br />
<br />
== Agarose Gel preparation and ruuning == <br />
(''Estimated time: 2 hours'') <br />
<br />
<br />
'''Materials needed''' <br />
* 1X TAE <br />
* 125 mL flask <br />
* Agarose <br />
* Gel Pouring Tray <br />
* Tape <br />
* Gel rig <br />
<br />
<br />
'''Protocol''' <br />
# Measure out 40mL of 1X TAE buffer <br />
# Transfer buffer to 125 mL flask <br />
# Weigh out 0.4g agarose to make a 1% gel <br />
# Transfer agarose to 125mL flask <br />
# Melt agarose in microwave for 30 seconds, <br />
# Take out the flask and shake it gently <br />
# Again,put the flask in the microwave for 30 seconds<br />
# Assemble the gel pouring apparatus by inserting gate into slots. <br />
# Allow gel to cool until flask can be handled comfortably <br />
# Add the stain (4 ul for 40 ml TAE) and shake gentely to mix.<br />
# Place comb in the gel rig <br />
# Pour agarose into gel tray <br />
# Allow to solidify. While the gel is solidifying prepare the samples. Mix 10 µl DNA sample with 2 µl 6X loading dye for each slot.<br />
# Pour 1X TAE over gel so that gel is covered by a 3-5mm buffer <br />
# Load samples into lane (Don't forget to load 5 µl 1kb+ ladder into one of the lanes) <br />
# Hook electrodes to gel apparatus <br />
# Run the apparatus at 120V for 45 minutes <br />
# Visualize the gel and record the results <br />
<br />
<br />
<br />
== Preparation of Top 10 chemical competent cells == <br />
(''Estimated time: 2 hours'') <br />
<br />
<br />
'''Materials needed''' <br />
* Top10 Ecoli cell <br />
* 50 mL centrifuge tubes <br />
* 1.5 mL small tubes<br />
* LB agar plate <br />
* LB medium <br />
* Chilled 0.1 M ice-cold MgCl2<br />
* Chilled 0.1 M ice-cold CaCl2 <br />
* Chilled 0.1 M CaCl2 / 15 %glycerol<br />
<br />
<br />
'''Protocol''' <br />
# Steak a loopful of Top10 Escherichia coli onto a fresh LB agar plate (without selective antibiotics) and incubated at 37 oC overnight. <br />
# Inoculate a single isolated colony of the Top10 E. coli into 5 ml of LB broth (without selective antibiotics) and incubated with shaking at 250 rpm overnight in a 37oC shaking incubator overnight.<br />
# Scale up the bacteria culture 100 times into 100 ml of fresh LB and grow to OD 600nm of 0.3 to 0.4 (2-3 hours). The current culture is in the exponential phase <br />
# Aliquot the above culture into two 50 ml pre-chilled centrifuge tubes <br />
# Incubate the two 50 ml tubes on ice for 10 min. <br />
# Centrifuge the two tubes of Top10 cells for 5 min at 5,000 rpm at 4 °C. <br />
# Decant the supernatant and re-suspend cells pellet in 30 ml of 0.1 M ice-cold MgCl2 thoroughly for each tube. <br />
# Centrifuge the mixture in the two tubes for 5 min at 5,000 rpm in 4 °C. <br />
# Decant the supernatant and re-suspend cells pellet in 20 ml of 0.1 M ice-cold CaCl2 for each tube <br />
# Incubate on ice for 30 min. <br />
# Centrifuge the mixture in the two tubes for 5 min at 5,000 rpm in 4 °C. <br />
# Decant the supernatant and re-suspend cells pellet in 1.5 ml of ice-cold 0.1 M CaCl2 / 15 %glycerol for each tube<br />
# Aliquot the cell suspension into 60 X 1.5 mL tubes each with 50 µl cell suspension <br />
# Store in - 80 °C deep freezer before use.<br />
<br />
<br />
<br />
== Nano-drop to measure DNA concentration== <br />
(''Estimated time: 10~20 mins'') <br />
<br />
<br />
'''Materials needed''' <br />
* DNA suspension in EB <br />
* NanoDrop ND-1000 Spectrophotometer<br />
<br />
<br />
'''Protocol''' <br />
# Start up software by clicking on shortcut<br />
# Chose measurement (Nucleic acid for DNA and RNA samples)<br />
# Clean pedestals with tissue with MilliQ water<br />
# The software asks for a testmeasurement with MilliQwater: Add 1.8 μl of MilliQ water to front pedestal and click “OK”<br />
# Add 1.8 μl of a Blank (DNA: EB) to pedestal and click “Blank”. <br />
# Add 1.8 μl of sample, click “Measure”, note results and type in a sample name in the software window<br />
# Several different values can be read: <br />
# DNA or RNA conc. in ng/microliter at 260 nm<br />
# Protein conc. at 230 nm<br />
# Quality at 260:280 (should be around 1.9)<br />
# Clean pedestals with tissue before measuring next sample<br />
# Close software by clicking “Exit” (twice)<br />
# Retrieve data by clicking on shortcut to “nanodrop data”<br />
<br />
<br />
<br />
== SDS Page for protein ==<br />
(''Estimated time: 2~3hrs'') <br />
<br />
<br />
'''Materials needed''' <br />
# SDS page kit (invitrogen)<br />
# Overnight cell culture<br />
<br />
<br />
'''Protocol''' <br />
# Inoculate interested colony in LB medium at 37°C overnight (250 rpm)<br />
# Dilute the above cell culture to 100 times in flask with LB (0.5mL in 50mL LB)<br />
# Incubate the flask until the culture OD ~= 0.8 <br />
# Divide the above cell culture into two flask each with ~25mL<br />
# One flask is for control while the other one for experiment <br />
# Incubate until OD=1.6 <br />
# Pipette 1mL cell culture from the above two flask and centrifuge at 12000rpm for 10 mins<br />
# Re-suspend the cell in 150 µL TE buffer <br />
# Pipette 15 µL cell sample into two fresh 1.5mL tubes<br />
# Add 15 µL sample buffer into the above two tubes<br />
# Let the tubes stands in boiling water for 10 mins<br />
# Take the gel out of fridge for it to thaw<br />
# Spin down the vapor and Load 15 µL sample into each slot<br />
# Gel run at 200V for 30mins <br />
# Remove the cover and extract out the gel<br />
# Wash and stain for 1~2hrs<br />
# Wash and de-stain for overnight <br />
# check gel band by densitometer <br />
<br />
