"
Team:Bologna/Project
From 2009.igem.org
(→Introduction) |
Marco.cavina (Talk | contribs) |
||
| Line 1: | Line 1: | ||
{{Template:BolognaTemplate}} | {{Template:BolognaTemplate}} | ||
<br> | <br> | ||
| - | + | = '''Introduction''' = | |
| - | + | <font size="3"> | |
Our goal is to create a logic gate based on a post-transcriptional regulation system in Escherichia coli, using RNA to silence gene expression. We inserted a cis-repressing sequence directly upstream of the rbs (ribosome binding site) to realize a "regulated rbs". We also designed the complementary trans-repressing sequence whose function is to recognize and cover the "regulated rbs" and prevent translation from it. Two versions of the trans- repressing sequence were designed with 2 different kinds of rbs covers. We want to use this short non-coding RNA segment placed in trans, to silence translation from dowstream the cis-repressing sequence. | Our goal is to create a logic gate based on a post-transcriptional regulation system in Escherichia coli, using RNA to silence gene expression. We inserted a cis-repressing sequence directly upstream of the rbs (ribosome binding site) to realize a "regulated rbs". We also designed the complementary trans-repressing sequence whose function is to recognize and cover the "regulated rbs" and prevent translation from it. Two versions of the trans- repressing sequence were designed with 2 different kinds of rbs covers. We want to use this short non-coding RNA segment placed in trans, to silence translation from dowstream the cis-repressing sequence. | ||
We developed a [[Team:Bologna/Software|bioinformatic tool]] to research the best sequences. Using the results of our software we changed some base pairs in order to minimize the free energy of the [[RNA secondary structures]]. | We developed a [[Team:Bologna/Software|bioinformatic tool]] to research the best sequences. Using the results of our software we changed some base pairs in order to minimize the free energy of the [[RNA secondary structures]]. | ||
| - | <br> | + | <br><br> |
These are the result sequences: | These are the result sequences: | ||
| + | </font> | ||
<br><br> | <br><br> | ||
| Line 56: | Line 57: | ||
|} | |} | ||
| + | <font size="3"> | ||
<br><br> | <br><br> | ||
When the TRANS-repressor element is present, it binds to the CIS-repressing, forming a RNA duplex and producing an obstruction that prevents the ribosome binding to the RBS: | When the TRANS-repressor element is present, it binds to the CIS-repressing, forming a RNA duplex and producing an obstruction that prevents the ribosome binding to the RBS: | ||
| Line 72: | Line 74: | ||
We decided to realize and developed the third circuit and we started to characterize its parts. | We decided to realize and developed the third circuit and we started to characterize its parts. | ||
<br>(More information in the [[Team:Bologna/Wetlab|Wetlab]] section) | <br>(More information in the [[Team:Bologna/Wetlab|Wetlab]] section) | ||
| + | </font> | ||
Revision as of 10:49, 16 October 2009
| HOME | TEAM | PROJECT | SOFTWARE | MODELING | WET LAB | PARTS | HUMAN PRACTICE | JUDGING CRITERIA |
|---|
Introduction
Our goal is to create a logic gate based on a post-transcriptional regulation system in Escherichia coli, using RNA to silence gene expression. We inserted a cis-repressing sequence directly upstream of the rbs (ribosome binding site) to realize a "regulated rbs". We also designed the complementary trans-repressing sequence whose function is to recognize and cover the "regulated rbs" and prevent translation from it. Two versions of the trans- repressing sequence were designed with 2 different kinds of rbs covers. We want to use this short non-coding RNA segment placed in trans, to silence translation from dowstream the cis-repressing sequence.
We developed a bioinformatic tool to research the best sequences. Using the results of our software we changed some base pairs in order to minimize the free energy of the RNA secondary structures.
These are the result sequences:
| Cis-repressing sequence, inserted upstream of the target gene | |||
| Scar | Cis-repressing | Rbs | Scar |
| TACTAGAG | AACACAAACTATCACTTTAACAACACATTACATATACATTAAAATATTAC | AAAGAGGAGAAA | TACTAGAG |
| Trans-repressor sequence with a cover of 7 bases (long version) | |||
| Scar | Cover | Trans(long) | Scar |
| TACTAGAG | CCTCTTT | GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT | TACTAGAG |
| Trans-repressor sequence with a cover of 4 bases (short version) | |||
| Scar | Cover | Trans(short) | Scar |
| TACTAGAG | CTTT | GTAATATTTTAATGTATATGTAATGTGTTGTTAAAGTGATAGTTTGTGTT | TACTAGAG |
When the TRANS-repressor element is present, it binds to the CIS-repressing, forming a RNA duplex and producing an obstruction that prevents the ribosome binding to the RBS:
These are three genetic circuits that uses Cis-repressing and Trans-repressor:
We decided to realize and developed the third circuit and we started to characterize its parts.
(More information in the Wetlab section)