<br />
'''Notes'''<br />
* Sample buffer lyses the cell and bind to the protein <br />
* After staining, the entire gel show blue color, the de-stain procedure is to remove the straining, however, the site where protein resides will remain blue since stain bind to the protein<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/ProtocolsTeam:NTU-Singapore/Notebook/Protocols2009-10-21T14:37:18Z<p>Sjee: </p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Our <span class="bold">Protocols</span></span><br class="clear" /><br />
<br />
<br />
<br />
== Plasmid resuspension from IGEM paper spots and well ==<br />
(''Estimated time: 25 min + 5 min for every part if you use scalpel/tweezers or + 15 min for every part if you use punch tool'') <br />
<br />
'''Materials needed''' : <br />
* Pre-warmed at 42°C TE <br />
* Desired spot location information <br />
* punch tool<br />
* ddH20 <br />
* 99% ethanol <br />
* 0.5 ml tubes <br />
<br />
'''Protocol''' <br />
# Put 10 µL of pre-warmed TE into a 0.5 ml tube. <br />
# Cut paper spots using punch tool, following the instructions provided with the IGEM kit. <br />
# Put the cut paper into the 0.5 ml tube. <br />
# Clean punch tool with water and ethanol every time after cutting a spot; be careful to dry the punch tool. <br />
# Incubate at 42°C for 20 min. <br />
# Vortex and spin down. <br />
# Pipttee 4-6 µl of DNA resuspension for transformation <br />
<br />
<br />
== Plasmid resuspension from Well ==<br />
<br />
'''Materials Needed'''<br />
* DI water<br />
<br />
'''Protocol'''<br />
# With a pipette tip, punch a hole through the foil cover into the corresponding well to the Biobrick™-standard part that you want. Make sure oriented the plate is properly oriented. Foil cover is recommended not to be removed, as it could lead to cross contamination between the wells.<br />
# Add 15uL of diH2O (deionized water)<br />
# Take 2uL DNA and transform into your desired competent cells, plate bacteria with the appropriate antibiotic* and grow overnight.<br />
# Pick a single colony and inoculate broth (again, with the correct antibiotic) and grow for 18 hours.<br />
# Use the resulting culture to miniprep the DNA AND make your own glycerol stock<br />
<br />
<br />
== BioBrick digestion with restriction enzymes == <br />
(''estimated time: 3 hours'') <br />
<br />
'''Materials needed: Double Digestion mixture composition (total volume: 50 µL)'''<br />
* DNA 1mg (usually 4~5 µL)<br />
* Enzyme-1 1 µL<br />
* Enzyme-2 1 µL<br />
* NEBBuffer-2 5 µL (1/10 of total volume, check double digestion table for which buffer to use)<br />
* BSA 0.5 µL (1/10 of buffer volume)<br />
* Mili-Q water 37.5 µL <br />
<br />
'''Protocol''' <br />
# Measure plasmid concentration by Nano-drop <br />
# Pipette apropraite amount of vector (usually 4~5 µl for 1 µg)<br />
# Take out NEBuffer and BSA to thaw (usually stored at -20 deg C), vortex for well mix<br />
# Adding the following components sequentially into 200 µL PCR tube, following the order: Mili-Q water → Enzyme Buffer → BSA (optional) → DNA → Enzyme<br />
# Pulse spin the tube and incubate at 37 deg C for 2 hours (2.5hrs)<br />
# Do MiniElute PCR purification for all the tubes to remove enzymes and buffers <br />
# Load the 10 µL plasmid with 2 µL loading dye for gel running<br />
<br />
'''Notes''' <br />
*check 37 deg C incubator is on, take out buffer, BSA, to thaw and vortex before adding, when adding buffer, enzymes, DNA (not BSA), putting the whole pipette tip into the solution, and then pipette up and down. For adding BSA, just push strongly and fast all the way down.<br />
<br />
<br />
== LB - Agar Plate Preparation Protocol == <br />
(''Estimated time: 3 hours + 1 hour pouring process'') <br />
<br />
'''Materials needed''' <br />
* LB broth <br />
* Agar <br />
* Autoclave bottle <br />
* Petri dishes<br />
<br />
'''Protocol''' <br />
# Weigh 25g of LB-Agar powder mix (or 15g LB powder + 10g agar) per liter of media desired. One liter makes 40-50 plates<br />
# Select an appropriate bottle and dissolve LB-Agar in autoclaved Mili-Q water. Add a stir bar and use a magnetic stirrer to speed dissolve process<br />
# Cover the bottle with aluminum foil, and secure the foil with autoclave tape. The foil should be somewhat loose (to avoid building pressure in the bottle while sterilizing and blowing the foil off).<br />
# Load the bottle into the autoclave, and sterilize it <br />
# Once the autoclave finishes venting (which can take twice as long as the sterilization proper), Unload the hot bottle using the insulated oven gloves <br />
# Allow the media to cool until it can be handled without the oven mits. <br />
# Once media is cool, add appropriate amount of ampicilin stock (stock 50mg/ml, final 100ug/ml, To achieve final concentrations, add 2mL of stock per 1L of media), use the magnetic stirrer (added before autoclave) to mix. <br />
# Pour directly from the bottle into sterile petri plates. Use a inoculation loop to snuff out bubbles that form during pouring. Bubbles can allow cells to access nutrients without being exposed to the plate's antibiotic, and should be blown out immediately before the gel can set.<br />
# Allow the plates to stand right side up until the gel sets. Plates should be stored upside down to keep condensation from falling on the media. Store petri plates in the plastic bags they ship in, in the 4°C fridge.<br />
<br />
<br />
== Transformation == <br />
(''Estimated time: 3 hours and 30 min + 12-16 hours overnight incubation'') <br />
<br />
'''Materials needed'''<br />
* LB agar plates with proper antibiotic added (Ampicilin) <br />
* Thawed Invitrogen TOP10 cells (every tube contains 50 µl of cell suspension) <br />
* Resuspended DNA <br />
* SOC medium <br />
<br />
'''Protocol''' <br />
# Put 4-6 µl of DNA resuspension into TOP10 tube. <br />
# Incubate on ice for 30 min. <br />
# Heat shock: 42°C for 1 min. <br />
# Put transformed TOP10 tube on ice for 2mins and then add 200 µl SOC medium into the tube. <br />
# Incubate for 1 hour at 37°C, 225 rpm. <br />
# Plate 200 µl of solution on a proper agar plate (with Ampicilin resistence). <br />
# Incubate overnight at 37°C. <br />
<br />
<br />
== Inoculation for overnight growth == <br />
(''Estimated time: 10 min + 12-16 hours overnight incubation'') <br />
<br />
'''Materials needed''' <br />
* 50mL Falcon tube.<br />
* 5 mL LB medium <br />
* Suitable Antibiotic <br />
* Single colonies on a plate<br />
<br />
'''Protocol''' <br />
# Pipet 5uL 1000X antibiotic into culture tube <br />
# Add 5mL LB medium with Ampicilin resistance<br />
# Select a single colony using a sterile inoculation loop <br />
# Place inoculation loop in culture tube and stir <br />
# Remove inoculation loop and place culture tube in incubator at 37°C overnight shaking vigorously (250 rpm) <br />
<br />
<br />
== Agarose Gel preparation and ruuning == <br />
(''Estimated time: 2 hours'') <br />
<br />
'''Materials needed''' <br />
* 1X TAE <br />
* 125 mL flask <br />
* Agarose <br />
* Gel Pouring Tray <br />
* Tape <br />
* Gel rig <br />
<br />
'''Protocol''' <br />
# Measure out 40mL of 1X TAE buffer <br />
# Transfer buffer to 125 mL flask <br />
# Weigh out 0.4g agarose to make a 1% gel <br />
# Transfer agarose to 125mL flask <br />
# Melt agarose in microwave for 30 seconds, <br />
# Take out the flask and shake it gently <br />
# Again,put the flask in the microwave for 30 seconds<br />
# Assemble the gel pouring apparatus by inserting gate into slots. <br />
# Allow gel to cool until flask can be handled comfortably <br />
# Add the stain (4 ul for 40 ml TAE) and shake gentely to mix.<br />
# Place comb in the gel rig <br />
# Pour agarose into gel tray <br />
# Allow to solidify. While the gel is solidifying prepare the samples. Mix 10 µl DNA sample with 2 µl 6X loading dye for each slot.<br />
# Pour 1X TAE over gel so that gel is covered by a 3-5mm buffer <br />
# Load samples into lane (Don't forget to load 5 µl 1kb+ ladder into one of the lanes) <br />
# Hook electrodes to gel apparatus <br />
# Run the apparatus at 120V for 45 minutes <br />
# Visualize the gel and record the results <br />
<br />
<br />
== Preparation of Top 10 chemical competent cells == <br />
(''Estimated time: 2 hours'') <br />
<br />
'''Materials needed''' <br />
* Top10 Ecoli cell <br />
* 50 mL centrifuge tubes <br />
* 1.5 mL small tubes<br />
* LB agar plate <br />
* LB medium <br />
* Chilled 0.1 M ice-cold MgCl2<br />
* Chilled 0.1 M ice-cold CaCl2 <br />
* Chilled 0.1 M CaCl2 / 15 %glycerol<br />
<br />
'''Protocol''' <br />
# Steak a loopful of Top10 Escherichia coli onto a fresh LB agar plate (without selective antibiotics) and incubated at 37 oC overnight. <br />
# Inoculate a single isolated colony of the Top10 E. coli into 5 ml of LB broth (without selective antibiotics) and incubated with shaking at 250 rpm overnight in a 37oC shaking incubator overnight.<br />
# Scale up the bacteria culture 100 times into 100 ml of fresh LB and grow to OD 600nm of 0.3 to 0.4 (2-3 hours). The current culture is in the exponential phase <br />
# Aliquot the above culture into two 50 ml pre-chilled centrifuge tubes <br />
# Incubate the two 50 ml tubes on ice for 10 min. <br />
# Centrifuge the two tubes of Top10 cells for 5 min at 5,000 rpm at 4 °C. <br />
# Decant the supernatant and re-suspend cells pellet in 30 ml of 0.1 M ice-cold MgCl2 thoroughly for each tube. <br />
# Centrifuge the mixture in the two tubes for 5 min at 5,000 rpm in 4 °C. <br />
# Decant the supernatant and re-suspend cells pellet in 20 ml of 0.1 M ice-cold CaCl2 for each tube <br />
# Incubate on ice for 30 min. <br />
# Centrifuge the mixture in the two tubes for 5 min at 5,000 rpm in 4 °C. <br />
# Decant the supernatant and re-suspend cells pellet in 1.5 ml of ice-cold 0.1 M CaCl2 / 15 %glycerol for each tube<br />
# Aliquot the cell suspension into 60 X 1.5 mL tubes each with 50 µl cell suspension <br />
# Store in - 80 °C deep freezer before use.<br />
<br />
<br />
== Nano-drop to measure DNA concentration== <br />
(''Estimated time: 10~20 mins'') <br />
<br />
'''Materials needed''' <br />
* DNA suspension in EB <br />
* NanoDrop ND-1000 Spectrophotometer<br />
<br />
'''Protocol''' <br />
# Start up software by clicking on shortcut<br />
# Chose measurement (Nucleic acid for DNA and RNA samples)<br />
# Clean pedestals with tissue with MilliQ water<br />
# The software asks for a testmeasurement with MilliQwater: Add 1.8 μl of MilliQ water to front pedestal and click “OK”<br />
# Add 1.8 μl of a Blank (DNA: EB) to pedestal and click “Blank”. <br />
# Add 1.8 μl of sample, click “Measure”, note results and type in a sample name in the software window<br />
# Several different values can be read: <br />
# DNA or RNA conc. in ng/microliter at 260 nm<br />
# Protein conc. at 230 nm<br />
# Quality at 260:280 (should be around 1.9)<br />
# Clean pedestals with tissue before measuring next sample<br />
# Close software by clicking “Exit” (twice)<br />
# Retrieve data by clicking on shortcut to “nanodrop data”<br />
<br />
<br />
== SDS Page for protein ==<br />
(''Estimated time: 2~3hrs'') <br />
<br />
'''Materials needed''' <br />
# SDS page kit (invitrogen)<br />
# Overnight cell culture<br />
<br />
'''Protocol''' <br />
# Inoculate interested colony in LB medium at 37°C overnight (250 rpm)<br />
# Dilute the above cell culture to 100 times in flask with LB (0.5mL in 50mL LB)<br />
# Incubate the flask until the culture OD ~= 0.8 <br />
# Divide the above cell culture into two flask each with ~25mL<br />
# One flask is for control while the other one for experiment <br />
# Incubate until OD=1.6 <br />
# Pipette 1mL cell culture from the above two flask and centrifuge at 12000rpm for 10 mins<br />
# Re-suspend the cell in 150 µL TE buffer <br />
# Pipette 15 µL cell sample into two fresh 1.5mL tubes<br />
# Add 15 µL sample buffer into the above two tubes<br />
# Let the tubes stands in boiling water for 10 mins<br />
# Take the gel out of fridge for it to thaw<br />
# Spin down the vapor and Load 15 µL sample into each slot<br />
# Gel run at 200V for 30mins <br />
# Remove the cover and extract out the gel<br />
# Wash and stain for 1~2hrs<br />
# Wash and de-stain for overnight <br />
# check gel band by densitometer <br />
<br />
'''Notes'''<br />
* Sample buffer lyses the cell and bind to the protein <br />
* After staining, the entire gel show blue color, the de-stain procedure is to remove the straining, however, the site where protein resides will remain blue since stain bind to the protein<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/Notebook/ProtocolsTeam:NTU-Singapore/Notebook/Protocols2009-10-21T14:17:25Z<p>Sjee: </p>
<hr />
<div>{{Template:NTUGlobalt}}<br />
<br />
<div id="plaquebanner" class="clearfix"><br />
<div id="ntunotebook" class="grid_16"><br />
<span class="hidden">Welcome to the notebook page!</span><br />
</div><br />
</div><br />
<div id="menu" class="hp clearfix main"><div class="grid_4 link"><span class="gray">A record of our exploits.</span></div><div class="grid_1 link">[[Team:NTU-Singapore | Home]]</div><div class="grid_2 link">[[Team:NTU-Singapore/Project | pLaq''U''<span class="sup">e</span> Out!]]</div><div class="grid_2 link">[[Team:NTU-Singapore/HPA | DIYbio]]</div><div class="grid_3 link">[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments!]]</div><div class="grid_2 link selflink">[[Team:NTU-Singapore/Notebook | <span class="selflink">Notebook</span>]]</div><div class="grid_2 link">[[Team:NTU-Singapore/About/Team | About Us]]</div></div><br />
<br />
<div id="ntucontent"><br />
<br />
<div class="grid_11 prefix_1 suffix_1" id="note"><br />
<span class="title">Our <span class="bold">Protocols</span></span><br class="clear" /><br />
<br />
<br />
<br />
== Plasmid resuspension from IGEM paper spots and well ==<br />
(''Estimated time: 25 min + 5 min for every part if you use scalpel/tweezers or + 15 min for every part if you use punch tool'') <br />
<br />
'''Materials needed''' : <br />
* Pre-warmed at 42°C TE <br />
* Desired spot location information <br />
* punch tool<br />
* ddH20 <br />
* 99% ethanol <br />
* 0.5 ml tubes <br />
<br />
'''Protocol''' <br />
# Put 10 µL of pre-warmed TE into a 0.5 ml tube. <br />
# Cut paper spots using punch tool, following the instructions provided with the IGEM kit. <br />
# Put the cut paper into the 0.5 ml tube. <br />
# Clean punch tool with water and ethanol every time after cutting a spot; be careful to dry the punch tool. <br />
# Incubate at 42°C for 20 min. <br />
# Vortex and spin down. <br />
# Pipttee 4-6 µl of DNA resuspension for transformation <br />
<br />
<br />
== Plasmid resuspension from Well ==<br />
<br />
'''Materials Needed'''<br />
* DI water<br />
<br />
'''Protocol'''<br />
# With a pipette tip, punch a hole through the foil cover into the corresponding well to the Biobrick™-standard part that you want. Make sure oriented the plate is properly oriented. Foil cover is recommended not to be removed, as it could lead to cross contamination between the wells.<br />
# Add 15uL of diH2O (deionized water)<br />
# Take 2uL DNA and transform into your desired competent cells, plate bacteria with the appropriate antibiotic* and grow overnight.<br />
# Pick a single colony and inoculate broth (again, with the correct antibiotic) and grow for 18 hours.<br />
# Use the resulting culture to miniprep the DNA AND make your own glycerol stock<br />
<br />
<br />
== BioBrick digestion with restriction enzymes == <br />
(''estimated time: 3 hours'') <br />
<br />
'''Materials needed: Double Digestion mixture composition (total volume: 50 µL)'''<br />
* DNA 1mg (usually 4~5 µL)<br />
* Enzyme-1 1 µL<br />
* Enzyme-2 1 µL<br />
* NEBBuffer-2 5 µL (1/10 of total volume, check double digestion table for which buffer to use)<br />
* BSA 0.5 µL (1/10 of buffer volume)<br />
* Mili-Q water 37.5 µL <br />
<br />
'''Protocol''' <br />
# Measure plasmid concentration by Nano-drop <br />
# Pipette apropraite amount of vector (usually 4~5 µl for 1 µg)<br />
# Take out NEBuffer and BSA to thaw (usually stored at -20 deg C), vortex for well mix<br />
# Adding the following components sequentially into 200 µL PCR tube, following the order: Mili-Q water → Enzyme Buffer → BSA (optional) → DNA → Enzyme<br />
# Pulse spin the tube and incubate at 37 deg C for 2 hours (2.5hrs)<br />
# Do MiniElute PCR purification for all the tubes to remove enzymes and buffers <br />
# Load the 10 µL plasmid with 2 µL loading dye for gel running<br />
<br />
'''Notes''' <br />
check 37 deg C incubator is on, take out buffer, BSA, to thaw and vortex before adding, when adding buffer, enzymes, DNA (not BSA), putting the whole pipette tip into the solution, and then pipette up and down. For adding BSA, just push strongly and fast all the way down.<br />
<br />
<br />
== LB - Agar Plate Preparation Protocol == <br />
(''Estimated time: 3 hours + 1 hour pouring process'') <br />
<br />
Materials needed: <br />
1. LB broth <br />
2. Agar <br />
3. Autoclave bottle <br />
4. Petri dishes<br />
Protocol <br />
1. Weigh 25g of LB-Agar powder mix (or 15g LB powder + 10g agar) per liter of media desired. One liter makes 40-50 plates<br />
2. Select an appropriate bottle and dissolve LB-Agar in autoclaved Mili-Q water. Add a stir bar and use a magnetic stirrer to speed dissolve process<br />
3. Cover the bottle with aluminum foil, and secure the foil with autoclave tape. The foil should be somewhat loose (to avoid building pressure in the bottle while sterilizing and blowing the foil off).<br />
4. Load the bottle into the autoclave, and sterilize it <br />
5. Once the autoclave finishes venting (which can take twice as long as the sterilization proper), Unload the hot bottle using the insulated oven gloves <br />
6. Allow the media to cool until it can be handled without the oven mits. <br />
7. Once media is cool, add appropriate amount of ampicilin stock (stock 50mg/ml, final 100ug/ml, To achieve final concentrations, add 2mL of stock per 1L of media), use the magnetic stirrer (added before autoclave) to mix. <br />
8. Pour directly from the bottle into sterile petri plates. Use a inoculation loop to snuff out bubbles that form during pouring. Bubbles can allow cells to access nutrients without being exposed to the plate's antibiotic, and should be blown out immediately before the gel can set.<br />
9. Allow the plates to stand right side up until the gel sets. Plates should be stored upside down to keep condensation from falling on the media. Store petri plates in the plastic bags they ship in, in the 4°C fridge.<br />
<br />
<br />
<br />
<br />
<br />
<br />
Transformation <br />
(Estimated time: 3 hours and 30 min + 12-16 hours overnight incubation) <br />
<br />
Materials needed: <br />
1. LB agar plates with proper antibiotic added (Ampicilin) <br />
2. Thawed Invitrogen TOP10 cells (every tube contains 50 µl of cell suspension) <br />
3. Resuspended DNA <br />
4. SOC medium <br />
Protocol <br />
1. Put 4-6 µl of DNA resuspension into TOP10 tube. <br />
2. Incubate on ice for 30 min. <br />
3. Heat shock: 42°C for 1 min. <br />
4. Put transformed TOP10 tube on ice for 2mins and then add 200 µl SOC medium into the tube. <br />
5. Incubate for 1 hour at 37°C, 225 rpm. <br />
6. Plate 200 µl of solution on a proper agar plate (with Ampicilin resistence). <br />
7. Incubate overnight at 37°C. <br />
<br />
<br />
Inoculation for overnight growth <br />
(Estimated time: 10 min + 12-16 hours overnight incubation) <br />
<br />
Materials needed: <br />
1. 50mL culture tube.<br />
2. 5 mL LB medium with Ampicilin resistance <br />
3. Single colonies on a plate<br />
Protocol <br />
1. Pipet 5uL 1000X antibiotic into culture tube <br />
2. Add 5mL LB medium with Ampicilin resistance<br />
3. Select a single colony using a sterile inoculation loop <br />
4. Place inoculation loop in culture tube and stir <br />
5. Remove inoculation loop and place culture tube in incubator at 37°C overnight shaking vigorously (250 rpm) <br />
<br />
<br />
Agarose Gel preparation and ruuning <br />
(Estimated time: 2 hours) <br />
<br />
Materials needed: <br />
1. 1X TAE <br />
2. 125 mL flask <br />
3. Agarose <br />
4. Gel Pouring Tray <br />
5. Tape <br />
6. Gel rig <br />
Protocol <br />
1. Measure out 40mL of 1X TAE buffer <br />
2. Transfer buffer to 125 mL flask <br />
3. Weigh out 0.4g agarose to make a 1% gel <br />
4. Transfer agarose to 125mL flask <br />
5. Melt agarose in microwave for 30 seconds, <br />
6. Take out the flask and shake it gently <br />
7. Again Put the flask in the microwave for 30 seconds<br />
8. Assemble the gel pouring apparatus by inserting gate into slots. <br />
9. Allow gel to cool until flask can be handled comfortably <br />
10. Add the stain (4 ul for 40 ml TAE) and shake gentely to mix.<br />
11. Place comb in the gel rig <br />
12. Pour agarose into gel tray <br />
13. Allow to solidify. While the gel is solidifying prepare the samples. Mix 10 µl DNA sample with 2 µl 6X loading dye for each slot.<br />
14. Pour 1X TAE over gel so that gel is covered by a 3-5mm buffer <br />
15. Load samples into lane (Don't forget to load 5 µl 1kb+ ladder into one of the lanes) <br />
16. Hook electrodes to gel apparatus <br />
17. Run the apparatus at 120V for 45 minutes <br />
18. Visualize the gel and record the results <br />
<br />
<br />
Preparation of Top 10 chemical competent cells <br />
(Estimated time: 2 hours) <br />
<br />
Materials needed: <br />
1. Top10 Ecoli cell <br />
2. 50 mL centrifuge tubes <br />
3. 1.5 mL small tubes<br />
4. LB agar plate <br />
5. LB medium <br />
6. Chilled 0.1 M ice-cold MgCl2<br />
7. Chilled 0.1 M ice-cold CaCl2 <br />
8. Chilled 0.1 M CaCl2 / 15 %glycerol<br />
Protocol <br />
1. Steak a loopful of Top10 Escherichia coli onto a fresh LB agar plate (without selective antibiotics) and incubated at 37 oC overnight. <br />
2. Inoculate a single isolated colony of the Top10 E. coli into 5 ml of LB broth (without selective antibiotics) and incubated with shaking at 250 rpm overnight in a 37oC shaking incubator overnight.<br />
3. Scale up the bacteria culture 100 times into 100 ml of fresh LB and grow to OD 600nm of 0.3 to 0.4 (2-3 hours). The current culture is in the exponential phase <br />
4. Aliquot the above culture into two 50 ml pre-chilled centrifuge tubes <br />
5. Incubate the two 50 ml tubes on ice for 10 min. <br />
6. Centrifuge the two tubes of Top10 cells for 5 min at 5,000 rpm at 4 °C. <br />
7. Decant the supernatant and re-suspend cells pellet in 30 ml of 0.1 M ice-cold MgCl2 thoroughly for each tube. <br />
8. Centrifuge the mixture in the two tubes for 5 min at 5,000 rpm in 4 °C. <br />
9. Decant the supernatant and re-suspend cells pellet in 20 ml of 0.1 M ice-cold CaCl2 for each tube <br />
10. Incubate on ice for 30 min. <br />
11. Centrifuge the mixture in the two tubes for 5 min at 5,000 rpm in 4 °C. <br />
12. Decant the supernatant and re-suspend cells pellet in 1.5 ml of ice-cold 0.1 M CaCl2 / 15 %glycerol for each tube<br />
13. Aliquot the cell suspension into 60 X 1.5 mL tubes each with 50 µl cell suspension <br />
14. Store in - 80 °C deep freezer before use.<br />
<br />
<br />
Nano-drop to measure DNA concentration <br />
(Estimated time: 10~20 mins) <br />
<br />
Materials needed: <br />
1. DNA suspension in EB <br />
2. NanoDrop ND-1000 Spectrophotometer<br />
Protocol <br />
1. Start up software by clicking on shortcut<br />
2. Chose measurement (Nucleic acid for DNA and RNA samples)<br />
3. Clean pedestals with tissue with MilliQ water<br />
4. The software asks for a testmeasurement with MilliQwater: Add 1.8 μl of MilliQ water to front pedestal and click “OK”<br />
5. Add 1.8 μl of a Blank (DNA: EB) to pedestal and click “Blank”. <br />
6. Add 1.8 μl of sample, click “Measure”, note results and type in a sample name in the software window<br />
7. Several different values can be read: <br />
8. DNA or RNA conc. in ng/microliter at 260 nm<br />
9. Protein conc. at 230 nm<br />
10. Quality at 260:280 (should be around 1.9)<br />
11. Clean pedestals with tissue before measuring next sample<br />
12. Close software by clicking “Exit” (twice)<br />
13. Retrieve data by clicking on shortcut to “nanodrop data”<br />
<br />
<br />
SDS Page for protein <br />
(Estimated time: 2~3hrs) <br />
<br />
Materials needed: <br />
1. SDS page kit (invitrogen)<br />
2. Overnight cell culture<br />
Protocol <br />
1. Inoculate interested colony in LB medium at 37°C overnight (250 rpm)<br />
2. Dilute the above cell culture to 100 times in flask with LB (0.5mL in 50mL LB)<br />
3. Incubate the flask until the culture OD ~= 0.8 <br />
4. Divide the above cell culture into two flask each with ~25mL<br />
o One flask is for control while the other one for experiment <br />
5. Incubate until OD=1.6 <br />
6. Pipette 1mL cell culture from the above two flask and centrifuge at 12000rpm for 10 mins<br />
7. Re-suspend the cell in 150 µL TE buffer <br />
8. Pipette 15 µL cell sample into two fresh 1.5mL tubes<br />
9. Add 15 µL sample buffer into the above two tubes<br />
10. Let the tubes stands in boiling water for 10 mins<br />
11. Take the gel out of fridge for it to thaw<br />
12. Spin down the vapor and Load 15 µL sample into each slot<br />
13. Gel run at 200V for 30mins <br />
14. Remove the cover and extract out the gel<br />
15. Wash and stain for 1~2hrs<br />
16. Wash and de-stain for overnight <br />
17. check gel band by densitometer <br />
Notes: <br />
1. Sample buffer lyses the cell and bind to the protein <br />
2. After staining, the entire gel show blue color, the de-stain procedure is to remove the straining, however, the site where protein resides will remain blue since stain bind to the protein<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<div class="wrap_3" id="submenu"><br />
<div class="subtitle contrast grid_3 clearfix"><br />
<span>Navigation</span><br />
</div><br />
<br />
<div class="grid_3 submenu"><br />
[[Team:NTU-Singapore/Notebook | What we did]]<br />
[[Team:NTU-Singapore/Notebook/Deliverables | Accomplishments]]<br />
[[Team:NTU-Singapore/Notebook/Safety | Safety]]<br />
[[Team:NTU-Singapore/Notebook/Protocols | Our protocols]]<br />
[[Team:NTU-Singapore/Notebook/Brainstorming | Brainstorming ideas]]<br />
[[Team:NTU-Singapore/Notebook/Links | Online resources]]<br />
</div></div><br />
<br />
</div><br class="clear" /><br />
<br />
<br />
<div id="ntufooter"><br />
<br />
<div class="grid_14 contrast omega alpha"><br />
<div style="padding-left:10px;">NTU@iGEM<sup>cc</sup> 2009. Some rights reserved.</div><br />
</div><br />
<br />
<div class="grid_2 textright"><br />
<html><a href="https://2009.igem.org/">iGEM '09</a> || <a href="#">TOP</a></html><br />
</div><br />
<br />
</div><br class="clear" /><br />
<br />
</div><br /><br /></div>Sjeehttp://2009.igem.org/Jamboree/Schedule/Practice_sessionsJamboree/Schedule/Practice sessions2009-10-12T06:32:28Z<p>Sjee: /* Friday October 30 : Practice Talks sign-up sheet */</p>
<hr />
<div>== Friday October 30 : Practice Talks sign-up sheet ==<br />
<!-- <span style="color:#D22325; font-weight:bold;">As the wiki has now been frozen, please email [[User:Meagan | Meagan]] with your team name and the letter and # of the slot that you would like to reserve.</span><br>--><br />
<br />
Use this sign-up sheet to sign up for a slot on Friday night (October 30) to practice your talk. Note that there will NOT be any A/V (audio/visual) support on staff. All classrooms will be unlocked and you should use them and leave them as you found them. <br />
<br />
There are a limited number of time slots available on a first-come first-serve basis so please only choose one slot. We cannot match the room that you will ultimately give your presentation in with the practice room. This should, however, give you a chance to practice your talk in a new environment.<br />
<br />
Also, there will also be pre-registration available beginning at 6pm. Conference services will be on-site to pass out team registration boxes (see the [[Jamboree | Jamboree]] page). <br />
<br />
<br />
(Pizza and refreshments will be available on a first-come first-serve basis)<br />
<br />
<br />
<html><br />
<link rel="stylesheet" href="http://parts.mit.edu/igem07/index.php?title=User:Macowell/schedule.css&action=raw&ctype=text/css"><br />
<table class="calendar"><h2 class="date"><a name="Friday Practice">Friday, November 7</a></h2><br />
<thead><br />
<tr><br />
<th width="15%">Time</th><br />
<th>room 32-123</th><br />
<th>room 32-141</th><br />
<th>room 32-155</th><br />
<th>room 32-G449</th><br />
<th>room 32-D463</th><br />
<th>room 32-261*</th><br />
<th>room 32-262*</th><br />
<th>room 32-346*</th><br />
<th>room 32-397*</th><br />
</tr><br />
</thead><br />
<tbody><br />
<tr class="even"><br />
<th>6:00p - 6:30p</th><br />
<td>Stanford</td><br />
<td>PKU_Beijing</td><br />
<td>C1</td><br />
<td>D1</td><br />
<td>E1</td><br />
<td>F1</td><br />
<td>G1</td><br />
<td>H1</td><br />
<td>I1</td><br />
</tr><br />
<tr class="odd"><br />
<th>6:30p - 7:00p</th><br />
<td>Warsaw</td><br />
<td>Southampton</td><br />
<td>C2</td><br />
<td>D2</td><br />
<td>E2</td><br />
<td>F2</td><br />
<td>G2</td><br />
<td>H2</td><br />
<td>I2</td><br />
</tr><br />
<tr class="even"><br />
<th>7:00p - 7:30p</th><br />
<td>IIT_Madras</td><br />
<td>Heidelberg</td><br />
<td>C3</td><br />
<td>D3</td><br />
<td>E3</td><br />
<td>F3</td><br />
<td>G3</td><br />
<td>H3</td><br />
<td>I3</td><br />
</tr><br />
<tr class="even"><br />
<th>7:30p - 8:00p</th><br />
<td>Tokyo_Tech</td><br />
<td>Tsinghua</td><br />
<td>C4</td><br />
<td>D4</td><br />
<td>E4</td><br />
<td>F4</td><br />
<td>G4</td><br />
<td>H4</td><br />
<td>I4</td><br />
</tr><br />
<tr class="odd"><br />
<th>8:00p - 8:30p</th><br />
<td>KULeuven</td><br />
<td>B5</td><br />
<td>C5</td><br />
<td>D5</td><br />
<td>E5</td><br />
<td>F5</td><br />
<td>G5</td><br />
<td>H5</td><br />
<td>I5</td><br />
</tr><br />
<tr class="even"><br />
<th>8:30p - 9:00p</th><br />
<td>USTC</td><br />
<td>NTU_Singapore</td><br />
<td>C6</td><br />
<td>D6</td><br />
<td>E6</td><br />
<td>F6</td><br />
<td>G6</td><br />
<td>H6</td><br />
<td>I6</td><br />
</tr><br />
<tr class="odd"><br />
<th>9:00p - 9:30p</th><br />
<td>USTC_Software</td><br />
<td>B7</td><br />
<td>C7</td><br />
<td>D7</td><br />
<td>E7</td><br />
<td>F7</td><br />
<td>G7</td><br />
<td>H7</td><br />
<td>I7</td><br />
</tr><br />
<tr class="even"><br />
<th>9:30p - 10:00p</th><br />
<td>A8</td><br />
<td>B8</td><br />
<td>C8</td><br />
<td>D8</td><br />
<td>E8</td><br />
<td>F8</td><br />
<td>G8</td><br />
<td>H8</td><br />
<td>I8</td><br />
</tr><br />
</tbody><br />
</table><br />
</html><br />
<br />
<br />
'''Important information for rooms marked with an asterisk (*):'''<br />
* Your team will be contacted to coordinate having an iGEM staff member escort you to these rooms as they are in a limited-access part of the Stata Center.<br />
* These rooms are smaller conference rooms throughout the Stata Center. <br />
* Saturday sessions will not be held in these rooms but in order to accommodate all teams who would like to practice their presentations in the 4-hour period on Friday night, we must open these rooms for practice sessions.</div>Sjeehttp://2009.igem.org/Team:NTU-Singapore/TeamTeam:NTU-Singapore/Team2009-07-21T06:34:24Z<p>Sjee: /* Advisors */</p>
<hr />
<div>{{Template:NTUGlobal}}<br />
<div class="grid_10"><br />
== The NTU iGEM '09 Team ==<br />
[[Image:NTUteam09-1.JPG|frame|Not the whole team. Arshath, KC et al.|center]]<br />
<div class="grid_5 alpha"><br />
==== Undergrads ====<br />
<div class="numlist"><br />
# [[#shujing | '''Ee''', Shu-Jing]]<br />
# [[#zhumeng | '''Zhu''', Meng]]<br />
# [[#minghao | '''Li''', Ming-Hao]]<br />
# [[#kc | '''Lim''', Kuan-Chien]]<br />
# [[#mervin | '''Goh''', Feng-Ji Mervin]]<br />
# [[#samuel | '''Lo''', Tat-Ming Samuel]]<br />
# [[#arshath | '''Mohamed''', Arshath]]<br />
# [[#naveen | '''Kodaganti''', Naveen Srivatsav]]<br />
</div></div><br />
<br />
<div class="grid_5 omega"><br />
==== Instructors ====<br />
<div class="numlist"><br />
# Prof. '''Ching''', Chi-Bun<br />
# Asst. Prof. '''Poh''', Chueh-Loo<br />
# Asst. Prof. '''Chang''', Wook Matthew<br />
# Asst. Prof. '''Jiang''', Rong Rong<br />
# Asst. Prof. '''Leong''', Su Jan Susanna<br />
# Asst. Prof. '''Lim''', Mayasari<br />
# Asst. Prof. '''Lim''', Sierin<br />
</div><br />
<br />
==== Advisors ====<br />
<div class="numlist"><br />
# Asst. Prof. '''Lee''', Kijoon<br />
# '''Saeidi''',Nazanin<br />
# '''Ling''', Hua<br />
</div></div><br />
<br />
<div class="grid_10 alpha omega grottom" id="undergrad"><br />
<br />
=== Undergraduates' Profile ===<br />
<br />
<div class="grid_5 alpha profile" id="shujing">[[Image:NTUshujing.jpg|frame|left|Fearless leader]]<div class="profwrite">'''Shu Jing'''<br /><br />
Meet Arshath, our energetic lab manager. Try clicking on Arshath's name in the undergrad list. It should jump to this image. This is the example of the individual profile. If we can crop every picture to the correct size, we can have it nicely framed with a caption as well.If the description extends the picture, this happens.</div><br />
</div><br />
<br />
<div class="grid_5 omega profile" id="zhumeng">[[Image:NTUzhumeng.jpg|frame|left|Silent thinker]]<div class=""profwrite">'''Zhu Meng'''<br /><br />
Meet Arshath, our energetic lab manager. This is the example of the individual profile. If we can crop every picture to the correct size, we can have it nicely framed with a caption as well.</div><br />
</div><br class="clear" /><br />
<br />
<div class="grid_5 alpha profile" id="samuel">[[Image:NTUsamuel.jpg|frame|left|Serious Sam]]<div class="profwrite">'''Samuel'''<br /><br />
Meet Arshath, our energetic lab manager. This is the example of the individual profile.</div><br />
</div><br />
<br />
<div class="grid_5 omega profile" id="kc">[[Image:NTUkc.jpg|frame|left|Team mascot]]<div class="profwrite">'''Kuan Chien'''<br /><br />
Meet Arshath, our energetic lab manager. This is the example of the individual profile. If we can crop every picture to the correct size, we can have it nicely framed with a caption as well.</div><br />
</div><br class="clear" /><br />
<br />
<div class="grid_5 alpha profile" id="mervin">[[Image:NTUmervin.jpg|frame|left|Future doctor]]<div class="profwrite">'''Mervin'''<br /><br />
Meet Arshath, our energetic lab manager. This is the example of the individual profile. If we can crop every picture to the correct size, we can have it nicely framed with a caption as well.</div><br />
</div><br />
<br />
<div class="grid_5 omega profile" id="minghao">[[Image:NTUminghua.jpg|frame|left]]<div class="profwrite">'''Ming Hao'''<br /><br />
Meet Arshath, our energetic lab manager. This is the example of the individual profile. If we can crop every picture to the correct size, we can have it nicely framed with a caption as well.</div><br />
</div><br class="clear" /><br />
<br />
<div class="grid_5 omega profile" id="arshath">[[Image:NTUarshath.jpg|frame|left|Spiritual guide]]<div class="profwrite">'''Arshath'''<br /><br />
Meet Arshath, our energetic lab manager. This is the example of the individual profile. If we can crop every picture to the correct size, we can have it nicely framed with a caption as well.</div><br />
</div><br />
<br />
<div class="grid_5 omega profile" id="naveen">[[Image:NTUnaveen.jpg|frame|left|Mac evangelist]]<div class="profwrite">'''Naveen'''<br /><br />
Meet Arshath, our energetic lab manager. This is the example of the individual profile. If we can crop every picture to the correct size, we can have it nicely framed with a caption as well.</div><br />
</div><br class="clear" /><br />
</div><br />
<br />
<div class="grid_10 alpha omega grottom" id="instad"><br />
<br />
=== Instructors & Advisors ===<br />
The detailed profile of our advisors and instructors will come here.<br />
</div><br />
<br />
</div><br />
{{Template:NTUfooter}}</div>Sjee